GcatWiki - User contributions [en]

Q5 PCR NEB

2016-06-14T21:05:58Z

Anbuser: /* Modifications */

== Reaction Setup ==

{| class="wikitable"
!|'''REAGENT'''
!|'''VOLUME (µL)'''
!|'''FINAL CONC.'''
|-
|'''10 µM Forward Primer'''
|2.5 µL
|0.5 µM
|-
|'''10 µM Reverse Primer'''
|2.5 µL
|0.5 µM
|-
|'''Template DNA'''
|Y (1ng)
|1 ng
|-
|'''Q5 High-Fidelity 2X Master Mix'''
|25 µL
|1X
|-
|'''Nuclease-free Water'''
|20- Y
|
|}
'''Final Volume = 50µL'''

Notes:

• Q5 High-Fidelity 2X Master Mix has an error rate > 100-fold lower than that of Taq DNA Polymerase

• Q5 High-Fidelity 2X Master Mix can be stored at -20°C. If precipitate forms after thawing, resuspend before use

• Remember to first dilute primers in nuclease-free water if starting with a higher concentration

• Do not exceed 50 µL final volume

== Thermocycling Conditions==

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!colspan="2"|'''TIME'''
|-
|
|
|'''<6kb'''
|'''≥6kb'''
|-
|'''Initial Denaturation'''
|98
|30 sec
|1-3 min
|-
|'''30 Cycles''' ''denature''
''anneal''

''extend''
|98
50-71

72
|10 sec
20 sec

10 sec per kb
|10 sec
50 sec

1 min per kb
|-
|'''Final Extension'''
|72
|2 min
|2 min
|-
|'''Hold'''
|4-22
|
|
|}

To find annealing temperature, follow steps on the NEB Tm Calculator, [http://tmcalculator.neb.com/#!/] which should yield a temperature 3°C above the Tm of the lower primer

== Modifications ==
If annealing temperature is above 72°C, use two-step PCR protocol below

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!colspan="2"|'''TIME'''
|-
|
|
|'''<6kb'''
|'''≥6kb'''
|-
|'''Initial Denaturation'''
|98
|30 sec
|1-3 min
|-
|'''30 Cycles''' ''denature''
''anneal & extend''
|98
≥72
|10 sec
10 sec per kb
|10 sec
1 min per kb
|-
|'''Final Extension'''
|72
|2 min
|2 min
|-
|'''Hold'''
|4-22
|
|
|}

Note that the length of each step should be thought of as a gradient, not a hard cutoff at 6kb.

For more information, visit the NEB Q5 High-Fidelity 2X Master Mix Protocol [https://www.neb.com/protocols/2012/08/29/protocol-for-q5-high-fidelity-2x-master-mix-m0492]

Q5 PCR NEB

2016-06-14T21:03:17Z

Anbuser: /* Thermocycling Conditions */

Q5 PCR NEB

2016-06-14T20:56:09Z

Anbuser: /* Reaction Setup */

Q5 PCR NEB

2016-06-14T20:46:23Z

Anbuser: Created page with "== Reaction Setup == {| class="wikitable" !|'''REAGENT''' !|'''VOLUME (µL)''' !|'''FINAL CONC.''' |- |'''10 µM Forward Primer''' |2.5 µL |0.5 µM |- |'''10 µM Reverse Pr..."

Davidson Protocols

2016-06-14T20:39:49Z

Anbuser:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Davidson Protocols

2016-06-14T20:39:12Z

Anbuser:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp_PCR_NEB]] '''How to set up LongAmp PCR'''
#[[Q5_PCR_NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

LongAmp PCR NEB

2016-06-14T20:09:01Z

Anbuser: /* Thermocycling Conditions */

== Reaction Setup ==

{| class="wikitable"
!|'''REAGENT'''
!|'''VOLUME (µL)'''
!|'''FINAL CONC.'''
|-
|'''10 µM Forward Primer'''
|2 µL
|0.4 µM
|-
|'''10 µM Reverse Primer'''
|2 µL
|0.4 µM
|-
|'''Template DNA'''
|Y (1ng)
|1 ng
|-
|'''LongAmp Taq 2X Master Mix'''
|25 µL
|1X
|-
|'''Nuclease-free Water'''
|21- Y
|
|}
'''Final Volume = 50µL'''

Notes:

• LongAmp Taq 2X Master Mix can be used to amplify templates of up to 30kb long.

• LongAmp Taq 2X Master Mix can be stored at -20°C, however, it is only stable for 15 freeze-thaw cycles. For more frequent use, NEB recommends storing it at 4°C.

• Remember to first dilute primers in nuclease-free water if starting with a higher concentration

• Do not exceed 50 µL final volume

== Thermocycling Conditions==

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal''

''extend''
|94
45-60

65
|20 sec
40 sec

50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

To find annealing temperature, follow steps on the NEB Tm Calculator, [http://tmcalculator.neb.com/#!/] which should yield a temperature 5°C below the Tm of the lower primer

== Modifications ==

• If template is GC rich, a longer initial denaturation of 2-4 minute is recommended

• If annealing temperature is above 60°C, use two-step PCR protocol below

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal & extend''
|94
60-65
|20 sec
50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

For more information, visit the NEB LongAmp Protocol [https://www.neb.com/protocols/2012/09/05/protocol-for-longamp-taq-2x-master-mix-m0287]

LongAmp PCR NEB

2016-06-14T19:53:51Z

Anbuser: /* Modifications: */

== Reaction Setup ==

{| class="wikitable"
!|'''REAGENT'''
!|'''VOLUME (µL)'''
!|'''FINAL CONC.'''
|-
|'''10 µM Forward Primer'''
|2 µL
|0.4 µM
|-
|'''10 µM Reverse Primer'''
|2 µL
|0.4 µM
|-
|'''Template DNA'''
|Y (1ng)
|1 ng
|-
|'''LongAmp Taq 2X Master Mix'''
|25 µL
|1X
|-
|'''Nuclease-free Water'''
|21- Y
|
|}
'''Final Volume = 50µL'''

Notes:

• LongAmp Taq 2X Master Mix can be used to amplify templates of up to 30kb long.

• LongAmp Taq 2X Master Mix can be stored at -20°C, however, it is only stable for 15 freeze-thaw cycles. For more frequent use, NEB recommends storing it at 4°C.

• Remember to first dilute primers in nuclease-free water if starting with a higher concentration

• Do not exceed 50 µL final volume

== Thermocycling Conditions==

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal''

''extend''
|94
45-60

65
|20 sec
40 sec

50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

To find annealing temperature, follow steps on the NEB Tm Calculator [http://tmcalculator.neb.com/#!/]

== Modifications ==

• If template is GC rich, a longer initial denaturation of 2-4 minute is recommended

• If annealing temperature is above 60°C, use two-step PCR protocol below

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal & extend''
|94
60-65
|20 sec
50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

For more information, visit the NEB LongAmp Protocol [https://www.neb.com/protocols/2012/09/05/protocol-for-longamp-taq-2x-master-mix-m0287]

LongAmp PCR NEB

2016-06-14T19:53:38Z

Anbuser: /* Reaction Setup: */

== Reaction Setup ==

{| class="wikitable"
!|'''REAGENT'''
!|'''VOLUME (µL)'''
!|'''FINAL CONC.'''
|-
|'''10 µM Forward Primer'''
|2 µL
|0.4 µM
|-
|'''10 µM Reverse Primer'''
|2 µL
|0.4 µM
|-
|'''Template DNA'''
|Y (1ng)
|1 ng
|-
|'''LongAmp Taq 2X Master Mix'''
|25 µL
|1X
|-
|'''Nuclease-free Water'''
|21- Y
|
|}
'''Final Volume = 50µL'''

Notes:

• LongAmp Taq 2X Master Mix can be used to amplify templates of up to 30kb long.

• LongAmp Taq 2X Master Mix can be stored at -20°C, however, it is only stable for 15 freeze-thaw cycles. For more frequent use, NEB recommends storing it at 4°C.

• Remember to first dilute primers in nuclease-free water if starting with a higher concentration

• Do not exceed 50 µL final volume

== Thermocycling Conditions==

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal''

''extend''
|94
45-60

65
|20 sec
40 sec

50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

To find annealing temperature, follow steps on the NEB Tm Calculator [http://tmcalculator.neb.com/#!/]

== Modifications: ==

• If template is GC rich, a longer initial denaturation of 2-4 minute is recommended

• If annealing temperature is above 60°C, use two-step PCR protocol below

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal & extend''
|94
60-65
|20 sec
50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

For more information, visit the NEB LongAmp Protocol [https://www.neb.com/protocols/2012/09/05/protocol-for-longamp-taq-2x-master-mix-m0287]

LongAmp PCR NEB

2016-06-14T19:53:12Z

Anbuser: /* Reaction Setup: */

== Reaction Setup: ==

{| class="wikitable"
!|'''REAGENT'''
!|'''VOLUME (µL)'''
!|'''FINAL CONC.'''
|-
|'''10 µM Forward Primer'''
|2 µL
|0.4 µM
|-
|'''10 µM Reverse Primer'''
|2 µL
|0.4 µM
|-
|'''Template DNA'''
|Y (1ng)
|1 ng
|-
|'''LongAmp Taq 2X Master Mix'''
|25 µL
|1X
|-
|'''Nuclease-free Water'''
|21- Y
|
|}
'''Final Volume = 50µL'''

Notes:

• LongAmp Taq 2X Master Mix can be used to amplify templates of up to 30kb long.

• LongAmp Taq 2X Master Mix can be stored at -20°C, however, it is only stable for 15 freeze-thaw cycles. For more frequent use, NEB recommends storing it at 4°C.

• Remember to first dilute primers in nuclease-free water if starting with a higher concentration

• Do not exceed 50 µL final volume

== Thermocycling Conditions==

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal''

''extend''
|94
45-60

65
|20 sec
40 sec

50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

To find annealing temperature, follow steps on the NEB Tm Calculator [http://tmcalculator.neb.com/#!/]

== Modifications: ==

• If template is GC rich, a longer initial denaturation of 2-4 minute is recommended

• If annealing temperature is above 60°C, use two-step PCR protocol below

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal & extend''
|94
60-65
|20 sec
50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

For more information, visit the NEB LongAmp Protocol [https://www.neb.com/protocols/2012/09/05/protocol-for-longamp-taq-2x-master-mix-m0287]

LongAmp PCR NEB

2016-06-14T19:53:01Z

Anbuser: /* Reaction Setup: */

== Reaction Setup: ==

{| class="wikitable"
!|'''REAGENT'''
!|'''VOLUME (µL)'''
!|'''FINAL CONC.'''
|-
|'''10 µM Forward Primer'''
|2 µL
|0.4 µM
|-
|'''10 µM Reverse Primer'''
|2 µL
|0.4 µM
|-
|'''Template DNA'''
|Y (1ng)
|1 ng
|-
|'''LongAmp Taq 2X Master Mix'''
|25 µL
|1X
|-
|'''Nuclease-free Water'''
|21- Y
|
|}
'''Final Volume = 50µL'''

Notes:
• LongAmp Taq 2X Master Mix can be used to amplify templates of up to 30kb long.

• LongAmp Taq 2X Master Mix can be stored at -20°C, however, it is only stable for 15 freeze-thaw cycles. For more frequent use, NEB recommends storing it at 4°C.

• Remember to first dilute primers in nuclease-free water if starting with a higher concentration

• Do not exceed 50 µL final volume

== Thermocycling Conditions==

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal''

''extend''
|94
45-60

65
|20 sec
40 sec

50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

To find annealing temperature, follow steps on the NEB Tm Calculator [http://tmcalculator.neb.com/#!/]

== Modifications: ==

• If template is GC rich, a longer initial denaturation of 2-4 minute is recommended

• If annealing temperature is above 60°C, use two-step PCR protocol below

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal & extend''
|94
60-65
|20 sec
50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

For more information, visit the NEB LongAmp Protocol [https://www.neb.com/protocols/2012/09/05/protocol-for-longamp-taq-2x-master-mix-m0287]

LongAmp PCR NEB

2016-06-14T19:52:13Z

Anbuser: /* Modifications: */

== Reaction Setup: ==

{| class="wikitable"
!|'''REAGENT'''
!|'''VOLUME (µL)'''
!|'''FINAL CONC.'''
|-
|'''10 µM Forward Primer'''
|2 µL
|0.4 µM
|-
|'''10 µM Reverse Primer'''
|2 µL
|0.4 µM
|-
|'''Template DNA'''
|Y (1ng)
|1 ng
|-
|'''LongAmp Taq 2X Master Mix'''
|25 µL
|1X
|-
|'''Nuclease-free Water'''
|21- Y
|
|}

'''Final Volume = 50µL'''

Notes:

• LongAmp Taq 2X Master Mix can be used to amplify templates of up to 30kb long.

• LongAmp Taq 2X Master Mix can be stored at -20°C, however, it is only stable for 15 freeze-thaw cycles. For more frequent use, NEB recommends storing it at 4°C.

• Remember to first dilute primers in nuclease-free water if starting with a higher concentration

• Do not exceed 50 µL final volume

== Thermocycling Conditions==

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal''

''extend''
|94
45-60

65
|20 sec
40 sec

50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

To find annealing temperature, follow steps on the NEB Tm Calculator [http://tmcalculator.neb.com/#!/]

== Modifications: ==

• If template is GC rich, a longer initial denaturation of 2-4 minute is recommended

• If annealing temperature is above 60°C, use two-step PCR protocol below

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal & extend''
|94
60-65
|20 sec
50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

For more information, visit the NEB LongAmp Protocol [https://www.neb.com/protocols/2012/09/05/protocol-for-longamp-taq-2x-master-mix-m0287]

LongAmp PCR NEB

2016-06-14T19:51:22Z

Anbuser: /* Thermocycling Conditions */

== Reaction Setup: ==

{| class="wikitable"
!|'''REAGENT'''
!|'''VOLUME (µL)'''
!|'''FINAL CONC.'''
|-
|'''10 µM Forward Primer'''
|2 µL
|0.4 µM
|-
|'''10 µM Reverse Primer'''
|2 µL
|0.4 µM
|-
|'''Template DNA'''
|Y (1ng)
|1 ng
|-
|'''LongAmp Taq 2X Master Mix'''
|25 µL
|1X
|-
|'''Nuclease-free Water'''
|21- Y
|
|}

'''Final Volume = 50µL'''

Notes:

• LongAmp Taq 2X Master Mix can be used to amplify templates of up to 30kb long.

• LongAmp Taq 2X Master Mix can be stored at -20°C, however, it is only stable for 15 freeze-thaw cycles. For more frequent use, NEB recommends storing it at 4°C.

• Remember to first dilute primers in nuclease-free water if starting with a higher concentration

• Do not exceed 50 µL final volume

== Thermocycling Conditions==

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal''

''extend''
|94
45-60

65
|20 sec
40 sec

50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

To find annealing temperature, follow steps on the NEB Tm Calculator [http://tmcalculator.neb.com/#!/]

== Modifications: ==

• If template is GC rich, a longer initial denaturation of 2-4 minute is recommended

• If annealing temperature is above 60°C, use two-step PCR protocol below

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal & extend''
|94
60-65
|20 sec
50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

LongAmp PCR NEB

2016-06-14T19:47:09Z

Anbuser: /* Reaction Setup: */

LongAmp PCR NEB

2016-06-14T19:46:36Z

Anbuser: /* Thermocycling Conditions */

== Reaction Setup: ==

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''10 µM Forward Primer'''
|2 µL
|0.4 µM
|-
|'''10 µM Reverse Primer'''
|2 µL
|0.4 µM
|-
|'''Template DNA'''
|Y (1ng)
|1 ng
|-
|'''LongAmp Taq 2X Master Mix'''
|25 µL
|1X
|-
|'''Nuclease-free Water'''
|21- Y
|
|}

'''Final Volume = 50µL'''

Notes:

• LongAmp Taq 2X Master Mix can be used to amplify templates of up to 30kb long.

• LongAmp Taq 2X Master Mix can be stored at -20°C, however, it is only stable for 15 freeze-thaw cycles. For more frequent use, NEB recommends storing it at 4°C.

• Remember to first dilute primers in nuclease-free water if starting with a higher concentration

• Do not exceed 50 µL final volume

== Thermocycling Conditions==

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal''

''extend''
|94
45-60*

65
|20 sec
40 sec

50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

LongAmp PCR NEB

2016-06-14T19:45:37Z

Anbuser: Created page with " == Reaction Setup: == {| class="wikitable" !|'''STEP''' !|'''TEMPERATURE (°C)''' !|'''TIME''' |- |'''10 µM Forward Primer''' |2 µL |0.4 µM |- |'''10 µM Reverse Primer'..."

== Reaction Setup: ==

{| class="wikitable"
!|'''STEP'''
!|'''TEMPERATURE (°C)'''
!|'''TIME'''
|-
|'''10 µM Forward Primer'''
|2 µL
|0.4 µM
|-
|'''10 µM Reverse Primer'''
|2 µL
|0.4 µM
|-
|'''Template DNA'''
|Y (1ng)
|1 ng
|-
|'''LongAmp Taq 2X Master Mix'''
|25 µL
|1X
|-
|'''Nuclease-free Water'''
|21- Y
|
|}

'''Final Volume = 50µL'''

Notes:

• LongAmp Taq 2X Master Mix can be used to amplify templates of up to 30kb long.

• LongAmp Taq 2X Master Mix can be stored at -20°C, however, it is only stable for 15 freeze-thaw cycles. For more frequent use, NEB recommends storing it at 4°C.

• Remember to first dilute primers in nuclease-free water if starting with a higher concentration

• Do not exceed 50 µL final volume

== Thermocycling Conditions==

{| class="wikitable"
!|'''REAGENT'''
!|'''VOLUME'''
!|'''FINAL CONC.'''
|-
|'''Initial Denaturation'''
|94
|1 min
|-
|'''30 Cycles''' ''denature''
''anneal''

''extend''
|94
45-60*

65
|20 sec
40 sec

50 sec per kb
|-
|'''Final Extension'''
|65
|10 min
|-
|'''Hold'''
|4-22
|
|}

File:TABLE1.png

2016-06-14T19:14:03Z

Anbuser: Anbuser uploaded a new version of "File:TABLE1.png"

File:TABLE1.png

2016-06-14T19:11:45Z

Anbuser:

Davidson Protocols

2016-06-13T21:17:13Z

Anbuser:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp_PCR_NEB]] '''How to set up LongAmp PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]