<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=AnGordon</id>
		<title>GcatWiki - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=AnGordon"/>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Special:Contributions/AnGordon"/>
		<updated>2026-05-17T04:03:02Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.28.2</generator>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_pLuxR/cI&amp;diff=5947</id>
		<title>Test pLuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_pLuxR/cI&amp;diff=5947"/>
				<updated>2008-07-15T20:17:20Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson/Missouri_Western_iGEM2008&amp;diff=5727</id>
		<title>Davidson/Missouri Western iGEM2008</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson/Missouri_Western_iGEM2008&amp;diff=5727"/>
				<updated>2008-07-02T19:35:02Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* Lux cell signaling system */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;font size = &amp;quot;6&amp;quot;&amp;gt;&amp;lt;center&amp;gt;&lt;br /&gt;
Davidson College - Missouri Western State University&lt;br /&gt;
&amp;lt;/center&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
iGEM 2008&lt;br /&gt;
&amp;lt;/center&amp;gt;&amp;lt;/font&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Contact A Team Member]]==&lt;br /&gt;
&lt;br /&gt;
== [[Team_Projects]] ==&lt;br /&gt;
&lt;br /&gt;
==[[Wet Lab Pages]]==&lt;br /&gt;
&lt;br /&gt;
==[[Math Modeling Pages]]==&lt;br /&gt;
&lt;br /&gt;
== Las/Rhl cell signaling system ==&lt;br /&gt;
'''Responsible''': Robert Cool, Alicia Allen, and Erin Feeney&lt;br /&gt;
&lt;br /&gt;
'''Las System'''&lt;br /&gt;
&lt;br /&gt;
'''Signal Molecule''': An AHL called PAI-1 (N-3-oxododecanoyl-l-hsl)(3-oxo-C12-hsl)&lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': Pseudomonas aeruginosa gram(-)   possibly E.coli (see article 3)&lt;br /&gt;
&lt;br /&gt;
'''Receiver protein''': LasR&lt;br /&gt;
&lt;br /&gt;
'''Effect of binding''': TXN activation of virulence genes, lasA, lasB, apr, toxR&lt;br /&gt;
&lt;br /&gt;
'''Synthase''': LasI enzyme&lt;br /&gt;
&lt;br /&gt;
'''Target Genes''': lasI, lasA, lasB, apr, toxR&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': unknown&lt;br /&gt;
 &lt;br /&gt;
&lt;br /&gt;
'''References'''&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes&amp;quot; &lt;br /&gt;
&lt;br /&gt;
JP Pearson, EC Pesci and BH Iglewski &lt;br /&gt;
[http://jb.asm.org/cgi/reprint/179/18/5756?maxtoshow=&amp;amp;HITS=10&amp;amp;hits=10&amp;amp;RESULTFORMAT=&amp;amp;titleabstract=las&amp;amp;searchid=1&amp;amp;FIRSTINDEX=0&amp;amp;resourcetype=HWCIT]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Regulation of Pseudomonas Quinolone Signal Synthesis in Pseudomonas aeruginosa&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Dana S. Wade, M. Worth Calfee, Edson R. Rocha, Elizabeth A. Ling, Elana Engstrom, James P. Coleman, and Everett C. Pesci&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/187/13/4372?view=long&amp;amp;pmid=15968046 2]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Posttranscriptional Control of Quorum-Sensing-Dependent Virulence Genes by DksA in Pseudomonas aeruginosa&lt;br /&gt;
&lt;br /&gt;
Florence Jude,Thilo Köhler,Pavel Branny,Karl Perron,Matthias P. Mayer,Rachel Comte, and Christian van Delden&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/185/12/3558?view=long&amp;amp;pmid=12775693 3]&lt;br /&gt;
&lt;br /&gt;
Pending: [http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1447470]&lt;br /&gt;
&lt;br /&gt;
'''Rhl System''' &lt;br /&gt;
 &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''Signal Molecule''': An AHL called PAI-2, Plasminogen activator inhibitor-2, N-butanoyl-homoserine lactone (C4HSL) &lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': Pseudomonas aeruginosa, gram(-)&lt;br /&gt;
&lt;br /&gt;
'''Receiver Protein''': Rhl R &lt;br /&gt;
&lt;br /&gt;
'''Effect of Binding''': activation of Rhamnosyl Transferase, then making RL (rhamnolipid) &lt;br /&gt;
&lt;br /&gt;
'''Synthase''': RhlA and RhlB &lt;br /&gt;
&lt;br /&gt;
'''Target Genes''': pqsABCDE and phnAB&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': unknown&lt;br /&gt;
&lt;br /&gt;
'''References'''&lt;br /&gt;
&lt;br /&gt;
[http://jb.asm.org/cgi/reprint/189/13/4827 background information on Las and Rhl]&lt;br /&gt;
&lt;br /&gt;
[[Image:Las_rhl.gif]]&lt;br /&gt;
&lt;br /&gt;
'''Parts Needed''':&lt;br /&gt;
&lt;br /&gt;
LasR + pro/term&lt;br /&gt;
&lt;br /&gt;
RhlR + pro/term&lt;br /&gt;
&lt;br /&gt;
RhlI + pro/term&lt;br /&gt;
&lt;br /&gt;
pqsABCDE + pro/term&lt;br /&gt;
&lt;br /&gt;
pqsR&lt;br /&gt;
&lt;br /&gt;
pqsH + pro/term&lt;br /&gt;
&lt;br /&gt;
phnAB&lt;br /&gt;
&lt;br /&gt;
LasI&lt;br /&gt;
&lt;br /&gt;
RBS&lt;br /&gt;
&lt;br /&gt;
== Lux cell signaling system ==&lt;br /&gt;
&lt;br /&gt;
'''Responsible:''' Andrew Gordon and Pallavi Penumetcha&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule:''' ''N''-acyl-homoserine lactone (AHL) Generic term for a variety of species specific hormone-like molecules &lt;br /&gt;
&lt;br /&gt;
'''Bacterial species:''' discovered in ''Vibrio fischeri'' known to work in ''E. coli''&lt;br /&gt;
&lt;br /&gt;
'''Receiver protein:''' LuxR protein receives signal from AHL; also has some control over transciption of luciferase&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule synthase:''' LuxI; also has some control over transciption of luciferase&lt;br /&gt;
&lt;br /&gt;
'''Additional Information:''' &amp;quot;Quorum Quenching&amp;quot; aiiA (intracellular) lactonase reduces AHL concentration&lt;br /&gt;
&lt;br /&gt;
[[Image:800px-Luxrreceiverschematic.png]]&lt;br /&gt;
&lt;br /&gt;
'''Resources'''&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/Lux Lux Operon Pathway]&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/AHL AHL signaling molecules by species; some are specific to gram pos but may affect gram negs]&lt;br /&gt;
&lt;br /&gt;
[http://www.horizonpress.com/jmmb/v1/v1n1/03.pdf Reducing Crosstalk in Lux System]&lt;br /&gt;
&lt;br /&gt;
'''References'''&lt;br /&gt;
&lt;br /&gt;
[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=522112 Quorum Quenching to control Lux Pathway]&lt;br /&gt;
&lt;br /&gt;
[http://www.nature.com/nature/journal/v434/n7037/full/nature03461.html] A Synthetic multicellular system for programmed pattern formation&lt;br /&gt;
&lt;br /&gt;
'''Parts Needed''':&lt;br /&gt;
&lt;br /&gt;
LuxR + pro/term&lt;br /&gt;
&lt;br /&gt;
RBS&lt;br /&gt;
&lt;br /&gt;
LuxI + pro/term&lt;br /&gt;
&lt;br /&gt;
LuxI sender&lt;br /&gt;
&lt;br /&gt;
== The ainS Quorum Sensing System??? ==&lt;br /&gt;
&lt;br /&gt;
'''References'''&lt;br /&gt;
&lt;br /&gt;
[http://www.medmicro.wisc.edu/labs/mcfall_ruby_papers/pdf/2003/Lupp_Ruby_2003_MolMicro.pdf Synergy of Lux and Ain]&lt;br /&gt;
&lt;br /&gt;
[http://www.medmicro.wisc.edu/labs/mcfall_ruby_papers/pdf/2004/Lupp_Ruby_Jun2004_JBacteriol.pdf Ain induction of Lux]&lt;br /&gt;
&lt;br /&gt;
[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1112039 Layers of Signaling]&lt;br /&gt;
&lt;br /&gt;
[http://www.medmicro.wisc.edu/labs/mcfall_ruby_papers/pdf/2003/Lupp_Ruby_2003_MolMicro.pdf Sequential Induction]&lt;br /&gt;
&lt;br /&gt;
== Lsr (AI-2) cell signaling system ==&lt;br /&gt;
&lt;br /&gt;
'''Responsible''': Kelly Davis, Xiao Zhu&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule''': AI-2 (furanosyl borate diester in V. harveyi, a variety of other molecules in other species), all are derived from DPD. [http://iai.asm.org/cgi/reprint/73/6/3197.pdf AI-2 is R-THMF in E. coli]&lt;br /&gt;
&lt;br /&gt;
[http://www.biomedcentral.com/content/pdf/1471-2148-4-36.pdf]&lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': &lt;br /&gt;
&lt;br /&gt;
lsrA,B,C,D,F,G,R,K: Escherichia coli HS, SMS-3-5, str. K12 substr. MG1655, and substr. DH10B.&lt;br /&gt;
&lt;br /&gt;
lsrE:Escherichia coli str. K12 substr. MG1655 &lt;br /&gt;
&lt;br /&gt;
LuxS:Escherichia coli HS, SMS-3-5, APEC O1, str. K12 substr. MG1655, substr. DH10B, and UTI89.&lt;br /&gt;
&lt;br /&gt;
'''Receiver protein''': LsrR protein receives signal from sensor protein&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule synthase''': Pfs enzyme, then LuxS autoinducer synthase&lt;br /&gt;
&lt;br /&gt;
'''Target genes''': lsr operon, including ABC transporter and LsrK kinase&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': LsrR represses the lsr operon, derepression by phospho-AI-2; catabolite repression influences AI-2 accumulation through the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex, which directly stimulates transcription of the lsr operon and indirectly represses luxS expression.cAMP-CRP is shown to bind to a cAMP receptor protein (CRP) binding site located in the upstream region of the lsr promoter and works with the LsrR repressor to regulate AI-2 uptake.&lt;br /&gt;
&lt;br /&gt;
'''Note:''' AI-2 is synthesized and secreted during exponential growth and is imported in stationary phase when glucose becomes limiting. In the presence of glucose, AI-2 is not imported because the lsr operon is not transcribed due to camp-CAP mediated repression. Both glycerol and G3P(glycerol 3-phosphate) repress lsr transcription, while the majority repression comes from G3P. DHAP represses lsr transcription by a cAMP-CAP-independent mechanism involving LsrR.&lt;br /&gt;
&lt;br /&gt;
'''Parts Needed:'''&lt;br /&gt;
&lt;br /&gt;
LsrR pro/term&lt;br /&gt;
&lt;br /&gt;
LsrK&lt;br /&gt;
&lt;br /&gt;
LsrACDB (transport)&lt;br /&gt;
&lt;br /&gt;
LsrFGE (catabolic)&lt;br /&gt;
&lt;br /&gt;
LuxS&lt;br /&gt;
&lt;br /&gt;
Pfs enzyme (?)&lt;br /&gt;
&lt;br /&gt;
http://gcat.davidson.edu/GcatWiki/images/b/b8/N654260305_1291548_2335.jpg&lt;br /&gt;
&lt;br /&gt;
'''Note:'''&lt;br /&gt;
&lt;br /&gt;
lsrB encodes the periplasmic AI-2 binding protein&lt;br /&gt;
&lt;br /&gt;
lsrC &amp;amp; lsrD encode the channel proteins&lt;br /&gt;
&lt;br /&gt;
lsrA encodes the ATPase that provides energy for AI-2 transport &lt;br /&gt;
&lt;br /&gt;
lsrF is similar to genes specifying aldolases&lt;br /&gt;
&lt;br /&gt;
lsrG encodes a protein with an unknown function. &lt;br /&gt;
&lt;br /&gt;
[http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&amp;amp;Cmd=ShowDetailView&amp;amp;TermToSearch=5591389&amp;amp;ordinalpos=26&amp;amp;itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum tam: trans-aconitate 2-methyltransferase, also known as lsrE or yneD]   [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&amp;amp;Cmd=ShowDetailView&amp;amp;TermToSearch=6061192&amp;amp;ordinalpos=10&amp;amp;itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum yneE:conserved inner membrane protein]&lt;br /&gt;
&lt;br /&gt;
http://gcat.davidson.edu/GcatWiki/images/3/30/N654260305_1340817_550.jpg&lt;br /&gt;
&lt;br /&gt;
[[Image:Har.JPG]] &lt;br /&gt;
[http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&amp;amp;id=55669965 R-THMF]&lt;br /&gt;
http://gcat.davidson.edu/GcatWiki/images/8/8c/S-DPD.gif&lt;br /&gt;
http://www.nature.com/nrmicro/journal/v3/n5/images/nrmicro1146-f2.gif&lt;br /&gt;
&lt;br /&gt;
http://gcat.davidson.edu/GcatWiki/images/c/c9/Grl.jpg&lt;br /&gt;
&lt;br /&gt;
DHAP: dihydroxyacetone phosphate.&lt;br /&gt;
&lt;br /&gt;
http://gcat.davidson.edu/GcatWiki/images/9/9b/Grlw.jpg&lt;br /&gt;
&lt;br /&gt;
'''References'''&lt;br /&gt;
&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/187/6/2066?maxtoshow=&amp;amp;HITS=10&amp;amp;hits=10&amp;amp;RESULTFORMAT=&amp;amp;titleabstract=lsrR&amp;amp;searchid=1&amp;amp;FIRSTINDEX=0&amp;amp;resourcetype=HWCIT Cyclic AMP and cAMP Receptor Protein Influence both Synthesis and Uptake of Extracellular Autoinducer 2 in Escherichia coli]&lt;br /&gt;
&lt;br /&gt;
[http://iai.asm.org/cgi/reprint/IAI.00550-07v1.pdf Global Effects of the Cell-to-Cell Signaling Molecules Autoinducer-2, Autoinducer-3, and Epinephrine in a luxS Mutant of Enterohemorrhagic Escherichia Coli]&lt;br /&gt;
&lt;br /&gt;
[http://www.rsc.org/delivery/_ArticleLinking/DisplayHTMLArticleforfree.cfm?JournalCode=CC&amp;amp;Year=2005&amp;amp;ManuscriptID=b509396a&amp;amp;Iss=38 Shows how AI-2 is formed]&lt;br /&gt;
&lt;br /&gt;
[http://www.jstor.org/sici?sici=0027-8424(20031125)100%3C14549%3ACCAB%3E2.0.CO%3B2-B&amp;amp;cookieSet=1 Signaling explained with graphics of AI-2 pathways]&lt;br /&gt;
&lt;br /&gt;
[http://web.ebscohost.com/ehost/detail?vid=1&amp;amp;hid=116&amp;amp;sid=edfbf2f7-b0c8-40c3-8227-1cc94f134972%40sessionmgr108 Lsr-mediated transport and processing of AI-2 in Salmonella typhimurium]&lt;br /&gt;
&lt;br /&gt;
[http://www.microbialcellfactories.com/content/pdf/1475-2859-1-5.pdf Review of AI-2 and other systems]&lt;br /&gt;
&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/189/16/6011?maxtoshow=&amp;amp;HITS=10&amp;amp;hits=10&amp;amp;RESULTFORMAT=&amp;amp;titleabstract=AI+2+LsrR&amp;amp;searchid=1&amp;amp;FIRSTINDEX=0&amp;amp;resourcetype=HWCIT Quorum Sensing in Escherichia coli Is Signaled by AI-2/LsrR: Effects on Small RNA and Biofilm Architecture]&lt;br /&gt;
&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/187/1/238?maxtoshow=&amp;amp;HITS=10&amp;amp;hits=10&amp;amp;RESULTFORMAT=&amp;amp;titleabstract=quorum+sensing+AI-2&amp;amp;searchid=1&amp;amp;FIRSTINDEX=0&amp;amp;resourcetype=HWCIT Regulation of Uptake and Processing of the Quorum-Sensing Autoinducer AI-2 in Escherichia coli]&lt;br /&gt;
&lt;br /&gt;
'''Resources'''&lt;br /&gt;
&lt;br /&gt;
[http://www.ommscientific.com/ AI-2/DPD]&lt;br /&gt;
&lt;br /&gt;
[http://www.biomedcentral.com/content/pdf/1471-2180-8-98.pdf alternate AI-2 synthesis]&lt;br /&gt;
&lt;br /&gt;
[http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&amp;amp;cmd=Retrieve&amp;amp;dopt=full_report&amp;amp;list_uids=5586283 lsrK gene in Entrez] &lt;br /&gt;
&lt;br /&gt;
[http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&amp;amp;Cmd=ShowDetailView&amp;amp;TermToSearch=6062136&amp;amp;ordinalpos=9&amp;amp;itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum#summary lsrR gene in Entrez]&lt;br /&gt;
&lt;br /&gt;
[http://BioCyc.org/ECOLI/substring-search?type=NIL&amp;amp;object=lsr lsr nucleotide sequence in EcoCyc]&lt;br /&gt;
&lt;br /&gt;
Transcription of LuxS (interaction with micA,gshA)&lt;br /&gt;
&lt;br /&gt;
http://gcat.davidson.edu/GcatWiki/images/c/cb/N654260305_1347432_6212.jpg&lt;br /&gt;
&lt;br /&gt;
== Fec cell signaling system ==&lt;br /&gt;
Responsible: Xiao Zhu, James Barron (DC)&lt;br /&gt;
&lt;br /&gt;
'''Ferric Dicitrate Transport System'''&lt;br /&gt;
The inducer, ferric citrate, binds to an outer membrane transport protein, FecA, and without further transport elicits a signal that is transmitted across the outer membrane (by FecA), the periplasm, and the cytoplasmic membrane (by FecBCDE and FecR) into the cytoplasm. Signal transfer across the three subcellular compartments is mediated by the outer membrane transport protein (FecA) that interacts in the periplasm with a cytoplasmic transmembrane protein (FecR). FecR is required for activation of a sigma factor (FecI) which belongs to the extracytoplasmic function (ECF)sigma factor family.&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
Only iron not iron complex enters the cytoplasm. FecA is the TonB energy transducing system-dependent. &lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Signaling Molecule:''' FeC (ferric dicitrate)&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Bacteria species:''' E.coli, Pseudomonas putida, P. aeruginosa, Serratia marcescens, Klebsiella pneumoniae, Aerobacter aerogenes, Bordetella pertussis, B. bronchseptica, B. avium, and Ralstonia solanacearum.&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Receptor Protein: ''' FecA&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Effect of binding:''' the conformational changes that FecA undergoes when binding to ferric citrate:The alpha helix in loop 7 unravels, and the loop moves by up to 11 angstroms ; Loop 8 moves up to 15 angstroms.&lt;br /&gt;
http://www.rsc.org/ej/CS/2007/b617040b/b617040b-f13.gif&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Sensor Producer:''' N/A&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
Harvard iGEM'07 team worked with Fec system, the results were not favorable. [http://parts.mit.edu/igem07/index.php/Harvard#Quorum_Sensing :We believe that overexpression of the Fec system killed the cells, possibly by disturbing the cell membranes.]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
Regulation of the FecI-type ECF sigma factor by transmembrane signaling&lt;br /&gt;
[http://www.sciencedirect.com/science?_ob=ArticleURL&amp;amp;_udi=B6VS2-4834NW4-1&amp;amp;_user=2665120&amp;amp;_rdoc=1&amp;amp;_fmt=&amp;amp;_orig=search&amp;amp;_sort=d&amp;amp;view=c&amp;amp;_acct=C000058476&amp;amp;_version=1&amp;amp;_urlVersion=0&amp;amp;_userid=2665120&amp;amp;md5=23ac72561c82e74caa6a61b622c3501a]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://pathway.gramene.org/ECOLI/NEW-IMAGE?type=REACTION&amp;amp;object=RXN0-2261 More detailed information about Fec]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=215624&amp;amp;blobtype=pdf Exogenous Induction of the Iron Dicitrate Transport System of Escherichia coli K-12]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/183/1/162 Control of the Ferric Citrate Transport System of Escherichia coli:Mutations in Region2.1 of the FecI ECF Sigma Factor Suppress Mutations in the FecR Transmembrane Regulatory Protein]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/189/19/6913 Docking of the Periplasmic FecB Binding Protein to the FecCD Transmembrane Proteins in the Ferric Citrate Transport System of Escherichia coli]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/abstract/185/6/1870 Interactions between the Outer Membrane Ferric Citrate Transporter FecA and TonB: Studies of the FecA TonB Box]&lt;br /&gt;
&lt;br /&gt;
== Signal molecules ==&lt;br /&gt;
&lt;br /&gt;
[[Image:QSsignals.gif|QSsignals.gif]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Gram (-) bacteria use:'''&lt;br /&gt;
&lt;br /&gt;
3-oxo-C6-HSL, N-(3-oxohexanoyl)-L-homoserine lactone, an AHL&lt;br /&gt;
&lt;br /&gt;
DPD, the AI-2 precursor, 4,5 dihydroxy-2,3-pentanedione&lt;br /&gt;
&lt;br /&gt;
HHQ, 2-heptyl-4(1H)-quinolone, an AQ&lt;br /&gt;
&lt;br /&gt;
'''Gram (+) bacteria use:'''&lt;br /&gt;
&lt;br /&gt;
DPD, the AI-2 precursor, 4,5 dihydroxy-2,3-pentanedione&lt;br /&gt;
&lt;br /&gt;
A-Factor, 2-isocapryloyl-3-hydroxymethyl--butyrolactone&lt;br /&gt;
&lt;br /&gt;
PQS, pseudomonas quinolone signal, 2-heptyl-3-hydroxy-4(1H)-quinolone&lt;br /&gt;
&lt;br /&gt;
DSF, ‘diffusible factor’, cis-11-methyl-2-dodecenoic acid&lt;br /&gt;
&lt;br /&gt;
3OH-PAME, hydroxyl-palmitic acid methyl ester; &lt;br /&gt;
&lt;br /&gt;
AIP-1, staphylococcal autoinducing peptide 1&lt;br /&gt;
&lt;br /&gt;
== E. coli Signaling ==&lt;br /&gt;
&lt;br /&gt;
&amp;quot;As yet no AHL-producing Escherichia coli or Salmonella strains have been identified, although both organisms possess an AHL receptor (SdiA) of the LuxR protein class and respond to AHLs produced by other bacteria.&amp;quot; [http://mic.sgmjournals.org/cgi/reprint/153/12/3923 Williams 2007]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Cell signaling resources ==&lt;br /&gt;
[http://partsregistry.org/Featured_Parts:Cell-Cell-Signaling Featured parts in iGEM registry]&lt;br /&gt;
&lt;br /&gt;
[http://en.wikipedia.org/wiki/Cell_signaling Wikipedia entry]&lt;br /&gt;
&lt;br /&gt;
[http://mic.sgmjournals.org/cgi/reprint/153/12/3923 Quorum sensing, communication and cross-kingdom signalling in the bacterial world]&lt;br /&gt;
&lt;br /&gt;
[http://www.molbio.princeton.edu/index.php?option=content&amp;amp;task=view&amp;amp;id=27 Bonnie Bassler lab at Princeton]&lt;br /&gt;
&lt;br /&gt;
[http://www.nottingham.ac.uk/quorum/ One-Stop Shopping for QS from Nottingham]&lt;br /&gt;
&lt;br /&gt;
[http://journals.royalsociety.org/content/w26732234707/?p=c1685368363e450faabedd3ee8fd60dc&amp;amp;pi=3 Special Issue: Bacterial conversations: talking, listening and eavesdropping]&lt;br /&gt;
&lt;br /&gt;
[http://library.albany.edu/science/whatsnew_dialogs.htm Dialogs with Bacteria: Quorum Sensing]&lt;br /&gt;
&lt;br /&gt;
[http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/C/CellSignaling.html General Types of Cell Signaling: Bacteria on Steroids?]&lt;br /&gt;
&lt;br /&gt;
[http://www.samsi.info/200405/compbio/workinggroup/cell/Eungdamrong_Iyengar_Biology_of_the_Cell_96_355_2004.pdf Modeling Cell-Signaling Networks]&lt;br /&gt;
&lt;br /&gt;
[http://journals.royalsociety.org/content/m5hgygq1t6daxy72/fulltext.pdf Quorum Sensing and the Population Control of Virulence]&lt;br /&gt;
&lt;br /&gt;
== Davidson Journal Club ==&lt;br /&gt;
&lt;br /&gt;
[http://www.bio.davidson.edu/courses/synthetic/papers/Stochastic_Cells.pdf Stochasticity and Gene Expression --- Dr. Campbell]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/cryptography_graph.pdf Hash Function --- Dr. Heyer]&lt;br /&gt;
&lt;br /&gt;
== iGEM 2007 Useful Information ==&lt;br /&gt;
'''Virginia Tech''' &lt;br /&gt;
&lt;br /&gt;
''Engineering and Epidemic''&lt;br /&gt;
&lt;br /&gt;
The use of bacteria to model the spread of a disease.  It would appear that cell-to-cell communication is a major part of the design of the project.  It is unclear how successful the team was in building parts useful to us.  Most of the project seems to be on the mathematical modeling side of things.&lt;br /&gt;
&lt;br /&gt;
The use of bacteria to model the spread of a disease. It would appear that cell-to-cell communication is a major part of the design of the project. It is unclear how successful the team was in building parts useful to us. Most of the project seems to be on the mathematical modeling side of things. &lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Virginia_Tech&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''University of Waterloo'''&lt;br /&gt;
&lt;br /&gt;
''Half-Adder Logic Gate''&lt;br /&gt;
&lt;br /&gt;
The goal of this project is to design a basic device for computing. Our idea was to reproduce a circuit element called a half adder with DNA, which takes in two 1-bit inputs, adds them, and outputs a sum and a carry. Our device responds to two inputs: red light and the chemical tetracycline. The input sensors control a set of genetic switches in order to carry out the computation and fluoresces green, red, or neither, depending on the outcome.  Useful for long addition in base-2.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Waterloo&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''UCSF'''&lt;br /&gt;
&lt;br /&gt;
''Project 1: Protein Scaffolds as a Molecular Breadboard''&lt;br /&gt;
&lt;br /&gt;
Using synthetic protein scaffolds to control information flow of a kinase pathway in eukaryotic cells.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/UCSF&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tianjin'''&lt;br /&gt;
&lt;br /&gt;
''Biological diode''&lt;br /&gt;
&lt;br /&gt;
In this project, we try to construct a biological device to imitate the function of the diode, one of the most significant parts in the electric integrate circuit. The flow of molecular signal AHL is considered as the current of electric circuit. The generator, amplifiers, blocks and detector cells are constructed with the parts provided by MIT and then are equipped in series in order to establish the cellular and molecular biological diode. Our device, which is a combination of technologies from the field of computer science, molecular biology and chemical engineering, is a breakthrough for the application of mature techniques of chemical engineering to the field of synthetic biology.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tianjin&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Duke University'''&lt;br /&gt;
&lt;br /&gt;
''Bacterial Communication With Light''&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''University of Cambridge'''&lt;br /&gt;
&lt;br /&gt;
''BOL: Bacteria OnLine''&lt;br /&gt;
&lt;br /&gt;
They talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tokyo Tech'''&lt;br /&gt;
&lt;br /&gt;
''Pareto's Principle: An Ant Society''&lt;br /&gt;
&lt;br /&gt;
The goal of our project is to make a bacterial society that follows Pareto's principle as an ant society does. On the other word, we try to construct a bacterial system which takes &amp;quot;balanced differentiation&amp;quot;. Bistability and cell-cell communication are necessary to realize our model of &amp;quot;Balanced differentiation&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Quorum Sensing'''&lt;br /&gt;
[http://www.nottingham.ac.uk/quorum/index.htm See this quorum sensing web page]&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
&lt;br /&gt;
''Quorum Sensing''&lt;br /&gt;
&lt;br /&gt;
Was developing a luxL luxR quorum sensing system using OHHL. Lux quorum-sensing works like a system of sender and receiver.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Harvard#Quorum_Sensing&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Chiba'''&lt;br /&gt;
&lt;br /&gt;
''Communication Unit''&lt;br /&gt;
&lt;br /&gt;
Something about cell to cell communication involving LuxL, LuxR, and AHL. Hard to understand because they did not translate into English very well.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Chiba/Communication&lt;br /&gt;
&lt;br /&gt;
    &lt;br /&gt;
'''Brown'''&lt;br /&gt;
&lt;br /&gt;
''Cellular Lead Sensor''&lt;br /&gt;
&lt;br /&gt;
-no useful information&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Brown   &lt;br /&gt;
   &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Colombia-Israel (ORT Ebin High School)'''&lt;br /&gt;
&lt;br /&gt;
''A Microbial Biosensor Device'' &lt;br /&gt;
&lt;br /&gt;
No description left...&lt;br /&gt;
&lt;br /&gt;
- http://parts.mit.edu/igem07/index.php/Colombia-Israel%20(ORT%20Ebin%20High%20School) &lt;br /&gt;
&lt;br /&gt;
    &lt;br /&gt;
'''Edinburgh'''&lt;br /&gt;
&lt;br /&gt;
''Division PoPper'' and ''Self Flavouring Yoghurt'' &lt;br /&gt;
&lt;br /&gt;
- This team is working on a project that is looking into a form of cell communication &lt;br /&gt;
&lt;br /&gt;
- &amp;quot;We designed a signal generator device that produces an output in the form of PoPS pulses each time a bacteria undergoes cell division. Therefore it may trigger actions as a function of cell replication.&amp;quot; &lt;br /&gt;
&lt;br /&gt;
- Could not find where on this page this info came from, but it was included with this link:&lt;br /&gt;
''- The goal of this project is to design a basic device for computing. Our idea was to reproduce a circuit element called a half adder with DNA, which takes in two 1-bit inputs, adds them, and outputs a sum and a carry. Our device responds to two inputs: red light and the chemical tetracycline. The input sensors control a set of genetic switches in order to carry out the computation and fluoresces green, red, or neither, depending on the outcome. Useful for long addition in base-2.'' &lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Edinburgh#The_Projects.21&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Imperial'''&lt;br /&gt;
&lt;br /&gt;
''Infector Detector''&lt;br /&gt;
&lt;br /&gt;
-no useful information, but really interesting project...&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Imperial + UCSF (2007)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Middle East Technical University'''&lt;br /&gt;
&lt;br /&gt;
Chase simulator &lt;br /&gt;
&lt;br /&gt;
This project was not completed, but has some interesting information on E. coli cells triggering a response in nearby E. coli cells.&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Chase_Simulator&lt;br /&gt;
&lt;br /&gt;
== iGEM 2006 Useful Information ==&lt;br /&gt;
'''UT Austin 2005/2006'''&lt;br /&gt;
Project : Edge Detector &lt;br /&gt;
Link to parts: http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM&amp;amp;group=iGEM_UTAustin&lt;br /&gt;
&lt;br /&gt;
Useful information: &lt;br /&gt;
They  have &amp;quot;black boxed&amp;quot; the light-system and used it as an input for the of the edge detection circuitry. &lt;br /&gt;
&lt;br /&gt;
Edge Detector Circuit and logic. The light sensing machinery from above has been black-boxed and the edge detection circuitry has been added downstream. Red light represses the expression of 2 genes; a biosynthetic gene for a membrane diffusible quorum sensing activator (AHL), and a dominant transcriptional repressor (cI). (Right) The output of the circuit (Z;Beta-galactosidase) is ON only in the presence of X (AHL) and the absence of Y (cI). This can only occur at the light/dark boundary.&lt;br /&gt;
&lt;br /&gt;
Note: Built on 2005’s work. Pretty much the same as 2005. &lt;br /&gt;
&lt;br /&gt;
 &lt;br /&gt;
&lt;br /&gt;
''' Harvard'''&lt;br /&gt;
“Cell Surface Targeting” &lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Harvard_2006&lt;br /&gt;
&lt;br /&gt;
Project Overview&lt;br /&gt;
“In order to target nanostructures to cells, we developed adaptamers, universal nucleic acid adaptars which can link two substrates.&lt;br /&gt;
•	Such an interface could also be used to link together entire cells for the study of cell-cell interactions and the linkage of two interacting proteins, in effect creating a nucleic acid enzyme.&lt;br /&gt;
•	Adaptamers generally depend on aptamers, short sequences of nucleic acid that bind with high specificity and affinity to particular substrates.&lt;br /&gt;
•	Tahiri-Alaoui et al. created the first aptamer in 2002, consisting of two aptamer sequences linked together by a bulky basepairing region ~100 nucleotides long.&lt;br /&gt;
•	Our goal was to create an adaptamer that could link together streptavidin and thrombin. Delivery of thrombin to a streptavidin-coated magnetic bead would show the potential for delivery of a macromolecule to a cell surface.&lt;br /&gt;
Additionally, we wished to be able to be able to quench adaptamer function through the addition of an adapatamer-disabling oligonucleotide.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''The University of Calgary''' 2006 iGEM team is working on the following project. A petri plate is inhabited by two strains of genetically engineered ''E. coli'' bacteria. The first strain---the Senders---have been engineered to emit two chemical signals into the plate environment: Aspartate and Acyl Homoserine Lactone (AHSL). The senders themselves are activated by light. The second strain---the Receivers---have been designed to respond to each of these signals in a different way.&lt;br /&gt;
The Receivers express Green Fluorescent Protein in the vicinity of AHSL.&lt;br /&gt;
The Receivers also move towards areas of greater Aspartate concentration. The same bacteria also decrease Aspartate levels where they are present, as this is a nutrient and constitutes the reason for why they are attracted to it in the first place.&lt;br /&gt;
Our goal is to make the Senders and Receivers create interesting behaviour dynamics visualized by fluorescent patterns.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM2006&amp;amp;group=iGEM2006_Calgary&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Berkeley''': networks of cells communicating via conjugation; demonstrated the transmission of a coded message&lt;br /&gt;
&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/University_of_California_Berkeley_2006&lt;br /&gt;
&lt;br /&gt;
“We have developed the process of addressable conjugation for communication within a network of E. coli bacteria. Here, bacteria send messages to one another via conjugation of plasmid DNAs, but the message is only meaningful to cells with a matching address sequence. In this way, the Watson Crick base-pairing of addressing sequences replaces the spatial connectivity present in neural systems. To construct this system, we have adapted natural conjugation systems as the communication device. Information contained in the transferred plasmids is only accessable by &amp;quot;unlocking&amp;quot; the message using RNA based 'keys'. The resulting addressable conjugation process is being adapted to construct a network of NAND logic gates in bacterial cultures.”&lt;br /&gt;
&lt;br /&gt;
'''Mexico''': cellular automata&lt;br /&gt;
&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/IPN_UNAM_2006&lt;br /&gt;
&lt;br /&gt;
“We wish contribute to the iGEM project development various protein based bio-components. We will work along three main lines: complex and reversible dynamical systems and formal languages, that support particles and multiple reactions, related to the molecular transformations.”&lt;br /&gt;
&lt;br /&gt;
“We study two-dimensional cellular automaton, where every cell takes states 0 and 1 and updates its state depending on sum of states of its 8 closest neighbors as follows. Cell in state 0 takes state 1 if there are exactly two neighbors in state 1, otherwise the cell remains in state 0. Cell in state 1 remains in state 1 if there are exactly seven neighbors in state 1, otherwise the cell switches to state 0. CA governed by such cell-state transition rule exhibits reaction-diffusion like pattern dynamics, so we call this Diffusion Rule.”&lt;br /&gt;
&lt;br /&gt;
“Using the diffusion rule we can generate a dynamical pattern over a system, like turn on/off ligth with alive o dead cells that shows a luminescence, examples include fluorescence, bioluminescence and phosphorescence.”&lt;br /&gt;
“Starting with any configuration, the cells alive are represented in yellow (the activator) and dead in black (the inhibitor), see figure 4. The system is created defining an inicial state over the base configuration (see figure 3). The luminescence is obtained by the evolution of this initial pattern.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Brown:Bacterial''' Freeze Tag&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Brown:Bacterial_Freeze_Tag#Overview&lt;br /&gt;
2006 igem&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This project involves programming bacteria to be able to play a game of freeze tag. Bacteria will be engineered to swim around a microfluidics device until they reach a certain proximity to the 'IT' cell and then they will lose their ability to move. This loss of motility will be combined with a change in color from Green to Blue. When another bacterium, which is moving (not the 'IT' cell), reaches a certain proximity to the 'frozen' bacteria it will again regain its ability to move and turn from Blue to Yellow.&lt;br /&gt;
&lt;br /&gt;
TetR promoted with LuxI downstream. LuxI is an enzyme that produces AHL and will produce the red fluorescent protein (RFP). The AHL produced is exported from the cell where it then forms a complex with the LuxR protein that is produced by the AHL sensor within the Receiver cell.&lt;br /&gt;
&lt;br /&gt;
The AHL sensor is TetR promoted and forms the LuxR protein which then forms a complex with AHL. This LuxR and AHL complex then activates the pLuxR promoter. Downstream of the pLuxR promoter is the LacI protein. LacI inhibits the pLac promoter on the &amp;quot;Freeze Machine&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
A promoter that is regulated by LacI will promote the production of LasI, MotB, and cI. This will subsequently inhibit the production of CFP and LasR. In the presence of LacI, however, MotB, LasI, and cI will not be produced. CFP will therefore be produced along with LasR and LacI. This results in the &amp;quot;freezing&amp;quot; of the cell.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''McGill University Split YFP'''&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/McGill_University_2006&lt;br /&gt;
&lt;br /&gt;
The idea behind the project is fluorescence complementation, which involves the joining of two leucine zipper proteins, Fos and Jun, each fused to a half terminus of YFP. Originally, the Fos and Jun proteins were fused to a beta gene coding for a membrane protein. The project involved performing a PCR reaction to produce two inserts, the N-terminus and the C-terminus of YFP, and then ligating these inserts into 2 vectors, containing Jun-beta and the Fos-beta respectively. The two fusion proteins (Fos-beta-YFPC and Jun-beta-YFPN) were expressed in the cell membrane of two populations of E. coli. We then allowed these two cell types to combine, resulting—ideally—in the complementary binding of the Jun and Fos proteins when the cells are in close contact. Consequently, the two half YFP fragments bind to form full YFP, and the cells will fluoresce.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Penn State'''&lt;br /&gt;
http://openwetware.org/wiki/IGEM:PennState/2006&lt;br /&gt;
&lt;br /&gt;
The bacterial relay race takes advantage of an ability to control cellular motility using inducible promoters such as those involved in nutrient catabolism or quorum sensing. “Receiver” bacteria move in response to small-molecule signals either added to the system or originating from motile, “sender” strains. The most significant challenges relating to this project stem from difficulties of tightly controlling the target motility gene motB. Low levels of motB expression result in system failure (constitutive motility), and resolving this issue is essential to developing reliable modular systems that are the hallmark of synthetic biology&lt;br /&gt;
&lt;br /&gt;
'''Tokyo'''&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Tokyo_Alliance:_Conclusion&lt;br /&gt;
&lt;br /&gt;
Our project is to make this Noughts-and-Crosses in vivo.&lt;br /&gt;
-1.	Inputs&lt;br /&gt;
-1.	Chemicals&lt;br /&gt;
-1.	To indicate each square&lt;br /&gt;
-1.	To be spreaded into all squares.&lt;br /&gt;
-1.	Outputs&lt;br /&gt;
-1.	Reporter of SYANAC: GFP&lt;br /&gt;
Reporter of Human: RFP&lt;br /&gt;
&lt;br /&gt;
We can say we will expand the number of regulator genes we can use to build logic gates and through this project we made simple constructing method.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''BU 2006''' &lt;br /&gt;
Project: build a functioning &amp;quot;Biological Night-Light&amp;quot; system&lt;br /&gt;
&lt;br /&gt;
Link to parts : http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM2006&amp;amp;group=iGEM2006_BU&lt;br /&gt;
Goal&lt;br /&gt;
Isolate luxCDABE and add the 4 BioBrick restriction sites to the ends of the gene.&lt;br /&gt;
Ideas&lt;br /&gt;
&amp;quot;Proteins that affect the wavelength of the emitted light, lumazine and yellow fluorescent protein, have been isolated from Photobacterium and Vibrio species, respectively. The lumazine proteins shift the color of the light to wavelengths shorter than 490 nm...&amp;quot; (Meighen 1991) Perhaps we could build a circuit to modulate the emitted wavelength by periodically expressing a carefully-chosen fluoresent protein. Think FRET and BRET.&lt;br /&gt;
&lt;br /&gt;
Let's modify the lux operon so our bacteria can play Conway's Game of Life. In the game, discrete &amp;quot;cells&amp;quot; interact with one another according to four extremely simple rules, which essentially boil down to this: if a cell has too many or too few neighbors it turns off, otherwise it turns/stays on. These rules and the initial state of all the cells often produce systems of fascinating and lifelike complexity. Perhaps we could add a circuit such that LuxI would only be activated in response to a narrow &amp;quot;medium&amp;quot; range of concentrations of its autoinducer (3OC6HSL), not too much or too little. In fact, I think such a circuit has already been built by the Weiss lab and demonstrated with their infamous bullseye. &lt;br /&gt;
&lt;br /&gt;
'''Weiss Lab: Game of Life'''&lt;br /&gt;
Link: http://www.princeton.edu/~rweiss/&lt;br /&gt;
Note: Weiss Lab build a system that enables cells to “play” Conway’s Game of Life, where cells live or die based on the density of their neighbors.  This system exhibits complex global emergent behavior that arises from the interaction of cells based on simple local rules.&lt;br /&gt;
&lt;br /&gt;
Another system is a pulse generator where sender cells communicate to nearby receiver cells, which then respond with a transient burst of gene expression whose amplitude and duration depends on the distance from the senders. In another system, receiver cells have been engineered to respond to cell-cell communication signals from senders. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Bangalore NCBS 2006'''&lt;br /&gt;
	Synchronization of bacterial cell cycles. Use a cell cycle-dependent promoter to drive a LuxI-LuxR based cell-cell signal. Use regulation of replication initiator DnaA to modulate cell cycle in receiver cells. Immediate goals: To determine if candidate promoters oscillate; to regulate DnaA levels&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Workshop&lt;br /&gt;
&lt;br /&gt;
'''Rice University 2006'''&lt;br /&gt;
The objective of this project is to engineer Escherichia coli which are able to actively pursue and mark or eliminate another bacterial target. This system can be divided into three components: an input element, a processing element, and a response element. The input element will consist of a quorum sensing circuit which would allow specific detection of the bacterial target. The processing element will facilitate the signaling of this input into controlled responses. A number of different response elements can be conceived, to be used separately or in tandem: 1) integration into the chemotactic pathway of E. coli, allowing for directed mobilization towards the target, 2) reporter response at high pheromone concentrations to allow for visual identification of the target location (e.g., GFP production), and 3) an elimination response to produce molecules which are specifically lethal to the desired target.&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/PROJECT_PROPOSAL&lt;br /&gt;
&lt;br /&gt;
'''Cambridge''': http://parts.mit.edu/wiki/index.php/Cambridge_University_2006&lt;br /&gt;
&lt;br /&gt;
The type 1 cell produces 3O-C6-HSL (represented by the small yellow cannon ball) while type 2 produces 3O-C12-HSL (represented by the blue cannon ball).  The type 1 cell responds to 3O-C12 HSL and type 2 responds to 3O-C6 HSL. The response of type 1 cells can be visualized through the expression of RFP. The response of type 2 cells can be visualized through the expression of GFP.&lt;br /&gt;
&lt;br /&gt;
1.	Parts used for generating patterns (these are parts whose function Cambridge characterized) &lt;br /&gt;
 (a) Constitutively expressed fluorescent proteins:&lt;br /&gt;
ECFP: BBa_I13601&lt;br /&gt;
GFP: BBa_J04430&lt;br /&gt;
EYFP: BBa_I6031&lt;br /&gt;
mRFP1: BBa_J04450 &lt;br /&gt;
(b) Constitutive or auto-induced AHL synthesis:&lt;br /&gt;
Lux-sender (auto-inducing): BBa_I15030&lt;br /&gt;
Las-sender (constitutive): BBa_I0407&lt;br /&gt;
Rhl-sender (constitutive): BBa_I0405&lt;br /&gt;
Cin-sender (constitutive): BBa_I0409  &lt;br /&gt;
(c) AHL-induced fluorescence response:&lt;br /&gt;
Lux-receiver (GFP): BBa_T9002&lt;br /&gt;
Lux-receiver (EYFP): BBa_I13263&lt;br /&gt;
Las-receiver (EYFP): BBa_I0426&lt;br /&gt;
Rhl-receiver (EYFP): BBa_I0424&lt;br /&gt;
Cin-receiver (EYFP): BBa_I0428&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Princeton''': http://parts.mit.edu/wiki/index.php/Princeton:Project_Summary&lt;br /&gt;
&lt;br /&gt;
Mammalian cell-cell signaling using LuxR and LuxI…not applicable&lt;br /&gt;
&lt;br /&gt;
== iGEM 2005 Useful Information ==&lt;br /&gt;
'''Caltech'''&lt;br /&gt;
http://www.cds.caltech.edu/~murray/synbio/wiki/index.php?title=Main_Page&amp;amp;direction=prev&amp;amp;oldid=52 &lt;br /&gt;
AND gates used to build an adder (oligo technology, Winfree lab)&lt;br /&gt;
http://www.cds.caltech.edu/%7Emurray/synbio/wiki/images/5/55/Chen-surf05.pdf&lt;br /&gt;
&lt;br /&gt;
Massive models: http://www.cds.caltech.edu/%7Emurray/synbio/wiki/images/4/44/Ho-surf05.pdf&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Cambridge''' &lt;br /&gt;
http://www.ccbi.cam.ac.uk/iGEM2005/index.php/Main_Page&lt;br /&gt;
Used sender/pulse-generator from Princeton to do something?&lt;br /&gt;
AHL signal and aTc activated promoter&lt;br /&gt;
Important paper in PNAS where this is shown to work:&lt;br /&gt;
http://www.princeton.edu/~rweiss/papers/basu-pulse-2004.pdf&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
http://bio.freelogy.org/wiki/IGEM_2005&lt;br /&gt;
Bacterial wire propogates signal of AHL&lt;br /&gt;
&lt;br /&gt;
'''MIT 2005'''&lt;br /&gt;
The first way we might build such a system involves the direct communication of an antigen, which can be just about anything, with the cell; this is accomplished by attaching an antibody to the cell in such a way that the binding of an antigen to the antibody initiates a signalling cascade that terminates in PoPs. The main benefit of such a system is that it can stand alone, and is thus a viable solution to problems such as &amp;quot;how do we deploy our biosensor into a lake where it can respond to toxin levels?&amp;quot; The main issue to be dealt with is that this system is in some ways less modular; of course, anyone could just follow our steps and hook up their scFv sequence of choice.&lt;br /&gt;
http://openwetware.org/wiki/IGEM:MIT/2005/Direct_communication_of_antigen_and_receiver&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''UC Berkley 2005'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/UC_Berkeley_2005&lt;br /&gt;
&lt;br /&gt;
Conjugation is a process through which cells can exchange genetic material on plasmids. Conjugal plasmids (in our case incF and incP plasmids) carry the machinery necessary to transfer themselves in the form of mating pair formation (mpf) and DNA transfer (dtr) genes. Conjugation is under the control of the TraJ regulatory protein, which when expressed induces a cascade that results in the formation of a pore by mpf genes and then subsequent nicking, rolling circle replication and transfer of one strand of the plasmid by the relaxosome complex and other dtr proteins. The relaxosome nicks the plasmid at the OriT region and then covalently attaches one of its subunits to the 5' end of the plasmid DNA, and by doing so it is able to drag the plasmid across the pore formed by the mpf machinery by means of a coupling protein. Upon reaching its destination, the single strand of plasmid DNA is recircularized and a complement strand is synthesized by transferred primases.&lt;br /&gt;
&lt;br /&gt;
Non-mobile synthetic F plasmid: Begins the conjugation signal, which it sends to plasmid B. Also contains the CFP tag which identifies the host cell as &amp;quot;F-type&amp;quot;, and always produces mRNA 'key 2' which unlocks RNA lock 2&lt;br /&gt;
&lt;br /&gt;
-1.	-B - Non-mobile almost-wild F plasmid: Contains all F-plasmid genes EXCEPT OriTf, TraJf. Plasmid receives and propagates the conjugation signal from TraJf in plasmid 1-A and sends the signal to OriTf in 1-C&lt;br /&gt;
1-C - Mobile F plasmid: Contains the OriTf site which receives signal from plasmid 1-B. This plasmid then leaves the host cell and enters the conjugating recipient cell. Holds encrypted message (produce cI --&amp;gt; turn on GFP to signify &amp;quot;message 1 received&amp;quot;) secured by RNA lock 1.&lt;br /&gt;
&lt;br /&gt;
2-A Non-mobile synthetic R plasmid: Always produces mRNA 'key1'. Thus when it receives 'lock1' (sent by mobile plasmid 1-C) it can open the latter and produce cI, which will activate plasmid 1-C (turn on GFP, &amp;quot;message 1 received&amp;quot;) and simultaneously activate TraJr (start R conjugation cascade)&lt;br /&gt;
&lt;br /&gt;
-1.	2-B Non-mobile almost-wild R plasmid: Just like 1-B, contains all of the wild type R-plasmid EXCEPT OriTr and TraJr. Propagates TraJr signal from 2-A and sends it to OriTr&lt;br /&gt;
2-C Mobile R plasmid: Contains the OriTr site, which receives signal from plasmid 2-B. This plasmid then leaves the host cell and submits its message back into cell #1&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Penn State'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php?title=Penn_StateProjectDes&lt;br /&gt;
&lt;br /&gt;
”The idea for our project grew out of one for a &amp;quot;bacterial maze,&amp;quot; in which bacteria would use logic to make their way through a microfabricated labrynth. This seemed slightly too difficult, so we linearized the the concept and added transfer of a signal; the idea was then dubbed a &amp;quot;bacterial relay race.&amp;quot;&lt;br /&gt;
As in a conventional relay race, the signal is to &amp;quot;go,&amp;quot; or induce motility of a latter stage participant. This is accomplished by passing a baton. In our case, the participants are E. coli, and the baton is a quorum sensing molecule, 3OC6HSL (we have another strategy that utilizes conjugation rather than quorum sensing to mediate the signal).&lt;br /&gt;
In addition to passing the signal, though, the first participant must stop. We explored this option, but settled instead on terminating the first participant. In our design we really do kill the messanger.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Arizona'''  &lt;br /&gt;
“Water Color” &lt;br /&gt;
http://parts.mit.edu/wiki/index.php/University_of_Arizona_2006&lt;br /&gt;
&lt;br /&gt;
Project Details&lt;br /&gt;
“The current name of our project is &amp;quot;Water Color.&amp;quot; It is a system that selectively expresses one of three florescence proteins. Each of the three florescence proteins will be expressed in the presence of a unique inducer. Each florescent protein will be controlled by a unique repressed promoter. Thus we will have the expression of three flourescent proteins activated by the presence of there respective inducers.&lt;br /&gt;
The idea of our project is to have a media with these cells on it so that each cell will be individually activated to shown a certain &amp;quot;color&amp;quot; (in actuallity, express one florescent protein, which may or may not look unique). Thus the media is able to dispaly an image. The spacial resolution with determine how much it will look like an image. A further idea, to be implemented later (time permitting), is to have the ability to &amp;quot;erase&amp;quot; the image. This would be accomplished by repressing all three promoters. Currently, there are no plans to implement this.”&lt;br /&gt;
&lt;br /&gt;
Flowchart of Parts: http://parts.mit.edu/wiki/index.php/University_of_Arizona_2006/Parts_Schedule&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
http://bio.freelogy.org/wiki/IGEM_2005&lt;br /&gt;
&lt;br /&gt;
'''UC Berkley 2005'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/UC_Berkeley_2005&lt;br /&gt;
&lt;br /&gt;
Conjugation is a process through which cells can exchange genetic material on plasmids. Conjugal plasmids (in our case incF and incP plasmids) carry the machinery necessary to transfer themselves in the form of mating pair formation (mpf) and DNA transfer (dtr) genes. Conjugation is under the control of the TraJ regulatory protein, which when expressed induces a cascade that results in the formation of a pore by mpf genes and then subsequent nicking, rolling circle replication and transfer of one strand of the plasmid by the relaxosome complex and other dtr proteins. The relaxosome nicks the plasmid at the OriT region and then covalently attaches one of its subunits to the 5' end of the plasmid DNA, and by doing so it is able to drag the plasmid across the pore formed by the mpf machinery by means of a coupling protein. Upon reaching its destination, the single strand of plasmid DNA is recircularized and a complement strand is synthesized by transferred primases.&lt;br /&gt;
&lt;br /&gt;
Non-mobile synthetic F plasmid: Begins the conjugation signal, which it sends to plasmid B. Also contains the CFP tag which identifies the host cell as &amp;quot;F-type&amp;quot;, and always produces mRNA 'key 2' which unlocks RNA lock 2&lt;br /&gt;
&lt;br /&gt;
-1.	-B - Non-mobile almost-wild F plasmid: Contains all F-plasmid genes EXCEPT OriTf, TraJf. Plasmid receives and propagates the conjugation signal from TraJf in plasmid 1-A and sends the signal to OriTf in 1-C&lt;br /&gt;
1-C - Mobile F plasmid: Contains the OriTf site which receives signal from plasmid 1-B. This plasmid then leaves the host cell and enters the conjugating recipient cell. Holds encrypted message (produce cI --&amp;gt; turn on GFP to signify &amp;quot;message 1 received&amp;quot;) secured by RNA lock 1.&lt;br /&gt;
&lt;br /&gt;
2-A Non-mobile synthetic R plasmid: Always produces mRNA 'key1'. Thus when it receives 'lock1' (sent by mobile plasmid 1-C) it can open the latter and produce cI, which will activate plasmid 1-C (turn on GFP, &amp;quot;message 1 received&amp;quot;) and simultaneously activate TraJr (start R conjugation cascade)&lt;br /&gt;
&lt;br /&gt;
-1.	2-B Non-mobile almost-wild R plasmid: Just like 1-B, contains all of the wild type R-plasmid EXCEPT OriTr and TraJr. Propagates TraJr signal from 2-A and sends it to OriTr&lt;br /&gt;
2-C Mobile R plasmid: Contains the OriTr site, which receives signal from plasmid 2-B. This plasmid then leaves the host cell and submits its message back into cell #1&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5718</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5718"/>
				<updated>2008-07-02T16:17:38Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Parallel Biobrick Assembly'''&lt;br /&gt;
&lt;br /&gt;
'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
K091107 + B0034 + K091109 + B0034 + C0072 + B0015[B0010+B0012]&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1A || B0015 || Double Terminator || RX/SP || RX || 129bp || C0072 || Mnt Gene || RX/SP || RS || 288bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 1B || B0034 || RBS  || RX/SP || RX || 12bp || K091109 || LuxS Gene || RX/SP || RS || 516bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 2 || B0034 || RBS || RX/SP || SP || 12bp || Product of 1B || LuxS + RBS || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Product of 2 || RBS + LuxS + RBS || RX/SP || SP ||  || Product of 1A || Mnt Gene + TT || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 4 || K091107 || pLux/cI || RX/SP || SP ||  || Product of 3 || RBS + LuxS + RBS + Mnt + TT || RX/SP || XP ||  || Objective 1 || &lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Parts'''&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;40&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;110&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;60&amp;quot;|Source&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|location('07)&lt;br /&gt;
!width=&amp;quot;35&amp;quot;|Vector&lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_B0015 B0015]||double terminator ||registry 07 ||Plt.1-1I;Plt.3-3O ||pSB1AK3 &lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_B0034 B0034] ||RBS ||registry 07 ||Plt.1-3O ||pSB1A2&lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_C0072 C0072] ||Mnt Gene ||registry 07 ||Plt.2-5M ||pSB2K3 &lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_K091107 K091107] ||pLux/cI || N/A || || &lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_K091109 K091109] ||LuxS || N/A || || &lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5717</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5717"/>
				<updated>2008-07-02T16:16:54Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Parallel Biobrick Assembly'''&lt;br /&gt;
&lt;br /&gt;
'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
K091107 + B0034 + K091109 + B0034 + C0072 + B0015[B0010+B0012]&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1A || B0015 || Double Terminator || RX/SP || RX || 129bp || C0072 || Mnt Gene || RX/SP || RS || 288bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 1B || B0034 || RBS  || RX/SP || RX || 12bp || K091109 || LuxS Gene || RX/SP || RS || 516bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 2 || B0034 || RBS || RX/SP || SP || 12bp || Product of 1B || LuxS + RBS || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Product of 2 || RBS + LuxS + RBS || RX/SP || SP ||  || Product of 1A || Mnt Gene + TT || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 4 || K091107 || pLux/cI || RX/SP || SP ||  || Product of 3 || RBS + LuxS + RBS + Mnt + TT || RX/SP || XP ||  || Objective 1 || &lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Parts'''&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;40&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;110&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;60&amp;quot;|Source&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|location('07)&lt;br /&gt;
!width=&amp;quot;35&amp;quot;|Vector&lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_B0015 B0015]||double terminator ||registry 07 ||Plt.1-1I;Plt.3-3O ||pSB1AK3 &lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_B0034 B0034] ||RBS ||registry 07 ||Plt.1-3O ||pSB1A2&lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_C0072 C0072] ||Mnt Gene ||registry 07 ||Plt.2-5M ||pSB2K3 &lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_K091107 K091107] ||pLux/cI || N/A || || &lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_K091109 K091109] ||LuxS || N/A || || &lt;br /&gt;
|-&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5716</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5716"/>
				<updated>2008-07-02T16:15:37Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Parallel Biobrick Assembly'''&lt;br /&gt;
&lt;br /&gt;
'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
K091107 + B0034 + K091109 + B0034 + C0072 + B0015[B0010+B0012]&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1A || B0015 || Double Terminator || RX/SP || RX || 129bp || C0072 || Mnt Gene || RX/SP || RS || 288bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 1B || B0034 || RBS  || RX/SP || RX || 12bp || K091109 || LuxS Gene || RX/SP || RS || 516bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 2 || B0034 || RBS || RX/SP || SP || 12bp || Product of 1B || LuxS + RBS || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Product of 2 || RBS + LuxS + RBS || RX/SP || SP ||  || Product of 1A || Mnt Gene + TT || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 4 || K091107 || pLux/cI || RX/SP || SP ||  || Product of 3 || RBS + LuxS + RBS + Mnt + TT || RX/SP || XP ||  || Objective 1 || &lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Parts'''&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;40&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;110&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;60&amp;quot;|Source&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|location('07)&lt;br /&gt;
!width=&amp;quot;35&amp;quot;|Vector&lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_B0015 B0015]||double terminator ||registry 07 ||Plt.1-1I;Plt.3-3O ||pSB1AK3 || &lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_B0034 B0034] ||RBS ||registry 07 ||Plt.1-3O ||pSB1A2 || &lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_C0072 C0072] ||Mnt Gene ||registry 07 ||Plt.2-5M ||pSB2K3 || &lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_K091107 K091107] ||pLux/cI || N/A || || || &lt;br /&gt;
|-&lt;br /&gt;
|[http://partsregistry.org/Part:BBa_K091109 K091109] ||LuxS || N/A || || || &lt;br /&gt;
|-&lt;br /&gt;
-}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5715</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5715"/>
				<updated>2008-07-02T15:59:19Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Parallel Biobrick Assembly'''&lt;br /&gt;
&lt;br /&gt;
'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
K091107 + B0034 + K091109 + B0034 + C0072 + B0015[B0010+B0012]&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1A || B0015 || Double Terminator || RX/SP || RX || 129bp || C0072 || Mnt Gene || RX/SP || RS || 288bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 1B || B0034 || RBS  || RX/SP || RX || 12bp || K091109 || LuxS Gene || RX/SP || RS || 516bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 2 || B0034 || RBS || RX/SP || SP || 12bp || Product of 1B || LuxS + RBS || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Product of 2 || RBS + LuxS + RBS || RX/SP || SP ||  || Product of 1A || Mnt Gene + TT || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 4 || K091107 || pLux/cI || RX/SP || SP ||  || Product of 3 || RBS + LuxS + RBS + Mnt + TT || RX/SP || XP ||  || Objective 1 || &lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5714</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5714"/>
				<updated>2008-07-02T15:58:50Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Parallel Biobrick Assembly'''&lt;br /&gt;
&lt;br /&gt;
'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
K091107 + B0034 + K091109 + B0034 + C0072 + B0015[B0010+B0012]&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1A || B0015 || Double Terminator || RX/SP || RX || 129bp || C0072 || Mnt Gene || RX/SP || RS || 288bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 1B || B0034 || RBS  || RX/SP || RX || 12bp || K091109 || LuxS Gene || RX/SP || RS || 516bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 2 || B0034 || RBS || RX/SP || SP || 12bp || Product of 1B || LuxS + RBS || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Product of 2 || RBS + LuxS + RBS || RX/SP || SP ||  || Product of 1A || Mnt Gene + TT || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 4 || K091107 || pLux/cI || RX/SP || SP ||  || Product of 3 || RBS + LuxS + RBS + Mnt + TT || RX/SP || XP ||  || || Objective 1&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5713</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5713"/>
				<updated>2008-07-02T15:57:52Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Parallel Biobrick Assembly'''&lt;br /&gt;
&lt;br /&gt;
'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
K091107 + B0034 + K091109 + B0034 + C0072 + B0015[B0010+B0012]&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1A || B0015 || Double Terminator || RX/SP || RX || 129bp || C0072 || Mnt Gene || RX/SP || RS || 288bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 1B || B0034 || RBS  || RX/SP || RX || 12bp || K091109 || LuxS Gene || RX/SP || RS || 516bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 2 || B0034 || RBS || RX/SP || SP || 12bp || Product of 1B || LuxS + RBS || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Product of 2 || RBS + LuxS + RBS || RX/SP || SP ||  || Product of 1A || Mnt Gene + TT || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 4 || K091107 || pLux/cI || RX/SP || SP ||  || Product of 3 || RBS + LuxS + RBS + Mnt + TT || RX/SP || XP ||  || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5712</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5712"/>
				<updated>2008-07-02T15:46:47Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Parallel Biobrick Assembly'''&lt;br /&gt;
&lt;br /&gt;
'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
K091107 + B0034 + K091109 + B0034 + C0072 + B0015[B0010+B0012]&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1A || B0015 || Double Terminator || RX/SP || RX || 129bp || C0072 || Mnt Gene || RX/SP || RS || 288bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 1B || B0034 || RBS  || RX/SP || RX || 12bp || K091109 || LuxS Gene || RX/SP || RS || 516bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 2 || B0034 || RBS || RX/SP || SP || 12bp || Product of 1B || LuxS + RBS || XP ||  || || ||&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Product of 2 || RBS + LuxS + RBS || RX/SP || SP ||  || Product of 1A || Mnt Gene + TT || RX/SP || XP || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5708</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5708"/>
				<updated>2008-07-02T15:34:14Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
== Parallel Biobrick Assembly ==&lt;br /&gt;
&lt;br /&gt;
'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
K091107 + B0034 + K091109 + B0034 + C0072 + B0015[B0010+B0012]&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1A || B0015 || Double Terminator || RX/SP || RX || 129bp || C0072 || Mnt Gene || RX/SP || RS || 288bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 1B || B0034 || RBS  || RX/SP || RX || 12bp || K091109 || LuxS Gene || RX/SP || RS || 516bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5707</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5707"/>
				<updated>2008-07-02T15:32:36Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
K091107 + B0034 + K091109 + B0034 + C0072 + B0015[B0010+B0012]&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1A || B0015 || Double Terminator || RX/SP || RX || 129bp || C0072 || Mnt Gene || RX/SP || RS || 288bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| 1B || B0034 || RBS  || RX/SP || RX || 12bp || K091109 || LuxS Gene || RX/SP || RS || 516bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5703</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5703"/>
				<updated>2008-07-02T15:26:45Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
K091107 + B0034 + K091109 + B0034 + C0072 + B0015[B0010+B0012]&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1A || B0015 || Double Terminator || RX/SP || RX || 129bp || C0072 || Mnt Gene || RX/SP || RS || 288bp ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5674</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5674"/>
				<updated>2008-07-02T14:36:11Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
K091107 + B0034 + K091109 + B0034 + C0072 + B0015[B0010+B0012]&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5666</id>
		<title>LuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI&amp;diff=5666"/>
				<updated>2008-07-02T14:05:53Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Objective 1''': pLux/cI + RBS + LuxS + RBS + Mnt + TT  (ampicillin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Objective 2''': pBAD + RBS + LuxR + TT  (kanamycin resistance)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;20&amp;quot;|Step&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;70&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Prefix/suffix&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Enzymes&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|BBa_&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Size&lt;br /&gt;
|-&lt;br /&gt;
|.|| '''Vector''' || . || . || . || .  ||'''Insert'''||.||.||.||.||'''Product'''||.&lt;br /&gt;
|-&lt;br /&gt;
| 1|| || || || || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
| || ||  ||  ||  || || || || || || || ||&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_pLasR/cI&amp;diff=5571</id>
		<title>Test pLasR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_pLasR/cI&amp;diff=5571"/>
				<updated>2008-06-30T20:03:57Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;pLasR/cI is constitutively off and is repressed by cI. The addition of p-AI-1, activates LasR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LasR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|p-AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|p-AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5570</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5570"/>
				<updated>2008-06-30T20:03:48Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''[[Test pLuxR/cI]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
[[pMnt/Lac]]&lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LacI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Test pLsrR/cI]]&lt;br /&gt;
&lt;br /&gt;
[[Test pLasR/cI]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Test Mnt/Tet promoter]]&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|TetR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test tet repression&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/wiki/index.php?title=Part:BBa_I13453 I13453]+RBS+[http://partsregistry.org/Part:BBa_C0040 C0040]+TT+[http://partsregistry.org/Part:BBa_K091105 K091105]+[http://partsregistry.org/Part:BBa_E0240 E0240]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+[http://partsregistry.org/Part:BBa_C0072 C0072]+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5569</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5569"/>
				<updated>2008-06-30T20:03:13Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''[[Test pLuxR/cI]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
[[pMnt/Lac]]&lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LacI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Test pLsrR/cI]]&lt;br /&gt;
&lt;br /&gt;
Test pLasR/cI&lt;br /&gt;
&lt;br /&gt;
pLasR/cI is constitutively off and is repressed by cI. The addition of p-AI-1, activates LasR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LasR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|p-AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|p-AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Test Mnt/Tet promoter]]&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|TetR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test tet repression&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/wiki/index.php?title=Part:BBa_I13453 I13453]+RBS+[http://partsregistry.org/Part:BBa_C0040 C0040]+TT+[http://partsregistry.org/Part:BBa_K091105 K091105]+[http://partsregistry.org/Part:BBa_E0240 E0240]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+[http://partsregistry.org/Part:BBa_C0072 C0072]+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_pLsrR/cI&amp;diff=5565</id>
		<title>Test pLsrR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_pLsrR/cI&amp;diff=5565"/>
				<updated>2008-06-30T19:51:03Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LsrR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-2 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-2 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5564</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5564"/>
				<updated>2008-06-30T19:50:51Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''[[Test pLuxR/cI]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
[[pMnt/Lac]]&lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LacI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Test pLsrR/cI]]&lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LsrR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-2 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-2 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Test Mnt/Tet promoter]]&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|TetR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test tet repression&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/wiki/index.php?title=Part:BBa_I13453 I13453]+RBS+[http://partsregistry.org/Part:BBa_C0040 C0040]+TT+[http://partsregistry.org/Part:BBa_K091105 K091105]+[http://partsregistry.org/Part:BBa_E0240 E0240]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+[http://partsregistry.org/Part:BBa_C0072 C0072]+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5563</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5563"/>
				<updated>2008-06-30T19:50:28Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''[[Test pLuxR/cI]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
[[pMnt/Lac]]&lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LacI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LsrR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-2 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-2 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Test Mnt/Tet promoter]]&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|TetR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test tet repression&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/wiki/index.php?title=Part:BBa_I13453 I13453]+RBS+[http://partsregistry.org/Part:BBa_C0040 C0040]+TT+[http://partsregistry.org/Part:BBa_K091105 K091105]+[http://partsregistry.org/Part:BBa_E0240 E0240]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+[http://partsregistry.org/Part:BBa_C0072 C0072]+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5562</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5562"/>
				<updated>2008-06-30T19:49:30Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''[[Test pLuxR/cI]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
[[pMnt/Lac]]&lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LacI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LsrR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Test Mnt/Tet promoter]]&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|TetR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test tet repression&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/wiki/index.php?title=Part:BBa_I13453 I13453]+RBS+[http://partsregistry.org/Part:BBa_C0040 C0040]+TT+[http://partsregistry.org/Part:BBa_K091105 K091105]+[http://partsregistry.org/Part:BBa_E0240 E0240]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+[http://partsregistry.org/Part:BBa_C0072 C0072]+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_pLuxR/cI&amp;diff=5561</id>
		<title>Test pLuxR/cI</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_pLuxR/cI&amp;diff=5561"/>
				<updated>2008-06-30T19:48:45Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5560</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5560"/>
				<updated>2008-06-30T19:48:35Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''[[Test pLuxR/cI]]&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
[[pMnt/Lac]]&lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LacI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|IPTG - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LsrR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Test Mnt/Tet promoter]]&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|TetR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Mnt&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|aTc - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test tet repression&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/wiki/index.php?title=Part:BBa_I13453 I13453]+RBS+[http://partsregistry.org/Part:BBa_C0040 C0040]+TT+[http://partsregistry.org/Part:BBa_K091105 K091105]+[http://partsregistry.org/Part:BBa_E0240 E0240]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+[http://partsregistry.org/Part:BBa_C0072 C0072]+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Designing_XOR_Gates_-_two_campus_approach&amp;diff=5559</id>
		<title>Designing XOR Gates - two campus approach</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Designing_XOR_Gates_-_two_campus_approach&amp;diff=5559"/>
				<updated>2008-06-30T19:47:45Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* Missouri Western XOR Biological Design 1 */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== Davidson XOR Biological Design ==&lt;br /&gt;
[http://partsregistry.org/AHL '''List of auto-inducers and their catalog numbers.''']&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;'''Davidson Approach'''&amp;lt;br&amp;gt;&lt;br /&gt;
'''Here is an idea Malcolm and Laurie developed.''' &amp;lt;br&amp;gt;&lt;br /&gt;
'''Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.'''&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:XOR_AMC1b.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]&lt;br /&gt;
&lt;br /&gt;
[[Oligos_to_Build]]: Sequences we will need to make this XOR gate.&lt;br /&gt;
&lt;br /&gt;
== Missouri Western XOR Biological Design 1==&lt;br /&gt;
&lt;br /&gt;
These two XOR circuits are designed to complement each other. Each recieves a cell-to-cell signal (AI-1 or AI-2) and a chemical signal (IPTG or AHL) and processes it into a cell-to-cell signal.  Colonies that output AI-1 would alternate with colonies that produce AI-2.  The input message to be hashed could be encoded by the presence or absence of the chemical signals, which would also alternate.  &lt;br /&gt;
&lt;br /&gt;
'''Design Variables'''&lt;br /&gt;
&lt;br /&gt;
1. strength on RBS for each of the coding sequences (eg. RBS for enzymes could be weak)&lt;br /&gt;
&lt;br /&gt;
2. order of coding sequences (eg. enzymes could be second for lower expression level)&lt;br /&gt;
&lt;br /&gt;
3. identity of repressors ('''Davidson is building three different LacI repressors''')&lt;br /&gt;
&lt;br /&gt;
4. type of degradation tag on proteins&lt;br /&gt;
&lt;br /&gt;
'''Things to Do'''&lt;br /&gt;
&lt;br /&gt;
1. make a list of the parts needed and their building status&lt;br /&gt;
&lt;br /&gt;
2. design, order, and clone 4 hybrid promoters&lt;br /&gt;
&lt;br /&gt;
3. test the 4 hybrid promoters with GFP or RFP outputs&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''[[DNA Sequences of Relevant Parts]]&lt;br /&gt;
'''&lt;br /&gt;
&lt;br /&gt;
'''[[Parts from the registry]]&lt;br /&gt;
'''&lt;br /&gt;
&lt;br /&gt;
'''[[Oligo design for XOR Hybrid Promoters]]&lt;br /&gt;
&lt;br /&gt;
'''[[Parts needed for XOR]]&lt;br /&gt;
&lt;br /&gt;
'''&lt;br /&gt;
&lt;br /&gt;
'''[[Test XOR Hybrid Promoters]]&lt;br /&gt;
&lt;br /&gt;
'''&lt;br /&gt;
[[Image:XOR DR AI2.PNG]]&lt;br /&gt;
&lt;br /&gt;
'''Above '''- Input of AI-1 or IPTG turns on production of AI-2 by LuxS.  Input by both AI-1 and IPTG allows production of the repressors cI and Mnt, which repress both transcription units.  LuxR and LacI are constitutively expressed.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Image:XOR DR AI1b.PNG]]&amp;lt;br&amp;gt;&lt;br /&gt;
'''Above''' - Input of AI-2 or aTc turns on production of AI-1 by LuxI.  Input by both AI-2 and aTc allows production of the repressors cI and Mnt, which repress both transcription units.  LsrK, LsrR and TetR are constitutively expressed.&lt;br /&gt;
&lt;br /&gt;
== Combined Davidson/Missouri Western XOR Biological Design ==&lt;br /&gt;
&lt;br /&gt;
A strength of the Davidson XOR design above is that each of the two signalling molecules used is foreign to E. coli.  A strength of the Missouri Western design above is that is uses two complementary XOR gates.  The design below combines the two approaches.  Each XOR circuit receives a cell-to-cell signal (AI-1 or P-AI-1) and a chemical signal (IPTG or AHL) and processes it into a cell-to-cell signal.  Colonies that output AI-1 would alternate with colonies that produce P-AI-1.  The input message to be hashed could be encoded by the presence or absence of the chemical signals, which would also alternate.  &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Image:xors dr pai1.PNG]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Input of AI-1 or IPTG turns on production of AI-2 by LuxS.  Input by both AI-1 and IPTG allows production of the repressors cI and Mnt, which repress both transcription units.  LuxR and LacI are constitutively expressed.&lt;br /&gt;
'''&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Image:xors dr ai1.PNG]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Input of AI-2 or aTc turns on production of AI-1 by LuxI.  Input by both AI-2 and aTc allows production of the repressors cI and Mnt, which repress both transcription units.  LsrK, LsrR and TetR are constitutively expressed.'''&lt;br /&gt;
&lt;br /&gt;
== Missouri Western XOR Biological Design 2==&lt;br /&gt;
&lt;br /&gt;
'''XOR Based on Tryptophan Anabolism and the TrpR Repressor'''&lt;br /&gt;
&lt;br /&gt;
Notes: LacI could be the new LacI X86+I12.  Also, the output gene should be LuxI, not LuxS. With LuxS, the second cell has to have the Las system in place of the Lux system (JB/AMC).&lt;br /&gt;
&lt;br /&gt;
The idea here is that there are two different XOR gate clones.  One takes input of AI1 and IPTG and outputs AI2.  The other takes inputs of AI2 and IPTG and outputs AI2.  These two clones could be alternated in a pathway of colonies (TE/AG).&lt;br /&gt;
&lt;br /&gt;
[[Image:XOR AI2.PNG]]&lt;br /&gt;
[[Image:XOR AI1.JPG]]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Missouri Western XOR Biological Design 3==&lt;br /&gt;
&lt;br /&gt;
This circuit connects the two transcription units through synthesis of AI-1 and LuxR, which combine to repress both units.  It responds to AI-2 and outputs AI-2.  An analogous circuit could have input of AI-1 and IPTG and output of AI-1.  However, these two could not communicate with each other.&lt;br /&gt;
&lt;br /&gt;
[[Image:LuxR_XOR.PNG]]&lt;br /&gt;
&lt;br /&gt;
'''Above - Input of AI-2 or IPTG turns on production of AI-2 by LuxS.  Input by both AI-2 and IPTG allows production of LuxI and LuxR, which combine to repress both transcription units.  LsrK, LsrR, and LacI are constitutively expressed.'''&lt;br /&gt;
&lt;br /&gt;
== Davidson Ampicillin Communication: time delayed cell growth ==&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;center&amp;gt;[[Image:XOR_AMC2.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The very first colony has a high copy number plasmid that is Amp and Kan resistant (&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt;). As this colony grows over time, it will digest ampicillin in an increasingly larger circle shown by radiating circles of blue. The subsequent colonies have a lower copy number plasmid and have a promoter-less version of Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; in addition to the XOR construct. The Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; coding will have either its native RBS or one we give it.&lt;br /&gt;
&lt;br /&gt;
== Davidson Growth Layouts ==&lt;br /&gt;
&amp;lt;center&amp;gt;[[Image:XOR_AMC3A.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;[[Image:XOR_AMC3B.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
To enhance the unidirectional flow of Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt;, we could either grow the cells on a slant or create a vertical stack of agar plugs. The thickness of the plug would be determined by the thickness of the plates we pour. This may or may not help with the diffusion of Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; but it is easier to do than microfluidics. &lt;br /&gt;
&lt;br /&gt;
----&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI_Test_and_Outcome&amp;diff=5558</id>
		<title>LuxR/cI Test and Outcome</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=LuxR/cI_Test_and_Outcome&amp;diff=5558"/>
				<updated>2008-06-30T19:44:37Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Test pLuxR/cI'''&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Designing_XOR_Gates_-_two_campus_approach&amp;diff=5557</id>
		<title>Designing XOR Gates - two campus approach</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Designing_XOR_Gates_-_two_campus_approach&amp;diff=5557"/>
				<updated>2008-06-30T19:44:28Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* Missouri Western XOR Biological Design 1 */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== Davidson XOR Biological Design ==&lt;br /&gt;
[http://partsregistry.org/AHL '''List of auto-inducers and their catalog numbers.''']&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;'''Davidson Approach'''&amp;lt;br&amp;gt;&lt;br /&gt;
'''Here is an idea Malcolm and Laurie developed.''' &amp;lt;br&amp;gt;&lt;br /&gt;
'''Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.'''&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:XOR_AMC1b.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]&lt;br /&gt;
&lt;br /&gt;
[[Oligos_to_Build]]: Sequences we will need to make this XOR gate.&lt;br /&gt;
&lt;br /&gt;
== Missouri Western XOR Biological Design 1==&lt;br /&gt;
&lt;br /&gt;
These two XOR circuits are designed to complement each other. Each recieves a cell-to-cell signal (AI-1 or AI-2) and a chemical signal (IPTG or AHL) and processes it into a cell-to-cell signal.  Colonies that output AI-1 would alternate with colonies that produce AI-2.  The input message to be hashed could be encoded by the presence or absence of the chemical signals, which would also alternate.  &lt;br /&gt;
&lt;br /&gt;
'''Design Variables'''&lt;br /&gt;
&lt;br /&gt;
1. strength on RBS for each of the coding sequences (eg. RBS for enzymes could be weak)&lt;br /&gt;
&lt;br /&gt;
2. order of coding sequences (eg. enzymes could be second for lower expression level)&lt;br /&gt;
&lt;br /&gt;
3. identity of repressors ('''Davidson is building three different LacI repressors''')&lt;br /&gt;
&lt;br /&gt;
4. type of degradation tag on proteins&lt;br /&gt;
&lt;br /&gt;
'''Things to Do'''&lt;br /&gt;
&lt;br /&gt;
1. make a list of the parts needed and their building status&lt;br /&gt;
&lt;br /&gt;
2. design, order, and clone 4 hybrid promoters&lt;br /&gt;
&lt;br /&gt;
3. test the 4 hybrid promoters with GFP or RFP outputs&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''[[DNA Sequences of Relevant Parts]]&lt;br /&gt;
'''&lt;br /&gt;
&lt;br /&gt;
'''[[Parts from the registry]]&lt;br /&gt;
'''&lt;br /&gt;
&lt;br /&gt;
'''[[Oligo design for XOR Hybrid Promoters]]&lt;br /&gt;
&lt;br /&gt;
'''[[Parts needed for XOR]]&lt;br /&gt;
&lt;br /&gt;
'''&lt;br /&gt;
&lt;br /&gt;
'''[[Test XOR Hybrid Promoters]]&lt;br /&gt;
&lt;br /&gt;
'''[[LuxR/cI Test and Outcome]]&lt;br /&gt;
&lt;br /&gt;
'''&lt;br /&gt;
[[Image:XOR DR AI2.PNG]]&lt;br /&gt;
&lt;br /&gt;
'''Above '''- Input of AI-1 or IPTG turns on production of AI-2 by LuxS.  Input by both AI-1 and IPTG allows production of the repressors cI and Mnt, which repress both transcription units.  LuxR and LacI are constitutively expressed.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Image:XOR DR AI1b.PNG]]&amp;lt;br&amp;gt;&lt;br /&gt;
'''Above''' - Input of AI-2 or aTc turns on production of AI-1 by LuxI.  Input by both AI-2 and aTc allows production of the repressors cI and Mnt, which repress both transcription units.  LsrK, LsrR and TetR are constitutively expressed.&lt;br /&gt;
&lt;br /&gt;
== Combined Davidson/Missouri Western XOR Biological Design ==&lt;br /&gt;
&lt;br /&gt;
A strength of the Davidson XOR design above is that each of the two signalling molecules used is foreign to E. coli.  A strength of the Missouri Western design above is that is uses two complementary XOR gates.  The design below combines the two approaches.  Each XOR circuit receives a cell-to-cell signal (AI-1 or P-AI-1) and a chemical signal (IPTG or AHL) and processes it into a cell-to-cell signal.  Colonies that output AI-1 would alternate with colonies that produce P-AI-1.  The input message to be hashed could be encoded by the presence or absence of the chemical signals, which would also alternate.  &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Image:xors dr pai1.PNG]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Input of AI-1 or IPTG turns on production of AI-2 by LuxS.  Input by both AI-1 and IPTG allows production of the repressors cI and Mnt, which repress both transcription units.  LuxR and LacI are constitutively expressed.&lt;br /&gt;
'''&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Image:xors dr ai1.PNG]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Input of AI-2 or aTc turns on production of AI-1 by LuxI.  Input by both AI-2 and aTc allows production of the repressors cI and Mnt, which repress both transcription units.  LsrK, LsrR and TetR are constitutively expressed.'''&lt;br /&gt;
&lt;br /&gt;
== Missouri Western XOR Biological Design 2==&lt;br /&gt;
&lt;br /&gt;
'''XOR Based on Tryptophan Anabolism and the TrpR Repressor'''&lt;br /&gt;
&lt;br /&gt;
Notes: LacI could be the new LacI X86+I12.  Also, the output gene should be LuxI, not LuxS. With LuxS, the second cell has to have the Las system in place of the Lux system (JB/AMC).&lt;br /&gt;
&lt;br /&gt;
The idea here is that there are two different XOR gate clones.  One takes input of AI1 and IPTG and outputs AI2.  The other takes inputs of AI2 and IPTG and outputs AI2.  These two clones could be alternated in a pathway of colonies (TE/AG).&lt;br /&gt;
&lt;br /&gt;
[[Image:XOR AI2.PNG]]&lt;br /&gt;
[[Image:XOR AI1.JPG]]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Missouri Western XOR Biological Design 3==&lt;br /&gt;
&lt;br /&gt;
This circuit connects the two transcription units through synthesis of AI-1 and LuxR, which combine to repress both units.  It responds to AI-2 and outputs AI-2.  An analogous circuit could have input of AI-1 and IPTG and output of AI-1.  However, these two could not communicate with each other.&lt;br /&gt;
&lt;br /&gt;
[[Image:LuxR_XOR.PNG]]&lt;br /&gt;
&lt;br /&gt;
'''Above - Input of AI-2 or IPTG turns on production of AI-2 by LuxS.  Input by both AI-2 and IPTG allows production of LuxI and LuxR, which combine to repress both transcription units.  LsrK, LsrR, and LacI are constitutively expressed.'''&lt;br /&gt;
&lt;br /&gt;
== Davidson Ampicillin Communication: time delayed cell growth ==&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;center&amp;gt;[[Image:XOR_AMC2.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The very first colony has a high copy number plasmid that is Amp and Kan resistant (&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt;). As this colony grows over time, it will digest ampicillin in an increasingly larger circle shown by radiating circles of blue. The subsequent colonies have a lower copy number plasmid and have a promoter-less version of Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; in addition to the XOR construct. The Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; coding will have either its native RBS or one we give it.&lt;br /&gt;
&lt;br /&gt;
== Davidson Growth Layouts ==&lt;br /&gt;
&amp;lt;center&amp;gt;[[Image:XOR_AMC3A.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;[[Image:XOR_AMC3B.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
To enhance the unidirectional flow of Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt;, we could either grow the cells on a slant or create a vertical stack of agar plugs. The thickness of the plug would be determined by the thickness of the plates we pour. This may or may not help with the diffusion of Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; but it is easier to do than microfluidics. &lt;br /&gt;
&lt;br /&gt;
----&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5543</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5543"/>
				<updated>2008-06-30T18:25:30Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLuxR/cI'''&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LsrR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 1 || 1 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Tet'''&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
Test Tet repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5542</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5542"/>
				<updated>2008-06-30T18:24:15Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLuxR/cI'''&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Tet'''&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
Test Tet repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5541</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5541"/>
				<updated>2008-06-30T18:23:45Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLuxR/cI'''&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Tet'''&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
Test Tet repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5540</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5540"/>
				<updated>2008-06-30T18:22:10Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLuxR/cI'''&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 || &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Tet'''&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
Test Tet repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5539</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5539"/>
				<updated>2008-06-30T18:21:46Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLuxR/cI'''&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 || &lt;br /&gt;
|-}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Tet'''&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
Test Tet repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5538</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5538"/>
				<updated>2008-06-30T18:21:25Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLuxR/cI'''&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 || &lt;br /&gt;
}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Tet'''&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
Test Tet repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5537</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5537"/>
				<updated>2008-06-30T18:21:03Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLuxR/cI'''&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 || &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Tet'''&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
Test Tet repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5536</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5536"/>
				<updated>2008-06-30T18:19:46Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLuxR/cI'''&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 |&lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 |&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 | &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 | &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Tet'''&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
Test Tet repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5535</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5535"/>
				<updated>2008-06-30T18:18:50Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLuxR/cI'''&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 || &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 || &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 || }&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Tet'''&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
Test Tet repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5534</id>
		<title>Test XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Test_XOR_Hybrid_Promoters&amp;diff=5534"/>
				<updated>2008-06-30T18:18:17Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is a rough idea of how to test the four hybrid promoters for the XOR gate.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLuxR/cI'''&lt;br /&gt;
&lt;br /&gt;
luxR/CI hybrid promoter is constitutively off. Ligate with GFP on the 3’ end. If luxR is present first then add AI-1, the bacteria should glow green. Then add CI, the bacteria should not glow.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP does not glows&lt;br /&gt;
                                                       &lt;br /&gt;
                                                          &lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+t+t+pLuxR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
add AI-1&lt;br /&gt;
&lt;br /&gt;
Some promoter→LuxR+cI+t+t+pLuxR/cI→GFP does not glow&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|LuxR&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|cI&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 + GFP&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|AI-1 - GFP&lt;br /&gt;
&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 0 || 0 || 0 || &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 0 || 1 || 0 ||&lt;br /&gt;
|-&lt;br /&gt;
| 0 || 1 || 0 || 0 || &lt;br /&gt;
|-&lt;br /&gt;
| 1 || 1 || 0 || 0 || &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Lac''' &lt;br /&gt;
&lt;br /&gt;
pMnt/Lac is constitutively on but is repressed by the LacI protein. The promoter is also repressed by the Mnt protein. The addition of IPTG should repress the LacI repressor and glow in the absence of the Mnt protein.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pLac/Mnt→GFP    does not glow&lt;br /&gt;
&lt;br /&gt;
                                                         &lt;br /&gt;
add IPTG &lt;br /&gt;
&lt;br /&gt;
Some promoter→LacI+t+t+pLac/Mnt→GFP     glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pLsrR/cI''' &lt;br /&gt;
&lt;br /&gt;
pLsrR/cI is constitutively on and is repressed by LsrR. The addition of AI-2, which becomes phosphorylated by LsrK, represses LsrR causing the promoter to turn on. The addition of cI to should repress the promoter causing it to turn off.&lt;br /&gt;
&lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP   does not glow &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2               &lt;br /&gt;
                                                &lt;br /&gt;
Some promoter→LsrK+LsrR+t+t+pLsrR/cI→GFP glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add AI-2 &lt;br /&gt;
                                                              &lt;br /&gt;
Some promoter→LsrK+LsrR+cI+t+t+pLsrR/cI→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Test pMnt/Tet'''&lt;br /&gt;
&lt;br /&gt;
The pMnt/TetR promoter is constitutively on and is repressed by the TetR protein. The addition of aTc should repress the TetR causing it to glow. The addition of the Mnt protein should repress the promoter causing it not glow.&lt;br /&gt;
&lt;br /&gt;
Test Tet repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter (pbad)→RBS+TetR+t+t+pMnt/Tet→RBS+GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
add aTc &lt;br /&gt;
                                                                &lt;br /&gt;
Some promoter→TetR+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Mnt repression:&lt;br /&gt;
&lt;br /&gt;
Some promoter→Mnt+t+t+pMnt/Tet→GFP glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Test Tet and Mnt repression:                       &lt;br /&gt;
                                         &lt;br /&gt;
Some promoter→TetR+Mnt+t+t+pMnt/Tet→GFP does not glows&lt;br /&gt;
&lt;br /&gt;
I13453+RBS+C0040+C0072+TT+K091105+E0240&lt;br /&gt;
&lt;br /&gt;
add aTc does not glow&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5475</id>
		<title>Davidson Projects with Updates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5475"/>
				<updated>2008-06-24T15:59:18Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* Building LsrK/LsrR receiver '''TESTER''' cell */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== Building LuxI sender '''TESTER''' cell ==&lt;br /&gt;
R0011 (verified) + F1610 (not right part from registry)&amp;lt;br&amp;gt;&lt;br /&gt;
Going after [http://partsregistry.org/Part:BBa_S03608 S03608] (pLac_RBS_LuxI) from 2007 registry &amp;lt;br&amp;gt;&lt;br /&gt;
If we get this and verify, we are done with this. If not, we are in need of LuxI part.&amp;lt;br&amp;gt;&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|Colonies from Registry Recovery?&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|Gel Verification?&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|Sequence Verification?&lt;br /&gt;
|-&lt;br /&gt;
|Yes|| ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Building LuxR receiver '''TESTER''' cell ==&lt;br /&gt;
Part [http://partsregistry.org/Part:BBa_K09100 K09100] has been built. &amp;lt;br&amp;gt;&lt;br /&gt;
Ready to test.&lt;br /&gt;
&lt;br /&gt;
== Building LuxS sender '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
Parts to be built &amp;lt;br&amp;gt;&lt;br /&gt;
LacIpL (R0011) + RBS (B0034) + LuxS + TT&lt;br /&gt;
&lt;br /&gt;
LuxS is the synthase protein for AI-2. This part is not available in the registry. The promoter and ribosome binding site were taken from the LuxI tester system.&lt;br /&gt;
&lt;br /&gt;
== Building LsrK/LsrR receiver '''TESTER''' cell ==&lt;br /&gt;
LsrKp + RBS + LsrK + TT&lt;br /&gt;
&lt;br /&gt;
LsrRp + RBS + LsrR + reporter (GFP/RFP/YFP) + TT&lt;br /&gt;
&lt;br /&gt;
LsrK needs to be constitutively expressed in order to receive the AI-2 signal. LsrR acts as its own repressor, so the reporter should not be activated until the AI-2 signal is received. Once LsrR binds to AI-2 molecule, the LsrR gene is activated and the positive feedback loop is initiated, which also turns on the reporter gene.&lt;br /&gt;
&lt;br /&gt;
== Building LasI sender '''TESTER''' cell ==&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0011 R0011]+ [http://partsregistry.org/Part:BBa_S03154 S03154].&lt;br /&gt;
&lt;br /&gt;
== Building LasR receiver '''TESTER''' cell ==&lt;br /&gt;
Ligatiion 1A S03156 + B0015 &amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1B R0079 + E0240&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1C B0015 + R0079&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 2: Successful Ligation 1A + uccessful Ligation 1B&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 3: Successful Ligation 2 + R0011&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Testing Crosstalk between Lux and Las ==&lt;br /&gt;
1) Mix LuxI sender cells with LasR receiver tester cells: negative control &amp;lt;br&amp;gt;&lt;br /&gt;
2) Mix LasI sender cells with LuxR receiver tester cells: negative control&amp;lt;br&amp;gt;&lt;br /&gt;
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
5) Verify LuxR receiver tester cells don't glow solo&amp;lt;br&amp;gt;&lt;br /&gt;
6) Verify LasR receiver tester cells don't glow solo &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== AND gate using pTetLac promoter ==&lt;br /&gt;
We have successfully built the pTetLac AND promoter: [http://partsregistry.org/Part:BBa_K091101 K091101]. &amp;lt;br&amp;gt;&lt;br /&gt;
This is sequence verified. &amp;lt;br&amp;gt;&lt;br /&gt;
Now we need the various LacI proteins (I12, X86 and I12+X86 variants). &amp;lt;br&amp;gt;&lt;br /&gt;
We need tetR repressor protein. We have tried to get it from the paper registry. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to see if this AND gate works as designed. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to test output to see if the two halves are balanced. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building XOR Gate ==&lt;br /&gt;
[http://partsregistry.org/AHL '''List of auto-inducers and their catalog numbers.''']&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;'''Davidson Approach'''&amp;lt;br&amp;gt;&lt;br /&gt;
'''Here is an idea Malcolm and Laurie developed.''' &amp;lt;br&amp;gt;&lt;br /&gt;
'''Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.'''&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:XOR_AMC1b.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]&lt;br /&gt;
&lt;br /&gt;
[[Oligos_to_Build]]: Sequences we will need to make this XOR gate.&lt;br /&gt;
&lt;br /&gt;
== Testing XOR Gate ==&lt;br /&gt;
We will need to have constitutive LasR and LuxR made in these cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]&lt;br /&gt;
&lt;br /&gt;
== Making Better pLac promoter and LacI proteins ==&lt;br /&gt;
'''LacI wild-type gene sequence (ORF begins at the first amino acid)'''&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC &lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA &lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC &lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA&lt;br /&gt;
ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG &lt;br /&gt;
CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC &lt;br /&gt;
TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT&lt;br /&gt;
GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG &lt;br /&gt;
GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC &lt;br /&gt;
AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12_X86 Mutation''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG&lt;br /&gt;
CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC&lt;br /&gt;
GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC&lt;br /&gt;
CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC&lt;br /&gt;
TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG&lt;br /&gt;
AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT&lt;br /&gt;
CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC&lt;br /&gt;
GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT&lt;br /&gt;
TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ1 Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
-These promoter sequences are taken from Glascock and Weickert 1998&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|lacIQ1 Promoter|| [[Image:placiq1_forward.jpg]] || [[Image:lacIq1reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|lacIQ Promoter|| [[Image:lacIqforwardprimer.jpg]] || [[Image:lacIqreversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12||[[Image:LacI_I12forwardprimer.jpg]]  || [[Image:LacI_I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI|| [[Image:LacIforwardprimer.jpg]] || [[Image:LacIreversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_X86 (Primers for step 1 of PCR)|| [[Image:LacIforwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5474</id>
		<title>Davidson Projects with Updates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5474"/>
				<updated>2008-06-24T15:42:58Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* Building LuxS sender '''TESTER''' cell */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== Building LuxI sender '''TESTER''' cell ==&lt;br /&gt;
R0011 (verified) + F1610 (not right part from registry)&amp;lt;br&amp;gt;&lt;br /&gt;
Going after [http://partsregistry.org/Part:BBa_S03608 S03608] (pLac_RBS_LuxI) from 2007 registry &amp;lt;br&amp;gt;&lt;br /&gt;
If we get this and verify, we are done with this. If not, we are in need of LuxI part.&amp;lt;br&amp;gt;&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|Colonies from Registry Recovery?&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|Gel Verification?&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|Sequence Verification?&lt;br /&gt;
|-&lt;br /&gt;
|Yes|| ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Building LuxR receiver '''TESTER''' cell ==&lt;br /&gt;
Part [http://partsregistry.org/Part:BBa_K09100 K09100] has been built. &amp;lt;br&amp;gt;&lt;br /&gt;
Ready to test.&lt;br /&gt;
&lt;br /&gt;
== Building LuxS sender '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
Parts to be built &amp;lt;br&amp;gt;&lt;br /&gt;
LacIpL (R0011) + RBS (B0034) + LuxS + TT&lt;br /&gt;
&lt;br /&gt;
LuxS is the synthase protein for AI-2. This part is not available in the registry. The promoter and ribosome binding site were taken from the LuxI tester system.&lt;br /&gt;
&lt;br /&gt;
== Building LsrK/LsrR receiver '''TESTER''' cell ==&lt;br /&gt;
LsrKp + RBS + LsrK + TT&lt;br /&gt;
&lt;br /&gt;
== Building LasI sender '''TESTER''' cell ==&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0011 R0011]+ [http://partsregistry.org/Part:BBa_S03154 S03154].&lt;br /&gt;
&lt;br /&gt;
== Building LasR receiver '''TESTER''' cell ==&lt;br /&gt;
Ligatiion 1A S03156 + B0015 &amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1B R0079 + E0240&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1C B0015 + R0079&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 2: Successful Ligation 1A + uccessful Ligation 1B&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 3: Successful Ligation 2 + R0011&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Testing Crosstalk between Lux and Las ==&lt;br /&gt;
1) Mix LuxI sender cells with LasR receiver tester cells: negative control &amp;lt;br&amp;gt;&lt;br /&gt;
2) Mix LasI sender cells with LuxR receiver tester cells: negative control&amp;lt;br&amp;gt;&lt;br /&gt;
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
5) Verify LuxR receiver tester cells don't glow solo&amp;lt;br&amp;gt;&lt;br /&gt;
6) Verify LasR receiver tester cells don't glow solo &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== AND gate using pTetLac promoter ==&lt;br /&gt;
We have successfully built the pTetLac AND promoter: [http://partsregistry.org/Part:BBa_K091101 K091101]. &amp;lt;br&amp;gt;&lt;br /&gt;
This is sequence verified. &amp;lt;br&amp;gt;&lt;br /&gt;
Now we need the various LacI proteins (I12, X86 and I12+X86 variants). &amp;lt;br&amp;gt;&lt;br /&gt;
We need tetR repressor protein. We have tried to get it from the paper registry. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to see if this AND gate works as designed. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to test output to see if the two halves are balanced. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building XOR Gate ==&lt;br /&gt;
[http://partsregistry.org/AHL '''List of auto-inducers and their catalog numbers.''']&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;'''Davidson Approach'''&amp;lt;br&amp;gt;&lt;br /&gt;
'''Here is an idea Malcolm and Laurie developed.''' &amp;lt;br&amp;gt;&lt;br /&gt;
'''Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.'''&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:XOR_AMC1b.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]&lt;br /&gt;
&lt;br /&gt;
[[Oligos_to_Build]]: Sequences we will need to make this XOR gate.&lt;br /&gt;
&lt;br /&gt;
== Testing XOR Gate ==&lt;br /&gt;
We will need to have constitutive LasR and LuxR made in these cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]&lt;br /&gt;
&lt;br /&gt;
== Making Better pLac promoter and LacI proteins ==&lt;br /&gt;
'''LacI wild-type gene sequence (ORF begins at the first amino acid)'''&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC &lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA &lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC &lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA&lt;br /&gt;
ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG &lt;br /&gt;
CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC &lt;br /&gt;
TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT&lt;br /&gt;
GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG &lt;br /&gt;
GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC &lt;br /&gt;
AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12_X86 Mutation''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG&lt;br /&gt;
CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC&lt;br /&gt;
GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC&lt;br /&gt;
CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC&lt;br /&gt;
TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG&lt;br /&gt;
AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT&lt;br /&gt;
CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC&lt;br /&gt;
GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT&lt;br /&gt;
TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ1 Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
-These promoter sequences are taken from Glascock and Weickert 1998&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|lacIQ1 Promoter|| [[Image:placiq1_forward.jpg]] || [[Image:lacIq1reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|lacIQ Promoter|| [[Image:lacIqforwardprimer.jpg]] || [[Image:lacIqreversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12||[[Image:LacI_I12forwardprimer.jpg]]  || [[Image:LacI_I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI|| [[Image:LacIforwardprimer.jpg]] || [[Image:LacIreversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_X86 (Primers for step 1 of PCR)|| [[Image:LacIforwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5473</id>
		<title>Davidson Projects with Updates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5473"/>
				<updated>2008-06-24T15:42:27Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* Building LsrK/LsrR receiver '''TESTER''' cell */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== Building LuxI sender '''TESTER''' cell ==&lt;br /&gt;
R0011 (verified) + F1610 (not right part from registry)&amp;lt;br&amp;gt;&lt;br /&gt;
Going after [http://partsregistry.org/Part:BBa_S03608 S03608] (pLac_RBS_LuxI) from 2007 registry &amp;lt;br&amp;gt;&lt;br /&gt;
If we get this and verify, we are done with this. If not, we are in need of LuxI part.&amp;lt;br&amp;gt;&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|Colonies from Registry Recovery?&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|Gel Verification?&lt;br /&gt;
!width=&amp;quot;100&amp;quot;|Sequence Verification?&lt;br /&gt;
|-&lt;br /&gt;
|Yes|| ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Building LuxR receiver '''TESTER''' cell ==&lt;br /&gt;
Part [http://partsregistry.org/Part:BBa_K09100 K09100] has been built. &amp;lt;br&amp;gt;&lt;br /&gt;
Ready to test.&lt;br /&gt;
&lt;br /&gt;
== Building LuxS sender '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
Parts to be built &amp;lt;br&amp;gt;&lt;br /&gt;
LacIpL (R0011) + RBS (B0034) + LuxS&lt;br /&gt;
&lt;br /&gt;
LuxS is the synthase protein for AI-2. This part is not available in the registry. The promoter and ribosome binding site were taken from the LuxI tester system.&lt;br /&gt;
&lt;br /&gt;
== Building LsrK/LsrR receiver '''TESTER''' cell ==&lt;br /&gt;
LsrKp + RBS + LsrK + TT&lt;br /&gt;
&lt;br /&gt;
== Building LasI sender '''TESTER''' cell ==&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0011 R0011]+ [http://partsregistry.org/Part:BBa_S03154 S03154].&lt;br /&gt;
&lt;br /&gt;
== Building LasR receiver '''TESTER''' cell ==&lt;br /&gt;
Ligatiion 1A S03156 + B0015 &amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1B R0079 + E0240&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1C B0015 + R0079&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 2: Successful Ligation 1A + uccessful Ligation 1B&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 3: Successful Ligation 2 + R0011&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Testing Crosstalk between Lux and Las ==&lt;br /&gt;
1) Mix LuxI sender cells with LasR receiver tester cells: negative control &amp;lt;br&amp;gt;&lt;br /&gt;
2) Mix LasI sender cells with LuxR receiver tester cells: negative control&amp;lt;br&amp;gt;&lt;br /&gt;
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
5) Verify LuxR receiver tester cells don't glow solo&amp;lt;br&amp;gt;&lt;br /&gt;
6) Verify LasR receiver tester cells don't glow solo &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== AND gate using pTetLac promoter ==&lt;br /&gt;
We have successfully built the pTetLac AND promoter: [http://partsregistry.org/Part:BBa_K091101 K091101]. &amp;lt;br&amp;gt;&lt;br /&gt;
This is sequence verified. &amp;lt;br&amp;gt;&lt;br /&gt;
Now we need the various LacI proteins (I12, X86 and I12+X86 variants). &amp;lt;br&amp;gt;&lt;br /&gt;
We need tetR repressor protein. We have tried to get it from the paper registry. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to see if this AND gate works as designed. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to test output to see if the two halves are balanced. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building XOR Gate ==&lt;br /&gt;
[http://partsregistry.org/AHL '''List of auto-inducers and their catalog numbers.''']&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;'''Davidson Approach'''&amp;lt;br&amp;gt;&lt;br /&gt;
'''Here is an idea Malcolm and Laurie developed.''' &amp;lt;br&amp;gt;&lt;br /&gt;
'''Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.'''&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:XOR_AMC1b.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]&lt;br /&gt;
&lt;br /&gt;
[[Oligos_to_Build]]: Sequences we will need to make this XOR gate.&lt;br /&gt;
&lt;br /&gt;
== Testing XOR Gate ==&lt;br /&gt;
We will need to have constitutive LasR and LuxR made in these cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]&lt;br /&gt;
&lt;br /&gt;
== Making Better pLac promoter and LacI proteins ==&lt;br /&gt;
'''LacI wild-type gene sequence (ORF begins at the first amino acid)'''&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC &lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA &lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC &lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA&lt;br /&gt;
ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG &lt;br /&gt;
CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC &lt;br /&gt;
TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT&lt;br /&gt;
GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG &lt;br /&gt;
GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC &lt;br /&gt;
AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12_X86 Mutation''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG&lt;br /&gt;
CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC&lt;br /&gt;
GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC&lt;br /&gt;
CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC&lt;br /&gt;
TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG&lt;br /&gt;
AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT&lt;br /&gt;
CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC&lt;br /&gt;
GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT&lt;br /&gt;
TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ1 Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
-These promoter sequences are taken from Glascock and Weickert 1998&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|lacIQ1 Promoter|| [[Image:placiq1_forward.jpg]] || [[Image:lacIq1reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|lacIQ Promoter|| [[Image:lacIqforwardprimer.jpg]] || [[Image:lacIqreversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12||[[Image:LacI_I12forwardprimer.jpg]]  || [[Image:LacI_I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI|| [[Image:LacIforwardprimer.jpg]] || [[Image:LacIreversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_X86 (Primers for step 1 of PCR)|| [[Image:LacIforwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5471</id>
		<title>Davidson Projects with Updates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5471"/>
				<updated>2008-06-24T15:14:18Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* Building LuxS sender '''TESTER''' cell */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== Building LuxI sender '''TESTER''' cell ==&lt;br /&gt;
R0011 (verified) + F1610 (not right part from registry)&amp;lt;br&amp;gt;&lt;br /&gt;
Going after [http://partsregistry.org/Part:BBa_S03608 S03608] (pLac_RBS_LuxI) from 2008 paper registry :-( &amp;lt;br&amp;gt;&lt;br /&gt;
If we get this and verify, we are done with this. If not, we are in need of LuxI part.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building LuxR receiver '''TESTER''' cell ==&lt;br /&gt;
Part [http://partsregistry.org/Part:BBa_K09100 K09100] has been built. &amp;lt;br&amp;gt;&lt;br /&gt;
Ready to test.&lt;br /&gt;
&lt;br /&gt;
== Building LuxS sender '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
Parts to be built &amp;lt;br&amp;gt;&lt;br /&gt;
LacIpL (R0011) + RBS (B0034) + LuxS&lt;br /&gt;
&lt;br /&gt;
LuxS is the synthase protein for AI-2. This part is not available in the registry. The promoter and ribosome binding site were taken from the LuxI tester system.&lt;br /&gt;
&lt;br /&gt;
== Building LsrK/LsrR receiver '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
== Building LasI sender '''TESTER''' cell ==&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0011 R0011]+ [http://partsregistry.org/Part:BBa_S03154 S03154].&lt;br /&gt;
&lt;br /&gt;
== Building LasR receiver '''TESTER''' cell ==&lt;br /&gt;
Ligatiion 1A S03156 + B0015 &amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1B R0079 + E0240&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1C B0015 + R0079&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 2: Successful Ligation 1A + uccessful Ligation 1B&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 3: Successful Ligation 2 + R0011&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Testing Crosstalk between Lux and Las ==&lt;br /&gt;
1) Mix LuxI sender cells with LasR receiver tester cells: negative control &amp;lt;br&amp;gt;&lt;br /&gt;
2) Mix LasI sender cells with LuxR receiver tester cells: negative control&amp;lt;br&amp;gt;&lt;br /&gt;
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
5) Verify LuxR receiver tester cells don't glow solo&amp;lt;br&amp;gt;&lt;br /&gt;
6) Verify LasR receiver tester cells don't glow solo &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== AND gate using pTetLac promoter ==&lt;br /&gt;
We have successfully built the pTetLac AND promoter: [http://partsregistry.org/Part:BBa_K091101 K091101]. &amp;lt;br&amp;gt;&lt;br /&gt;
This is sequence verified. &amp;lt;br&amp;gt;&lt;br /&gt;
Now we need the various LacI proteins (I12, X86 and I12+X86 variants). &amp;lt;br&amp;gt;&lt;br /&gt;
We need tetR repressor protein. We have tried to get it from the paper registry. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to see if this AND gate works as designed. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to test output to see if the two halves are balanced. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building XOR Gate ==&lt;br /&gt;
[http://partsregistry.org/AHL '''List of auto-inducers and their catalog numbers.''']&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;'''Davidson Approach'''&amp;lt;br&amp;gt;&lt;br /&gt;
'''Here is an idea Malcolm and Laurie developed.''' &amp;lt;br&amp;gt;&lt;br /&gt;
'''Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.'''&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:XOR_AMC1b.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]&lt;br /&gt;
&lt;br /&gt;
[[Oligos_to_Build]]: Sequences we will need to make this XOR gate.&lt;br /&gt;
&lt;br /&gt;
== Testing XOR Gate ==&lt;br /&gt;
We will need to have constitutive LasR and LuxR made in these cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]&lt;br /&gt;
&lt;br /&gt;
== Making Better pLac promoter and LacI proteins ==&lt;br /&gt;
'''LacI wild-type gene sequence (ORF begins at the first amino acid)'''&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC &lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA &lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC &lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA&lt;br /&gt;
ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG &lt;br /&gt;
CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC &lt;br /&gt;
TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT&lt;br /&gt;
GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG &lt;br /&gt;
GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC &lt;br /&gt;
AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12_X86 Mutation''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG&lt;br /&gt;
CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC&lt;br /&gt;
GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC&lt;br /&gt;
CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC&lt;br /&gt;
TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG&lt;br /&gt;
AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT&lt;br /&gt;
CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC&lt;br /&gt;
GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT&lt;br /&gt;
TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ1 Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
-These promoter sequences are taken from Glascock and Weickert 1998&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|lacIQ1 Promoter|| [[Image:placiq1_forward.jpg]] || [[Image:lacIq1reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|lacIQ Promoter|| [[Image:lacIqforwardprimer.jpg]] || [[Image:lacIqreversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12||[[Image:LacI_I12forwardprimer.jpg]]  || [[Image:LacI_I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI|| [[Image:LacIforwardprimer.jpg]] || [[Image:LacIreversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_X86 (Primers for step 1 of PCR)|| [[Image:LacIforwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5470</id>
		<title>Davidson Projects with Updates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5470"/>
				<updated>2008-06-24T15:05:56Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* Building LuxS sender '''TESTER''' cell */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== Building LuxI sender '''TESTER''' cell ==&lt;br /&gt;
R0011 (verified) + F1610 (not right part from registry)&amp;lt;br&amp;gt;&lt;br /&gt;
Going after [http://partsregistry.org/Part:BBa_S03608 S03608] (pLac_RBS_LuxI) from 2008 paper registry :-( &amp;lt;br&amp;gt;&lt;br /&gt;
If we get this and verify, we are done with this. If not, we are in need of LuxI part.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building LuxR receiver '''TESTER''' cell ==&lt;br /&gt;
Part [http://partsregistry.org/Part:BBa_K09100 K09100] has been built. &amp;lt;br&amp;gt;&lt;br /&gt;
Ready to test.&lt;br /&gt;
&lt;br /&gt;
== Building LuxS sender '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
Parts to be built &amp;lt;br&amp;gt;&lt;br /&gt;
LacIpL + B0034 + LuxS&lt;br /&gt;
&lt;br /&gt;
LuxS is the synthase protein for AI-2. This part is not available in the registry. The promoter and ribosome binding site were taken from the LuxI tester system. The promoter is part R0011.&lt;br /&gt;
&lt;br /&gt;
== Building LsrK/LsrR receiver '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
== Building LasI sender '''TESTER''' cell ==&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0011 R0011]+ [http://partsregistry.org/Part:BBa_S03154 S03154].&lt;br /&gt;
&lt;br /&gt;
== Building LasR receiver '''TESTER''' cell ==&lt;br /&gt;
Ligatiion 1A S03156 + B0015 &amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1B R0079 + E0240&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1C B0015 + R0079&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 2: Successful Ligation 1A + uccessful Ligation 1B&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 3: Successful Ligation 2 + R0011&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Testing Crosstalk between Lux and Las ==&lt;br /&gt;
1) Mix LuxI sender cells with LasR receiver tester cells: negative control &amp;lt;br&amp;gt;&lt;br /&gt;
2) Mix LasI sender cells with LuxR receiver tester cells: negative control&amp;lt;br&amp;gt;&lt;br /&gt;
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
5) Verify LuxR receiver tester cells don't glow solo&amp;lt;br&amp;gt;&lt;br /&gt;
6) Verify LasR receiver tester cells don't glow solo &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== AND gate using pTetLac promoter ==&lt;br /&gt;
We have successfully built the pTetLac AND promoter: [http://partsregistry.org/Part:BBa_K091101 K091101]. &amp;lt;br&amp;gt;&lt;br /&gt;
This is sequence verified. &amp;lt;br&amp;gt;&lt;br /&gt;
Now we need the various LacI proteins (I12, X86 and I12+X86 variants). &amp;lt;br&amp;gt;&lt;br /&gt;
We need tetR repressor protein. We have tried to get it from the paper registry. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to see if this AND gate works as designed. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to test output to see if the two halves are balanced. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building XOR Gate ==&lt;br /&gt;
[http://partsregistry.org/AHL '''List of auto-inducers and their catalog numbers.''']&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;'''Davidson Approach'''&amp;lt;br&amp;gt;&lt;br /&gt;
'''Here is an idea Malcolm and Laurie developed.''' &amp;lt;br&amp;gt;&lt;br /&gt;
'''Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.'''&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:XOR_AMC1b.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]&lt;br /&gt;
&lt;br /&gt;
[[Oligos_to_Build]]: Sequences we will need to make this XOR gate.&lt;br /&gt;
&lt;br /&gt;
== Testing XOR Gate ==&lt;br /&gt;
We will need to have constitutive LasR and LuxR made in these cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]&lt;br /&gt;
&lt;br /&gt;
== Making Better pLac promoter and LacI proteins ==&lt;br /&gt;
'''LacI wild-type gene sequence (ORF begins at the first amino acid)'''&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC &lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA &lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC &lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA&lt;br /&gt;
ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG &lt;br /&gt;
CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC &lt;br /&gt;
TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT&lt;br /&gt;
GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG &lt;br /&gt;
GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC &lt;br /&gt;
AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12_X86 Mutation''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG&lt;br /&gt;
CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC&lt;br /&gt;
GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC&lt;br /&gt;
CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC&lt;br /&gt;
TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG&lt;br /&gt;
AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT&lt;br /&gt;
CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC&lt;br /&gt;
GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT&lt;br /&gt;
TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ1 Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
-These promoter sequences are taken from Glascock and Weickert 1998&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|lacIQ1 Promoter|| [[Image:placiq1_forward.jpg]] || [[Image:lacIq1reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|lacIQ Promoter|| [[Image:lacIqforwardprimer.jpg]] || [[Image:lacIqreversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12||[[Image:LacI_I12forwardprimer.jpg]]  || [[Image:LacI_I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI|| [[Image:LacIforwardprimer.jpg]] || [[Image:LacIreversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_X86 (Primers for step 1 of PCR)|| [[Image:LacIforwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5469</id>
		<title>Davidson Projects with Updates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5469"/>
				<updated>2008-06-24T15:05:29Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* Building LuxS sender '''TESTER''' cell */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== Building LuxI sender '''TESTER''' cell ==&lt;br /&gt;
R0011 (verified) + F1610 (not right part from registry)&amp;lt;br&amp;gt;&lt;br /&gt;
Going after [http://partsregistry.org/Part:BBa_S03608 S03608] (pLac_RBS_LuxI) from 2008 paper registry :-( &amp;lt;br&amp;gt;&lt;br /&gt;
If we get this and verify, we are done with this. If not, we are in need of LuxI part.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building LuxR receiver '''TESTER''' cell ==&lt;br /&gt;
Part [http://partsregistry.org/Part:BBa_K09100 K09100] has been built. &amp;lt;br&amp;gt;&lt;br /&gt;
Ready to test.&lt;br /&gt;
&lt;br /&gt;
== Building LuxS sender '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
Parts to be built &amp;lt;br&amp;gt;&lt;br /&gt;
LacIpL + B0034 + LuxS&lt;br /&gt;
&lt;br /&gt;
LuxS is the synthase protein for AI-2. This part is not available in the registry. The promoter and ribosome binding site were taken from the LuxR tester system. The promoter is part R0011.&lt;br /&gt;
&lt;br /&gt;
== Building LsrK/LsrR receiver '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
== Building LasI sender '''TESTER''' cell ==&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0011 R0011]+ [http://partsregistry.org/Part:BBa_S03154 S03154].&lt;br /&gt;
&lt;br /&gt;
== Building LasR receiver '''TESTER''' cell ==&lt;br /&gt;
Ligatiion 1A S03156 + B0015 &amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1B R0079 + E0240&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1C B0015 + R0079&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 2: Successful Ligation 1A + uccessful Ligation 1B&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 3: Successful Ligation 2 + R0011&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Testing Crosstalk between Lux and Las ==&lt;br /&gt;
1) Mix LuxI sender cells with LasR receiver tester cells: negative control &amp;lt;br&amp;gt;&lt;br /&gt;
2) Mix LasI sender cells with LuxR receiver tester cells: negative control&amp;lt;br&amp;gt;&lt;br /&gt;
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
5) Verify LuxR receiver tester cells don't glow solo&amp;lt;br&amp;gt;&lt;br /&gt;
6) Verify LasR receiver tester cells don't glow solo &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== AND gate using pTetLac promoter ==&lt;br /&gt;
We have successfully built the pTetLac AND promoter: [http://partsregistry.org/Part:BBa_K091101 K091101]. &amp;lt;br&amp;gt;&lt;br /&gt;
This is sequence verified. &amp;lt;br&amp;gt;&lt;br /&gt;
Now we need the various LacI proteins (I12, X86 and I12+X86 variants). &amp;lt;br&amp;gt;&lt;br /&gt;
We need tetR repressor protein. We have tried to get it from the paper registry. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to see if this AND gate works as designed. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to test output to see if the two halves are balanced. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building XOR Gate ==&lt;br /&gt;
[http://partsregistry.org/AHL '''List of auto-inducers and their catalog numbers.''']&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;'''Davidson Approach'''&amp;lt;br&amp;gt;&lt;br /&gt;
'''Here is an idea Malcolm and Laurie developed.''' &amp;lt;br&amp;gt;&lt;br /&gt;
'''Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.'''&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:XOR_AMC1b.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]&lt;br /&gt;
&lt;br /&gt;
[[Oligos_to_Build]]: Sequences we will need to make this XOR gate.&lt;br /&gt;
&lt;br /&gt;
== Testing XOR Gate ==&lt;br /&gt;
We will need to have constitutive LasR and LuxR made in these cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]&lt;br /&gt;
&lt;br /&gt;
== Making Better pLac promoter and LacI proteins ==&lt;br /&gt;
'''LacI wild-type gene sequence (ORF begins at the first amino acid)'''&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC &lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA &lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC &lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA&lt;br /&gt;
ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG &lt;br /&gt;
CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC &lt;br /&gt;
TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT&lt;br /&gt;
GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG &lt;br /&gt;
GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC &lt;br /&gt;
AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12_X86 Mutation''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG&lt;br /&gt;
CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC&lt;br /&gt;
GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC&lt;br /&gt;
CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC&lt;br /&gt;
TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG&lt;br /&gt;
AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT&lt;br /&gt;
CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC&lt;br /&gt;
GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT&lt;br /&gt;
TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ1 Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
-These promoter sequences are taken from Glascock and Weickert 1998&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|lacIQ1 Promoter|| [[Image:placiq1_forward.jpg]] || [[Image:lacIq1reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|lacIQ Promoter|| [[Image:lacIqforwardprimer.jpg]] || [[Image:lacIqreversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12||[[Image:LacI_I12forwardprimer.jpg]]  || [[Image:LacI_I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI|| [[Image:LacIforwardprimer.jpg]] || [[Image:LacIreversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_X86 (Primers for step 1 of PCR)|| [[Image:LacIforwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5467</id>
		<title>Davidson Projects with Updates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5467"/>
				<updated>2008-06-24T14:59:31Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* Building LsrK receiver '''TESTER''' cell */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== Building LuxI sender '''TESTER''' cell ==&lt;br /&gt;
R0011 (verified) + F1610 (not right part from registry)&amp;lt;br&amp;gt;&lt;br /&gt;
Going after [http://partsregistry.org/Part:BBa_S03608 S03608] (pLac_RBS_LuxI) from 2008 paper registry :-( &amp;lt;br&amp;gt;&lt;br /&gt;
If we get this and verify, we are done with this. If not, we are in need of LuxI part.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building LuxR receiver '''TESTER''' cell ==&lt;br /&gt;
Part [http://partsregistry.org/Part:BBa_K09100 K09100] has been built. &amp;lt;br&amp;gt;&lt;br /&gt;
Ready to test.&lt;br /&gt;
&lt;br /&gt;
== Building LuxS sender '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
== Building LsrK/LsrR receiver '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
== Building LasI sender '''TESTER''' cell ==&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0011 R0011]+ [http://partsregistry.org/Part:BBa_S03154 S03154].&lt;br /&gt;
&lt;br /&gt;
== Building LasR receiver '''TESTER''' cell ==&lt;br /&gt;
Ligatiion 1A S03156 + B0015 &amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1B R0079 + E0240&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1C B0015 + R0079&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 2: Successful Ligation 1A + uccessful Ligation 1B&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 3: Successful Ligation 2 + R0011&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Testing Crosstalk between Lux and Las ==&lt;br /&gt;
1) Mix LuxI sender cells with LasR receiver tester cells: negative control &amp;lt;br&amp;gt;&lt;br /&gt;
2) Mix LasI sender cells with LuxR receiver tester cells: negative control&amp;lt;br&amp;gt;&lt;br /&gt;
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
5) Verify LuxR receiver tester cells don't glow solo&amp;lt;br&amp;gt;&lt;br /&gt;
6) Verify LasR receiver tester cells don't glow solo &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== AND gate using pTetLac promoter ==&lt;br /&gt;
We have successfully built the pTetLac AND promoter: [http://partsregistry.org/Part:BBa_K091101 K091101]. &amp;lt;br&amp;gt;&lt;br /&gt;
This is sequence verified. &amp;lt;br&amp;gt;&lt;br /&gt;
Now we need the various LacI proteins (I12, X86 and I12+X86 variants). &amp;lt;br&amp;gt;&lt;br /&gt;
We need tetR repressor protein. We have tried to get it from the paper registry. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to see if this AND gate works as designed. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to test output to see if the two halves are balanced. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building XOR Gate ==&lt;br /&gt;
[http://partsregistry.org/AHL '''List of auto-inducers and their catalog numbers.''']&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;'''Davidson Approach'''&amp;lt;br&amp;gt;&lt;br /&gt;
'''Here is an idea Malcolm and Laurie developed.''' &amp;lt;br&amp;gt;&lt;br /&gt;
'''Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.'''&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:XOR_AMC1b.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]&lt;br /&gt;
&lt;br /&gt;
[[Oligos_to_Build]]: Sequences we will need to make this XOR gate.&lt;br /&gt;
&lt;br /&gt;
== Testing XOR Gate ==&lt;br /&gt;
We will need to have constitutive LasR and LuxR made in these cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]&lt;br /&gt;
&lt;br /&gt;
== Making Better pLac promoter and LacI proteins ==&lt;br /&gt;
'''LacI wild-type gene sequence (ORF begins at the first amino acid)'''&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC &lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA &lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC &lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA&lt;br /&gt;
ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG &lt;br /&gt;
CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC &lt;br /&gt;
TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT&lt;br /&gt;
GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG &lt;br /&gt;
GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC &lt;br /&gt;
AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12_X86 Mutation''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG&lt;br /&gt;
CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC&lt;br /&gt;
GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC&lt;br /&gt;
CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC&lt;br /&gt;
TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG&lt;br /&gt;
AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT&lt;br /&gt;
CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC&lt;br /&gt;
GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT&lt;br /&gt;
TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ1 Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
-These promoter sequences are taken from Glascock and Weickert 1998&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|lacIQ1 Promoter|| [[Image:placiq1_forward.jpg]] || [[Image:lacIq1reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|lacIQ Promoter|| [[Image:lacIqforwardprimer.jpg]] || [[Image:lacIqreversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12||[[Image:LacI_I12forwardprimer.jpg]]  || [[Image:LacI_I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI|| [[Image:LacIforwardprimer.jpg]] || [[Image:LacIreversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_X86 (Primers for step 1 of PCR)|| [[Image:LacIforwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5466</id>
		<title>Davidson Projects with Updates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Projects_with_Updates&amp;diff=5466"/>
				<updated>2008-06-24T14:56:10Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== Building LuxI sender '''TESTER''' cell ==&lt;br /&gt;
R0011 (verified) + F1610 (not right part from registry)&amp;lt;br&amp;gt;&lt;br /&gt;
Going after [http://partsregistry.org/Part:BBa_S03608 S03608] (pLac_RBS_LuxI) from 2008 paper registry :-( &amp;lt;br&amp;gt;&lt;br /&gt;
If we get this and verify, we are done with this. If not, we are in need of LuxI part.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building LuxR receiver '''TESTER''' cell ==&lt;br /&gt;
Part [http://partsregistry.org/Part:BBa_K09100 K09100] has been built. &amp;lt;br&amp;gt;&lt;br /&gt;
Ready to test.&lt;br /&gt;
&lt;br /&gt;
== Building LuxS sender '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
== Building LsrK receiver '''TESTER''' cell ==&lt;br /&gt;
&lt;br /&gt;
== Building LasI sender '''TESTER''' cell ==&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0011 R0011]+ [http://partsregistry.org/Part:BBa_S03154 S03154].&lt;br /&gt;
&lt;br /&gt;
== Building LasR receiver '''TESTER''' cell ==&lt;br /&gt;
Ligatiion 1A S03156 + B0015 &amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1B R0079 + E0240&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 1C B0015 + R0079&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 2: Successful Ligation 1A + uccessful Ligation 1B&amp;lt;br&amp;gt;&lt;br /&gt;
Ligation 3: Successful Ligation 2 + R0011&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Testing Crosstalk between Lux and Las ==&lt;br /&gt;
1) Mix LuxI sender cells with LasR receiver tester cells: negative control &amp;lt;br&amp;gt;&lt;br /&gt;
2) Mix LasI sender cells with LuxR receiver tester cells: negative control&amp;lt;br&amp;gt;&lt;br /&gt;
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green&amp;lt;br&amp;gt;&lt;br /&gt;
5) Verify LuxR receiver tester cells don't glow solo&amp;lt;br&amp;gt;&lt;br /&gt;
6) Verify LasR receiver tester cells don't glow solo &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== AND gate using pTetLac promoter ==&lt;br /&gt;
We have successfully built the pTetLac AND promoter: [http://partsregistry.org/Part:BBa_K091101 K091101]. &amp;lt;br&amp;gt;&lt;br /&gt;
This is sequence verified. &amp;lt;br&amp;gt;&lt;br /&gt;
Now we need the various LacI proteins (I12, X86 and I12+X86 variants). &amp;lt;br&amp;gt;&lt;br /&gt;
We need tetR repressor protein. We have tried to get it from the paper registry. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to see if this AND gate works as designed. &amp;lt;br&amp;gt;&lt;br /&gt;
We need to test output to see if the two halves are balanced. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Building XOR Gate ==&lt;br /&gt;
[http://partsregistry.org/AHL '''List of auto-inducers and their catalog numbers.''']&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;'''Davidson Approach'''&amp;lt;br&amp;gt;&lt;br /&gt;
'''Here is an idea Malcolm and Laurie developed.''' &amp;lt;br&amp;gt;&lt;br /&gt;
'''Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.'''&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:XOR_AMC1b.jpg]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]&lt;br /&gt;
&lt;br /&gt;
[[Oligos_to_Build]]: Sequences we will need to make this XOR gate.&lt;br /&gt;
&lt;br /&gt;
== Testing XOR Gate ==&lt;br /&gt;
We will need to have constitutive LasR and LuxR made in these cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]&lt;br /&gt;
&lt;br /&gt;
== Making Better pLac promoter and LacI proteins ==&lt;br /&gt;
'''LacI wild-type gene sequence (ORF begins at the first amino acid)'''&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC &lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA &lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC &lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA&lt;br /&gt;
ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG &lt;br /&gt;
CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC &lt;br /&gt;
TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT&lt;br /&gt;
GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG &lt;br /&gt;
GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC &lt;br /&gt;
AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&lt;br /&gt;
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&lt;br /&gt;
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&lt;br /&gt;
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&lt;br /&gt;
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&lt;br /&gt;
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&lt;br /&gt;
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&lt;br /&gt;
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&lt;br /&gt;
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&lt;br /&gt;
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI_I12_X86 Mutation''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG&lt;br /&gt;
CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC&lt;br /&gt;
GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC&lt;br /&gt;
CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC&lt;br /&gt;
TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG&lt;br /&gt;
AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT&lt;br /&gt;
CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC&lt;br /&gt;
GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT&lt;br /&gt;
TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacI Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LacIQ1 Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
-These promoter sequences are taken from Glascock and Weickert 1998&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|lacIQ1 Promoter|| [[Image:placiq1_forward.jpg]] || [[Image:lacIq1reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|lacIQ Promoter|| [[Image:lacIqforwardprimer.jpg]] || [[Image:lacIqreversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12||[[Image:LacI_I12forwardprimer.jpg]]  || [[Image:LacI_I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI|| [[Image:LacIforwardprimer.jpg]] || [[Image:LacIreversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_X86 (Primers for step 1 of PCR)|| [[Image:LacIforwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Nystatin_Plates&amp;diff=5389</id>
		<title>Nystatin Plates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Nystatin_Plates&amp;diff=5389"/>
				<updated>2008-06-18T16:46:21Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The plates are made under the standard protocol with an antibiotic of choice. Nystatin can be added to either broth or agar solutions at a final concentration of 8ug/ml. Because this a very small amount, it is recommended a 1000X stock solution be made.  There are research papers to suggest this is a sufficient concentration to kill most common fungi and yeast. The experiment was replicated at Missouri Western with success.&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Nystatin_Plates&amp;diff=5388</id>
		<title>Nystatin Plates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Nystatin_Plates&amp;diff=5388"/>
				<updated>2008-06-18T16:45:38Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The plates are made under the standard protocol with an antibiotic of choice. Nystatin can be added to either broth or agar at a final concentration of 8ug/ml. Because this a very small amount, it is recommended a 1000X stock solution be made.  There are research papers to suggest this is a sufficient concentration to kill most common fungi and yeast. The experiment was replicated at Missouri Western with success.&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Nystatin_Plates&amp;diff=5387</id>
		<title>Nystatin Plates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Nystatin_Plates&amp;diff=5387"/>
				<updated>2008-06-18T16:44:02Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The plates are made under the standard protocol with an antibiotic of choice. Nystatin can be added to either broth or agar at a final concentration of 8ug/ml. There are research papers to suggest this is a sufficient concentration to kill most common fungi and yeast. The experiment was replicated at Missouri Western with success.&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Missouri_W/MWSU_protocols&amp;diff=5386</id>
		<title>Davidson Missouri W/MWSU protocols</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Missouri_W/MWSU_protocols&amp;diff=5386"/>
				<updated>2008-06-18T16:40:20Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[[Davidson_Missouri_W/colony_PCR | Colony PCR]]&lt;br /&gt;
&lt;br /&gt;
[[Standard PCR]]&lt;br /&gt;
&lt;br /&gt;
[[Resuspending Oligos]]&lt;br /&gt;
&lt;br /&gt;
[[Direct Synthesis with Overlapping Oligos]]&lt;br /&gt;
&lt;br /&gt;
[[Nystatin Plates]]&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Oligo_design_for_XOR_Hybrid_Promoters&amp;diff=5384</id>
		<title>Oligo design for XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Oligo_design_for_XOR_Hybrid_Promoters&amp;diff=5384"/>
				<updated>2008-06-18T16:29:25Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* LsrA/cI hybrid promoter */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Lux-cI hybrid promoter==&lt;br /&gt;
'''Responsible:Xiao Zhu'''&lt;br /&gt;
&lt;br /&gt;
'''Rationale'''&lt;br /&gt;
&lt;br /&gt;
This hybrid promoter is designed to respond to activation by LuxR when it is bound to AHL and to repression by the phage lambda cI repressor.  The repression needs to win over activation.  According to Ron Weiss, “the effect of cI is dominant over LuxR”(Ron Weiss, part description for R0065).  &lt;br /&gt;
&lt;br /&gt;
'''References and links'''&lt;br /&gt;
&lt;br /&gt;
[http://www.pnas.org/cgi/content/full/101/17/6355 Spatiotemporal control of gene expression with pulse-generating networks]&lt;br /&gt;
&lt;br /&gt;
[http://www.pnas.org/cgi/content/full/0307571101/DC1 Its supporting information]&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0062 Lux/HSL]&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0051 cI]&lt;br /&gt;
&lt;br /&gt;
'''Design Considerations'''&lt;br /&gt;
&lt;br /&gt;
We have come up with three possible designs for this promoter.  Designs A and B are based on the idea of replacing the region of the Lux promoter downstream of the -35 either the OR1 or the OR2 cI half-operator.  A) cI OR1, containing the lambda pR -10 region.  B) cI OR2, added LuxR-10 region. Based on what we have found up to now, promoters which are constructed just by inserting OR1/2 downstream of Lux are all very leaky.&lt;br /&gt;
&lt;br /&gt;
We hope that doing in this way could lead a stronger regulation for cI OR1/2.  There’s a journal talking about a research that used Lux-cI hybrid promoter in their system. What they did is to insert cI OR1 upstream of Lux +1(they had a mutant for OR1 sequence), and it’s leaky (“In this case, even without AHL, leaky CI expression completely represses luxPRcI-OR1”). &lt;br /&gt;
&lt;br /&gt;
Design C, to use OR2 twice, is because “it requires the binding of two cI repressor dimers for maximal repression”, but as BBa_R0065 has shown, if we put both OR2 and OR1 downstream of Lux, the promoter won’t work very well, it’s very leaky at high copy number. And we found that ETHZ iGEM’07 team were building these hybrid promoters as well. They used OR2 twice. We don’t know whether OR2 has any advantages over OR1 for functioning.&lt;br /&gt;
&lt;br /&gt;
'''Design A - LuxR/HSL + OR1'''&lt;br /&gt;
&lt;br /&gt;
'''Desired sequence A (101bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TACCTCTGGCGGTGATAA T GGTTGC TACTAGTAGC GGCCGCTGCA GATGC 3’&lt;br /&gt;
&lt;br /&gt;
'''Annotation of desired sequence A'''&lt;br /&gt;
&lt;br /&gt;
Oligos have 15bp overlap for direct synthesis&lt;br /&gt;
&lt;br /&gt;
BBa_Prefix: GCAT  GAATTCGCGGCCGCTTCTAGAG&lt;br /&gt;
&lt;br /&gt;
LuxR/HSL Box (only includes region upstream of -35 and the first T of -35): ACCTGTAGGA TCGTACAGG T&lt;br /&gt;
&lt;br /&gt;
LuxR -35:  TTTACG&lt;br /&gt;
&lt;br /&gt;
cI Half-Operator OR1: TACCTCTGGCGGTGATAA&lt;br /&gt;
&lt;br /&gt;
Lambda pR -10: GATAAT &lt;br /&gt;
&lt;br /&gt;
Spacer: (naturally occurring just 3' to -10 in cI promoter): GGTTGC&lt;br /&gt;
&lt;br /&gt;
Suffix: TACTAGTAGCGGCCGCTGCAG ATGC&lt;br /&gt;
&lt;br /&gt;
'''Forward primer (58bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TACCTCT3’&lt;br /&gt;
&lt;br /&gt;
'''Reverse Primer (58bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT CTGCAG CGGCCGCTAC TAGTAGCAAC CATTATCACC GCCAGAGGTA CGTAAACC 3’&lt;br /&gt;
&lt;br /&gt;
'''Design B - LuxR/HSL + OR2''' '''CHOSEN DESIGN'''&lt;br /&gt;
&lt;br /&gt;
'''Desired sequence B (108bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TAACACCGTG CGTGTTGA TATAGT CGAATAAA TACTAGTAGCGGCCGCTGCAGATGC 3’&lt;br /&gt;
&lt;br /&gt;
'''Annotated desired sequence B'''&lt;br /&gt;
&lt;br /&gt;
BBa_Prefix: GCAT  GAATTCGCGGCCGCTTCTAGAG&lt;br /&gt;
&lt;br /&gt;
LuxR/HSL Box (only includes region upstream of -35 and the first T of -35): ACCTGTAGGA TCGTACAGG T&lt;br /&gt;
&lt;br /&gt;
LuxR -35: TTTACG&lt;br /&gt;
&lt;br /&gt;
Lambda Half-Operator OR2: TAACACCGTG CGTGTTGA&lt;br /&gt;
&lt;br /&gt;
LuxR -10: TATAGT (we used the -10 region from LuxR in order to reduce the risk that LuxR -35 region won’t work well with -10 region from other sources.)&lt;br /&gt;
&lt;br /&gt;
Spacer (naturally occurs after LuxR -10): CGAATAAA&lt;br /&gt;
&lt;br /&gt;
Suffix: TACTAGTAGCGGCCGCTGCAG ATGC&lt;br /&gt;
&lt;br /&gt;
'''Forward Primer (63bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TAACACCGTGCG 3’&lt;br /&gt;
&lt;br /&gt;
'''Reverse Primer (61bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT CTGCAG CGGCCGCTAC TAGTATTTAT TCGACTATAT CAACACGCAC GGTGTTACGTA 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Design C - LuxR/HSL + 2xOR2'''&lt;br /&gt;
&lt;br /&gt;
'''Desired sequence C (141bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C TAACACCGTG CGTGTTGA  TTTATC TAACACCGTG CGTGTTGA TACTAGTAGCGGCCGCTGCAGATGC 3’&lt;br /&gt;
&lt;br /&gt;
'''Annotated desired sequence C'''&lt;br /&gt;
&lt;br /&gt;
BBa_Prefix: GCAT  GAATTCGCGGCCGCTTCTAGAG&lt;br /&gt;
&lt;br /&gt;
Lux/HSL (the whole sequence, including -35 and -10): ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C&lt;br /&gt;
&lt;br /&gt;
Lux -35: TTTACG&lt;br /&gt;
&lt;br /&gt;
Lux -10: TATAGT&lt;br /&gt;
&lt;br /&gt;
2xOR2 with 6 bp that naturally exist in Lambda promoter between OR2 and OR1 (we inserted the 6 bp spacer backwards so as to break the cI -35 region): TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA&lt;br /&gt;
&lt;br /&gt;
Suffix: TACTAGTAGCGGCCGCTGCAG ATGC&lt;br /&gt;
&lt;br /&gt;
'''Forward Primer (78bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C TAAC 3’&lt;br /&gt;
&lt;br /&gt;
'''Reverse Primer (78bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT CTGCAGCGGCCGCTACTAGTA TCAACACGCA CGGTGTTAGA TAAATCAACA CGCACGGTGT TAGACTATA ACAA 3’&lt;br /&gt;
&lt;br /&gt;
==Mnt/LacI hybrid promoter==&lt;br /&gt;
&lt;br /&gt;
'''Responsible:Robert Cool'''&lt;br /&gt;
&lt;br /&gt;
'''Rationale'''&lt;br /&gt;
&lt;br /&gt;
This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG.&lt;br /&gt;
&lt;br /&gt;
'''References and Links'''&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0073 R0073][http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 R0010]&lt;br /&gt;
&lt;br /&gt;
'''Design considerations'''&lt;br /&gt;
Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&amp;amp;pubmedid=11226234 ). Introduction of a LacI binding site between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by LacI. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tgtgtggaattgtga, and 2) Position lacI binding site (composed of an inverted repeat) from the lacI regulated promoter (R0010) immediately 3’ to truncated mnt promoter.&lt;br /&gt;
&lt;br /&gt;
'''Entire desired sequence (138 bp)'''&lt;br /&gt;
&lt;br /&gt;
Gcat Gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt   tgtgtggaattgtgagcggataacaatttcacaca   tactagtagcggccgctgcag atgc&lt;br /&gt;
&lt;br /&gt;
'''Annotated desired sequence'''&lt;br /&gt;
&lt;br /&gt;
Biobrick prefix: GCAT gaattcgcggccgcttctagag  &lt;br /&gt;
&lt;br /&gt;
Mnt promoter (everything before and including -10): ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt&lt;br /&gt;
&lt;br /&gt;
LacI binding site (last 35bp, everything after -10):  tgtgtggaattgtgagcggataacaatttcacacagagtcgtattaattt&lt;br /&gt;
&lt;br /&gt;
Biobrick suffix: tactagtagcggccgctgcag ATCG&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Forward Primer (75bp)'''&lt;br /&gt;
&lt;br /&gt;
gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctat&lt;br /&gt;
&lt;br /&gt;
'''Reverse Primer (75 bp)'''&lt;br /&gt;
&lt;br /&gt;
gcatctgcagcggccgctactagtatgtgtgaaattgttatccgctcacaattccacacaactataggagatcta&lt;br /&gt;
&lt;br /&gt;
==Mnt/TetR hybrid promoter==&lt;br /&gt;
&lt;br /&gt;
'''Responsible:Robert Cool'''&lt;br /&gt;
&lt;br /&gt;
'''Background'''&lt;br /&gt;
&lt;br /&gt;
This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc.&lt;br /&gt;
&lt;br /&gt;
'''References and links'''&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0073 R0073] [http://partsregistry.org/Part:BBa_R0040 R0040]&lt;br /&gt;
&lt;br /&gt;
'''Design considerations'''&lt;br /&gt;
Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&amp;amp;pubmedid=11226234 ). Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta), but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3’ to truncated mnt -10 sequence.&lt;br /&gt;
&lt;br /&gt;
'''Entire desired sequence (149 bp)'''&lt;br /&gt;
&lt;br /&gt;
Gcat gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tccctatcagtgatagaga actgta atccctatcagtgatagagat tactagtagcggccgctgcag atgc&lt;br /&gt;
&lt;br /&gt;
'''Annotated desired sequence'''&lt;br /&gt;
&lt;br /&gt;
Biobrick prefix: GCAT gaattcgcggccgcttctagag&lt;br /&gt;
&lt;br /&gt;
Mnt promoter (everything before and including -10):    ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt&lt;br /&gt;
&lt;br /&gt;
TetR binding site, tetR1: tccctatcagtgatagaga&lt;br /&gt;
&lt;br /&gt;
Spacer: actgta&lt;br /&gt;
&lt;br /&gt;
TetR binding site, tetR2: atccctatcagtgatagagat&lt;br /&gt;
&lt;br /&gt;
Biobrick suffix: tactagtagcggccgctgcag TAGC&lt;br /&gt;
&lt;br /&gt;
'''Forward primer (81 bp)'''       &lt;br /&gt;
&lt;br /&gt;
Gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagttcc&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Reverse primer (81 bp)'''&lt;br /&gt;
&lt;br /&gt;
gcatctgcagcggccgctactagtaatctctatcactgatagggattacagttctctatcactgatagggaactataggag&lt;br /&gt;
&lt;br /&gt;
==LsrA/cI hybrid promoter==&lt;br /&gt;
&lt;br /&gt;
'''Responsible: Andrew Gordon'''&lt;br /&gt;
&lt;br /&gt;
'''Rationale'''&lt;br /&gt;
&lt;br /&gt;
This hybrid promoter uses the LsrA promoter that is capable of being repressed by LsrR - induction can occur with phospho-AI-2.  Binding sites for cI repressor also occur. As a result the promoter is off in the absence of AI-2 and on in the presence of AI-2, but always off in the presence of cI.   &lt;br /&gt;
&lt;br /&gt;
'''References and links'''&lt;br /&gt;
&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/187/6/2066?view=long&amp;amp;pmid=15743955#F7 Wang et al]&lt;br /&gt;
[http://fruitfly.org:9005/seq_tools/promoter.html Promoter predictor]&lt;br /&gt;
&lt;br /&gt;
'''Design considerations'''&lt;br /&gt;
&lt;br /&gt;
The promoter region for LsrA should remain unaltered while cI binding sites (OR2) are introduced downstream.  The OR2 sites with cI bound should not allow transcription. The cI binding sites have a natural 6 bp spacer between them. It would be desirable to position the cI binding sites immediately downstream of the -10 region of the LsrA promoter.  However, experimental evidence for the txn start (+1) appears to be lacking.  &lt;br /&gt;
 &lt;br /&gt;
'''Design A - OR1 cI Cassette'''&lt;br /&gt;
&lt;br /&gt;
This will involve direct synthesis from two oligos of a biobricked part that contains two copies of the cI binding sites.  These can then be assembled behind the existing pLsrA promoter.&lt;br /&gt;
&lt;br /&gt;
'''Entire desired sequence'''&lt;br /&gt;
&lt;br /&gt;
TAACACCGTGCGTGTTGATTTATCTAACACCGTGCGTGTTGA&lt;br /&gt;
&lt;br /&gt;
Prefix: gcat  gaattcgcggccgcttctagag &lt;br /&gt;
&lt;br /&gt;
5' half of part: TAACACCGTGCGTGTTGATTTATCTAAC&lt;br /&gt;
&lt;br /&gt;
'''Forward oligo, pLsr/cI forward'''&lt;br /&gt;
&lt;br /&gt;
gcat  gaattcgcggccgcttctagag TAACACCGTGCGTGTTGATTTATCTAAC&lt;br /&gt;
&lt;br /&gt;
3' half of part: TTGATTTATCTAACACCGTGCGTGTTGA&lt;br /&gt;
&lt;br /&gt;
Reverse complement of 3' half of part: TAACACCGTGCGTGTTGATTTATCTAAC&lt;br /&gt;
&lt;br /&gt;
Suffix: gcat ctgcagcggccgctactagta&lt;br /&gt;
&lt;br /&gt;
'''Reverse oligo pLsrA/cI reverse'''&lt;br /&gt;
&lt;br /&gt;
gcat  ctgcagcggccgctactagta  TCAACACGCTCGGTGTTAGATAAATCAA&lt;br /&gt;
&lt;br /&gt;
Oligos have a 15 bp overlap for direct synthesis&lt;br /&gt;
&lt;br /&gt;
'''Design B - de novo pLsrA/cI promoter''' '''CHOSEN DESIGN'''&lt;br /&gt;
&lt;br /&gt;
According to [http://jb.asm.org/cgi/content/full/187/6/2066?view=long&amp;amp;pmid=15743955#F7 Wang et al], the start site for transcription predicted by the BDGP software (we could not replicate this!) is as indicated below in bold on the sequence of the pLsrA promoter that we built:&lt;br /&gt;
&lt;br /&gt;
AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAA'''TACAT T'''TGTTCA'''A'''AA CTCACCTGCA AAACTGAA&lt;br /&gt;
&lt;br /&gt;
So, a possible design for a hybrid LsrR/CI promoter would be to place two binding sites for cI immediately downstream of the -10 sequence of the LsrA promoter.&lt;br /&gt;
&lt;br /&gt;
Truncated LsrA promoter: AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAATACAT T&lt;br /&gt;
&lt;br /&gt;
cI binding site, OR1 and OR2 with 6 bp that naturally exists in Lambda promoter between OR2 and OR1, a 6 bp spacer has been inserted between the two OR sites so as to mutate the cI -35 region: TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA&lt;br /&gt;
&lt;br /&gt;
Synthesis could be accomplished with the already purchased primer &amp;quot;pLsrA forward&amp;quot; and a new primer that binds to the last portion of the truncated LsrA promoter.&lt;br /&gt;
&lt;br /&gt;
'''Entire Desired Sequence'''  AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAATACAT T   TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA&lt;br /&gt;
&lt;br /&gt;
'''New primer needed - &amp;quot;pLsrA/cI reverse&amp;quot; {82 bp}'''&lt;br /&gt;
&lt;br /&gt;
GCAT  CTGCAGCGGCCGCTACTAGTA  TTATCACCGCCAGAGGTAAAATctTCAACACGCACGGTGTTA  AATGTATTTCTGCTT&lt;br /&gt;
&lt;br /&gt;
Suffix with spacer (reverse complement):  GCAT CTGCAGCGGCCGCTACTAGTA  &lt;br /&gt;
&lt;br /&gt;
OR1 and OR2 sites with -35 mutations in the last 2 bases:TAACACCGTGCGTGTTGAagATTTTACCTCTGGCGGTGATAA&lt;br /&gt;
&lt;br /&gt;
OR1 and OR2 sites with -35 mutations in the last 2 bases(reverse complement): TTATCACCGCCAGAGGTAAAATctTCAACACGCACGGTGTTA&lt;br /&gt;
&lt;br /&gt;
15 nt from 3' end of truncated LsrA promoter (reverse complement): A ATGTATTTCT GCTT&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Oligo_design_for_XOR_Hybrid_Promoters&amp;diff=5383</id>
		<title>Oligo design for XOR Hybrid Promoters</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Oligo_design_for_XOR_Hybrid_Promoters&amp;diff=5383"/>
				<updated>2008-06-18T16:03:13Z</updated>
		
		<summary type="html">&lt;p&gt;AnGordon: /* LsrA/cI hybrid promoter */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Lux-cI hybrid promoter==&lt;br /&gt;
'''Responsible:Xiao Zhu'''&lt;br /&gt;
&lt;br /&gt;
'''Rationale'''&lt;br /&gt;
&lt;br /&gt;
This hybrid promoter is designed to respond to activation by LuxR when it is bound to AHL and to repression by the phage lambda cI repressor.  The repression needs to win over activation.  According to Ron Weiss, “the effect of cI is dominant over LuxR”(Ron Weiss, part description for R0065).  &lt;br /&gt;
&lt;br /&gt;
'''References and links'''&lt;br /&gt;
&lt;br /&gt;
[http://www.pnas.org/cgi/content/full/101/17/6355 Spatiotemporal control of gene expression with pulse-generating networks]&lt;br /&gt;
&lt;br /&gt;
[http://www.pnas.org/cgi/content/full/0307571101/DC1 Its supporting information]&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0062 Lux/HSL]&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/Part:BBa_R0051 cI]&lt;br /&gt;
&lt;br /&gt;
'''Design Considerations'''&lt;br /&gt;
&lt;br /&gt;
We have come up with three possible designs for this promoter.  Designs A and B are based on the idea of replacing the region of the Lux promoter downstream of the -35 either the OR1 or the OR2 cI half-operator.  A) cI OR1, containing the lambda pR -10 region.  B) cI OR2, added LuxR-10 region. Based on what we have found up to now, promoters which are constructed just by inserting OR1/2 downstream of Lux are all very leaky.&lt;br /&gt;
&lt;br /&gt;
We hope that doing in this way could lead a stronger regulation for cI OR1/2.  There’s a journal talking about a research that used Lux-cI hybrid promoter in their system. What they did is to insert cI OR1 upstream of Lux +1(they had a mutant for OR1 sequence), and it’s leaky (“In this case, even without AHL, leaky CI expression completely represses luxPRcI-OR1”). &lt;br /&gt;
&lt;br /&gt;
Design C, to use OR2 twice, is because “it requires the binding of two cI repressor dimers for maximal repression”, but as BBa_R0065 has shown, if we put both OR2 and OR1 downstream of Lux, the promoter won’t work very well, it’s very leaky at high copy number. And we found that ETHZ iGEM’07 team were building these hybrid promoters as well. They used OR2 twice. We don’t know whether OR2 has any advantages over OR1 for functioning.&lt;br /&gt;
&lt;br /&gt;
'''Design A - LuxR/HSL + OR1'''&lt;br /&gt;
&lt;br /&gt;
'''Desired sequence A (101bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TACCTCTGGCGGTGATAA T GGTTGC TACTAGTAGC GGCCGCTGCA GATGC 3’&lt;br /&gt;
&lt;br /&gt;
'''Annotation of desired sequence A'''&lt;br /&gt;
&lt;br /&gt;
Oligos have 15bp overlap for direct synthesis&lt;br /&gt;
&lt;br /&gt;
BBa_Prefix: GCAT  GAATTCGCGGCCGCTTCTAGAG&lt;br /&gt;
&lt;br /&gt;
LuxR/HSL Box (only includes region upstream of -35 and the first T of -35): ACCTGTAGGA TCGTACAGG T&lt;br /&gt;
&lt;br /&gt;
LuxR -35:  TTTACG&lt;br /&gt;
&lt;br /&gt;
cI Half-Operator OR1: TACCTCTGGCGGTGATAA&lt;br /&gt;
&lt;br /&gt;
Lambda pR -10: GATAAT &lt;br /&gt;
&lt;br /&gt;
Spacer: (naturally occurring just 3' to -10 in cI promoter): GGTTGC&lt;br /&gt;
&lt;br /&gt;
Suffix: TACTAGTAGCGGCCGCTGCAG ATGC&lt;br /&gt;
&lt;br /&gt;
'''Forward primer (58bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TACCTCT3’&lt;br /&gt;
&lt;br /&gt;
'''Reverse Primer (58bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT CTGCAG CGGCCGCTAC TAGTAGCAAC CATTATCACC GCCAGAGGTA CGTAAACC 3’&lt;br /&gt;
&lt;br /&gt;
'''Design B - LuxR/HSL + OR2''' '''CHOSEN DESIGN'''&lt;br /&gt;
&lt;br /&gt;
'''Desired sequence B (108bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TAACACCGTG CGTGTTGA TATAGT CGAATAAA TACTAGTAGCGGCCGCTGCAGATGC 3’&lt;br /&gt;
&lt;br /&gt;
'''Annotated desired sequence B'''&lt;br /&gt;
&lt;br /&gt;
BBa_Prefix: GCAT  GAATTCGCGGCCGCTTCTAGAG&lt;br /&gt;
&lt;br /&gt;
LuxR/HSL Box (only includes region upstream of -35 and the first T of -35): ACCTGTAGGA TCGTACAGG T&lt;br /&gt;
&lt;br /&gt;
LuxR -35: TTTACG&lt;br /&gt;
&lt;br /&gt;
Lambda Half-Operator OR2: TAACACCGTG CGTGTTGA&lt;br /&gt;
&lt;br /&gt;
LuxR -10: TATAGT (we used the -10 region from LuxR in order to reduce the risk that LuxR -35 region won’t work well with -10 region from other sources.)&lt;br /&gt;
&lt;br /&gt;
Spacer (naturally occurs after LuxR -10): CGAATAAA&lt;br /&gt;
&lt;br /&gt;
Suffix: TACTAGTAGCGGCCGCTGCAG ATGC&lt;br /&gt;
&lt;br /&gt;
'''Forward Primer (63bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TAACACCGTGCG 3’&lt;br /&gt;
&lt;br /&gt;
'''Reverse Primer (61bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT CTGCAG CGGCCGCTAC TAGTATTTAT TCGACTATAT CAACACGCAC GGTGTTACGTA 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Design C - LuxR/HSL + 2xOR2'''&lt;br /&gt;
&lt;br /&gt;
'''Desired sequence C (141bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C TAACACCGTG CGTGTTGA  TTTATC TAACACCGTG CGTGTTGA TACTAGTAGCGGCCGCTGCAGATGC 3’&lt;br /&gt;
&lt;br /&gt;
'''Annotated desired sequence C'''&lt;br /&gt;
&lt;br /&gt;
BBa_Prefix: GCAT  GAATTCGCGGCCGCTTCTAGAG&lt;br /&gt;
&lt;br /&gt;
Lux/HSL (the whole sequence, including -35 and -10): ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C&lt;br /&gt;
&lt;br /&gt;
Lux -35: TTTACG&lt;br /&gt;
&lt;br /&gt;
Lux -10: TATAGT&lt;br /&gt;
&lt;br /&gt;
2xOR2 with 6 bp that naturally exist in Lambda promoter between OR2 and OR1 (we inserted the 6 bp spacer backwards so as to break the cI -35 region): TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA&lt;br /&gt;
&lt;br /&gt;
Suffix: TACTAGTAGCGGCCGCTGCAG ATGC&lt;br /&gt;
&lt;br /&gt;
'''Forward Primer (78bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT  GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C TAAC 3’&lt;br /&gt;
&lt;br /&gt;
'''Reverse Primer (78bp)'''&lt;br /&gt;
&lt;br /&gt;
5’ GCAT CTGCAGCGGCCGCTACTAGTA TCAACACGCA CGGTGTTAGA TAAATCAACA CGCACGGTGT TAGACTATA ACAA 3’&lt;br /&gt;
&lt;br /&gt;
==Mnt/LacI hybrid promoter==&lt;br /&gt;
&lt;br /&gt;
'''Responsible:Robert Cool'''&lt;br /&gt;
&lt;br /&gt;
'''Rationale'''&lt;br /&gt;
&lt;br /&gt;
This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG.&lt;br /&gt;
&lt;br /&gt;
'''References and Links'''&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0073 R0073][http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 R0010]&lt;br /&gt;
&lt;br /&gt;
'''Design considerations'''&lt;br /&gt;
Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&amp;amp;pubmedid=11226234 ). Introduction of a LacI binding site between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by LacI. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tgtgtggaattgtga, and 2) Position lacI binding site (composed of an inverted repeat) from the lacI regulated promoter (R0010) immediately 3’ to truncated mnt promoter.&lt;br /&gt;
&lt;br /&gt;
'''Entire desired sequence (138 bp)'''&lt;br /&gt;
&lt;br /&gt;
Gcat Gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt   tgtgtggaattgtgagcggataacaatttcacaca   tactagtagcggccgctgcag atgc&lt;br /&gt;
&lt;br /&gt;
'''Annotated desired sequence'''&lt;br /&gt;
&lt;br /&gt;
Biobrick prefix: GCAT gaattcgcggccgcttctagag  &lt;br /&gt;
&lt;br /&gt;
Mnt promoter (everything before and including -10): ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt&lt;br /&gt;
&lt;br /&gt;
LacI binding site (last 35bp, everything after -10):  tgtgtggaattgtgagcggataacaatttcacacagagtcgtattaattt&lt;br /&gt;
&lt;br /&gt;
Biobrick suffix: tactagtagcggccgctgcag ATCG&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Forward Primer (75bp)'''&lt;br /&gt;
&lt;br /&gt;
gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctat&lt;br /&gt;
&lt;br /&gt;
'''Reverse Primer (75 bp)'''&lt;br /&gt;
&lt;br /&gt;
gcatctgcagcggccgctactagtatgtgtgaaattgttatccgctcacaattccacacaactataggagatcta&lt;br /&gt;
&lt;br /&gt;
==Mnt/TetR hybrid promoter==&lt;br /&gt;
&lt;br /&gt;
'''Responsible:Robert Cool'''&lt;br /&gt;
&lt;br /&gt;
'''Background'''&lt;br /&gt;
&lt;br /&gt;
This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc.&lt;br /&gt;
&lt;br /&gt;
'''References and links'''&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0073 R0073] [http://partsregistry.org/Part:BBa_R0040 R0040]&lt;br /&gt;
&lt;br /&gt;
'''Design considerations'''&lt;br /&gt;
Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&amp;amp;pubmedid=11226234 ). Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta), but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3’ to truncated mnt -10 sequence.&lt;br /&gt;
&lt;br /&gt;
'''Entire desired sequence (149 bp)'''&lt;br /&gt;
&lt;br /&gt;
Gcat gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tccctatcagtgatagaga actgta atccctatcagtgatagagat tactagtagcggccgctgcag atgc&lt;br /&gt;
&lt;br /&gt;
'''Annotated desired sequence'''&lt;br /&gt;
&lt;br /&gt;
Biobrick prefix: GCAT gaattcgcggccgcttctagag&lt;br /&gt;
&lt;br /&gt;
Mnt promoter (everything before and including -10):    ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt&lt;br /&gt;
&lt;br /&gt;
TetR binding site, tetR1: tccctatcagtgatagaga&lt;br /&gt;
&lt;br /&gt;
Spacer: actgta&lt;br /&gt;
&lt;br /&gt;
TetR binding site, tetR2: atccctatcagtgatagagat&lt;br /&gt;
&lt;br /&gt;
Biobrick suffix: tactagtagcggccgctgcag TAGC&lt;br /&gt;
&lt;br /&gt;
'''Forward primer (81 bp)'''       &lt;br /&gt;
&lt;br /&gt;
Gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagttcc&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Reverse primer (81 bp)'''&lt;br /&gt;
&lt;br /&gt;
gcatctgcagcggccgctactagtaatctctatcactgatagggattacagttctctatcactgatagggaactataggag&lt;br /&gt;
&lt;br /&gt;
==LsrA/cI hybrid promoter==&lt;br /&gt;
&lt;br /&gt;
'''Responsible: Andrew Gordon'''&lt;br /&gt;
&lt;br /&gt;
'''Rationale'''&lt;br /&gt;
&lt;br /&gt;
This hybrid promoter uses the LsrA promoter that is capable of being repressed by LsrR - induction can occur with phospho-AI-2.  Binding sites for cI repressor also occur. As a result the promoter is off in the absence of AI-2 and on in the presence of AI-2, but always off in the presence of cI.   &lt;br /&gt;
&lt;br /&gt;
'''References and links'''&lt;br /&gt;
&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/187/6/2066?view=long&amp;amp;pmid=15743955#F7 Wang et al]&lt;br /&gt;
[http://fruitfly.org:9005/seq_tools/promoter.html Promoter predictor]&lt;br /&gt;
&lt;br /&gt;
'''Design considerations'''&lt;br /&gt;
&lt;br /&gt;
The promoter region for LsrA should remain unaltered while cI binding sites (OR2) are introduced downstream.  The OR2 sites with cI bound should not allow transcription. The cI binding sites have a natural 6 bp spacer between them. It would be desirable to position the cI binding sites immediately downstream of the -10 region of the LsrA promoter.  However, experimental evidence for the txn start (+1) appears to be lacking.  &lt;br /&gt;
 &lt;br /&gt;
'''Design A - 2xOR2 cI Cassette'''&lt;br /&gt;
&lt;br /&gt;
This will involve direct synthesis from two oligos of a biobricked part that contains two copies of the cI binding sites.  These can then be assembled behind the existing pLsrA promoter.&lt;br /&gt;
&lt;br /&gt;
'''Entire desired sequence'''&lt;br /&gt;
&lt;br /&gt;
TAACACCGTGCGTGTTGATTTATCTAACACCGTGCGTGTTGA&lt;br /&gt;
&lt;br /&gt;
Prefix: gcat  gaattcgcggccgcttctagag &lt;br /&gt;
&lt;br /&gt;
5' half of part: TAACACCGTGCGTGTTGATTTATCTAAC&lt;br /&gt;
&lt;br /&gt;
'''Forward oligo, pLsr/cI forward'''&lt;br /&gt;
&lt;br /&gt;
gcat  gaattcgcggccgcttctagag TAACACCGTGCGTGTTGATTTATCTAAC&lt;br /&gt;
&lt;br /&gt;
3' half of part: TTGATTTATCTAACACCGTGCGTGTTGA&lt;br /&gt;
&lt;br /&gt;
Reverse complement of 3' half of part: TAACACCGTGCGTGTTGATTTATCTAAC&lt;br /&gt;
&lt;br /&gt;
Suffix: gcat ctgcagcggccgctactagta&lt;br /&gt;
&lt;br /&gt;
'''Reverse oligo pLsrA/cI reverse'''&lt;br /&gt;
&lt;br /&gt;
gcat  ctgcagcggccgctactagta  TCAACACGCTCGGTGTTAGATAAATCAA&lt;br /&gt;
&lt;br /&gt;
Oligos have a 15 bp overlap for direct synthesis&lt;br /&gt;
&lt;br /&gt;
'''Design B - de novo pLsrA/cI promoter''' '''CHOSEN DESIGN'''&lt;br /&gt;
&lt;br /&gt;
According to [http://jb.asm.org/cgi/content/full/187/6/2066?view=long&amp;amp;pmid=15743955#F7 Wang et al], the start site for transcription predicted by the BDGP software (we could not replicate this!) is as indicated below in bold on the sequence of the pLsrA promoter that we built:&lt;br /&gt;
&lt;br /&gt;
AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAA'''TACAT T'''TGTTCA'''A'''AA CTCACCTGCA AAACTGAA&lt;br /&gt;
&lt;br /&gt;
So, a possible design for a hybrid LsrR/CI promoter would be to place two binding sites for cI immediately downstream of the -10 sequence of the LsrA promoter.&lt;br /&gt;
&lt;br /&gt;
Truncated LsrA promoter: AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAATACAT T&lt;br /&gt;
&lt;br /&gt;
cI binding site, 2x OR2 with 6 bp that naturally exists in Lambda promoter between OR2 and OR1, a 6 bp spacer has been inserted between the two OR2 sites so as to mutate the cI -35 region: TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA&lt;br /&gt;
&lt;br /&gt;
Synthesis could be accomplished with the already purchased primer &amp;quot;pLsrA forward&amp;quot; and a new primer that binds to the last portion of the truncated LsrA promoter.&lt;br /&gt;
&lt;br /&gt;
'''Entire Desired Sequence'''  AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAATACAT T   TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA&lt;br /&gt;
&lt;br /&gt;
'''New primer needed - &amp;quot;pLsrA/cI reverse&amp;quot; {82 bp}'''&lt;br /&gt;
&lt;br /&gt;
GCATCTGCAGCGGCCGCTACTAGTATTATCACCGCCAGAGGTAAAATCTTCAACACGCACGGTGTTAAATGTATTTCTGCTT&lt;br /&gt;
&lt;br /&gt;
Suffix with spacer (reverse complement):  GCAT CTGCAGCGGCCGCTACTAGTA   &lt;br /&gt;
2x OR2 sites (reverse complement): TCAACACG CACGGTGTTA GATAAA TCAACACG CACGGTGTTA &lt;br /&gt;
15 nt from 3' end of truncated LsrA promoter (reverse complement): A ATGTATTTCT GCTTTTAATT&lt;/div&gt;</summary>
		<author><name>AnGordon</name></author>	</entry>

	</feed>