<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Dapenev</id>
		<title>GcatWiki - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Dapenev"/>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Special:Contributions/Dapenev"/>
		<updated>2026-10-01T06:58:52Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.28.2</generator>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_TWELVE_(April_2_-_6)&amp;diff=14120</id>
		<title>WEEK TWELVE (April 2 - 6)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_TWELVE_(April_2_-_6)&amp;diff=14120"/>
				<updated>2012-04-10T22:29:41Z</updated>
		
		<summary type="html">&lt;p&gt;Dapenev: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Discuss what we have learned so far and start thinking about project for this summer. &lt;br /&gt;
&lt;br /&gt;
What can be done in small pilot projects to generate preliminary data?  Remember that we do not have to complete the project in one summer.&lt;br /&gt;
&lt;br /&gt;
Journals due at Friday meeting, 3:00 p.m.&lt;br /&gt;
&lt;br /&gt;
'''Meet in Think Tank at 3:00. Video conference with MWSU 3:30 - 4:30 eastern.'''&lt;br /&gt;
&lt;br /&gt;
Be prepared to answer questions from MWSU and have questions to ask them.&lt;br /&gt;
&lt;br /&gt;
Discuss this paper about [http://www.jbioleng.org/content/pdf/1754-1611-5-12.pdf data sheets for standardized parts].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Relevant PRESENTATIONS'''&amp;lt;br&amp;gt;&lt;br /&gt;
This PPT file contains all the slides from student presentations addressing the idea proposed by MWSU. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:Reports_on_Circuits.pptx]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This PPT contains slides summarizing some of the best and most complicated papers. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:Week_11.pptx]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Bibliography of all the papers that we've read collectively so far:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''The Allure of Synthetic Biology'''&lt;br /&gt;
&lt;br /&gt;
Author(s): Valda Vinson and Elizabeth Pennisi&lt;br /&gt;
&lt;br /&gt;
Synthetic biology is a newly emerging field that promises to revolutionize our knowledge of life. From modifying the genetic code, through do-it-yourself labs, or studying and rewriting cellular circuitry, bioengineering should enable us to design biological systems to serve our own needs. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''The Life Hacker'''&lt;br /&gt;
&lt;br /&gt;
Author(s): John Bohannon&lt;br /&gt;
&lt;br /&gt;
George Church, a biologist working for Harvard University, has built a device for multiplex automated genome engineering (MAGE) that can prove to be of great use in humanity’s attempt to reinvent the genetic code. Just one of the ambitious options that lie ahead of this new technology is modifying a cell’s DNA to make the organism impervious to viruses. If that is possible, who’s to say what isn’t?&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Algae’s Second Try'''&lt;br /&gt;
&lt;br /&gt;
Author(s): Robert F. Service&lt;br /&gt;
&lt;br /&gt;
Synthetic biology has revitalized the attempt to produce algal fuels as an alternative industrial source of energy. The rapid progress of the field in the last 15 years has enabled technology to catch up with science, and with the development of new bioengineering tools it has become a lot easier to manipulate algae. Innovative solutions to algal fueling systems are now produced every day, and it would hardly surprise anyone when green technologies soon become far more efficient than regular oil.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''A Lab of Their Own'''&lt;br /&gt;
&lt;br /&gt;
Author(s): Sam Kean&lt;br /&gt;
&lt;br /&gt;
A community of do-it-yourself bioengineers has sprout up in the heart of New York City, combining science, learning, and fun in a way that attracts more and more people every day. The phenomenon is beginning to spread across the United States and outside as well. By making cutting-edge synthetic biology research accessible to people with limited scientific knowledge coming from various backgrounds, such undertakings can truly revolutionize our approach to technological progress. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Visions of Synthetic Biology'''&lt;br /&gt;
&lt;br /&gt;
Author(s): Sara Reardon&lt;br /&gt;
&lt;br /&gt;
The world’s first art exhibition dedicated to biological engineering sends a controversial message to its audience. The artists behind the Bio:Fiction film festival and its sister art show, Synth-ethic, represented in Vienna’s Museum of Natural History,  have drawn inspiration from the progress of field. Nevertheless, it is evident from the ridicule in their works that they remain skeptical to the audacious promises of synthetic biology.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Engineering bacteria to solve the Burnt Pancake Problem. '''&lt;br /&gt;
&lt;br /&gt;
Author(s): Karmella A Haynes, Marian L Broderick, Adam D Brown, Trevor L Butner, James O Dickson, W Lance Harden, Lane H Heard, Eric L Jessen, Kelly J Malloy, Brad J Ogden, Sabriya Rosemond, Samantha Simpson, Erin Zwack, A Malcolm Campbell, Todd T Eckdahl, Laurie J Heyer and Jeffrey L Poet&lt;br /&gt;
&lt;br /&gt;
Haynes et al. designed a system using Hin/hix DNA recombinase that could inverse genetic segments independently, representative of the “pancakes” in the NP-complete Burnt Pancake Problem. In addition to providing a new tool for in vivo genetic manipulation, the concept behind the study can be scaled up to solve larger, more complicated computational problems.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Solving a Hamiltonian Path Problem with a Bacterial Computer. '''&lt;br /&gt;
&lt;br /&gt;
Author(s): Jordan Baumgardner, Karen Acker, Oyinade Adefuye, Samuel T Crowley, Will DeLoache, James O Dickson, Lane Heard, Andrew T Martens, Nickolaus Morton,Michelle Ritter, Amber Shoecraft, Jessica Treece, Matthew Unzicker, Amanda Valencia, Mike Waters, A Malcolm Campbell, Laurie J Heyer, Jeffrey L Poet and Todd T Eckdahl&lt;br /&gt;
&lt;br /&gt;
Using a Hin/hix DNA recombinase system, Baumgradner et al. programmed bacteria to solve the NP-complete Hamiltonian Path Problem, or to find the shortest route from the start to the end of a directed graph, visiting each node (gene) exactly once. The experiment validates synthetic biology as an alternative to regular computing.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Bacterial Hash Function Using DNA-Based XOR Logic Reveals Unexpected Behavior of the LuxR Promoter.'''&lt;br /&gt;
&lt;br /&gt;
Author(s): Brianna Pearson, Kin H. Lau, Alicia Allen, James Barron, Robert Cool, Kelly Davis, Will DeLoache, Erin Feeney, Andrew Gordon, John Igo, Aaron Lewis, Kristi Muscalino, Madeline Parra, Pallavi Penumetcha, Victoria G. Rinker, Karlesha Roland, Xiao Zhu, Jeffrey L. Poet, Todd T. Eckdahl, Laurie J. Heyer and A Malcolm Campbell&lt;br /&gt;
&lt;br /&gt;
Pearson et al. designed a DNA-based model for time-delayed bacterial growth capable of performing Hash function calculations. The system is based on an XOR logic gate comprised of two opposing promoters. The researchers also discovered that Plux could be manipulated to activate backwards transcription, a notion which advances our understanding of the promoter and its functions.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''DNA assembly for synthetic biology: from parts to pathways and beyond'''&lt;br /&gt;
&lt;br /&gt;
Author(s): Tom Ellis,Tom Adie and Geoﬀ S. Baldwin&lt;br /&gt;
&lt;br /&gt;
The construction of chromosomal pathways has improved dramatically with the development of DNA combinatorial techniques, as well as the creation of standardized registries of genetic parts and tools. There is no “perfect” assembly method, which is why it is important to consider the characteristics of each one when choosing a way to approach the construction of a new system.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Talking the Talk'''&lt;br /&gt;
&lt;br /&gt;
Author(s): Colin Mcilswain&lt;br /&gt;
&lt;br /&gt;
Loss of public trust in genetically modified organisms (GMOs) in Europe has caused the progress of synthetic biology to come to a halt. Increased public awareness of the speculative risks implicit to bioengineering research has made people reluctant to further their support for the field. It has thus become necessary that the science should be regulated by a form of active public involvement, and it is up to the countries’ governments to make that change happen. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Noise in Gene Expression: Origins, Consequences, and Control'''&lt;br /&gt;
&lt;br /&gt;
Author(s): Jonathan M. Raser and Erin K. O’Shea  &lt;br /&gt;
&lt;br /&gt;
Noise is an inherent property of genetic pathways, and it could be both beneficial and detrimental depending on the specifics of the system. Noise levels can be controlled through varying the size of the network, the number of gene copies, or through positive and negative feedback loops. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Synthetic Biology: Integrated Gene Circuits'''&lt;br /&gt;
&lt;br /&gt;
Author(s): Nagarajan Nandagopal and Michael B. Elowitz&lt;br /&gt;
&lt;br /&gt;
This review paper looks at different techniques to diversify endogenous gene circuits and signal transduction pathways. Noise levels, network specificity, and dynamics are all characteristics of DNA-based systems that can be controlled in a variety of ways, some of the most useful ones of which are presented hereby. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Network Motifs: Simple Building Blocks of Complex Networks'''&lt;br /&gt;
&lt;br /&gt;
 Author(s): R. Milo, S. Shen-Orr, et al&lt;br /&gt;
&lt;br /&gt;
Network motifs are repetitive operational units within a system that would be favored by the process of natural selection. Such motifs represent the building blocks of most complex networks, which is why it is important to create registries with their characteristics, which would be immensely useful for the construction of synthetically designed pathways.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''DNA and the Brain'''&lt;br /&gt;
&lt;br /&gt;
Author(s): Anne Condon&lt;br /&gt;
&lt;br /&gt;
One of the long-existing goals of biological engineering has been to design a neural network based on molecular components. Qian et al. have pushed forward the progress in the area by creating a system made up of four DNA-comprised neurons capable of recognizing writing. The fact that the artificial system has been made capable of memory through complex chemical interactions and adjustments makes the research an important stepping stone for the development of “biochemical systems that can learn.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Scientific Link-Up Yields ‘Control Panel’ for Networks'''&lt;br /&gt;
&lt;br /&gt;
Author(s): Adrian Cho&lt;br /&gt;
&lt;br /&gt;
Scientists Yiu et al. have developed an algorithm to calculate the minimum number of nodes that need to be controlled in a network so that it can be fully-manipulated.  The researchers have demonstrated that their approach is applicable to a wide range of fields, amongst which synthetic biological systems, and have thus developed a powerful tool for evaluating chaos levels in any network.&lt;br /&gt;
&lt;br /&gt;
'''Comprehensive genetic dissection of the magnetosome gene island reveals the step-wise assembly of a prokaryotic organelle&lt;br /&gt;
'''Author(s): Dorothée Murata, Anna Quinlanb, Hojatollah Valic, and Arash Komeili &lt;br /&gt;
Murata et al. investigate organelle biogenesis in magnetotaxic bacteria, an area of biology that has been poorly understood previously. By studying various deletion mutants for magnetosome formation, the researchers were able to identify essential and non-essential encoding regions of the magnetosome island (MAI). This knowledge is necessary for the synthetic reconstruction of the magnetotaxic pathway.&lt;br /&gt;
&lt;br /&gt;
'''Comparative genome analysis of four Magnetotactic bacteria reveals a complex set of group-specific genes implicated in magnetosome biomineralization and function.&lt;br /&gt;
'''Author(s): Michael Richter,  Michael Kube, Dennis A. Bazylinski, Thierry Lombardot, Frank Oliver Glöckner, Richard Reinhardt, and Dirk Schüler &lt;br /&gt;
Richter et al. identified gene clusters that were specifically associated with magnetotaxis by comparing the DNA-sequences of four different strains of bacteria that exhibit the phenotype. Through detection of conserved genes within all of them, the researchers were able to find the parts that are of primary importance for the functioning of the pathway. Such parts would be the prime targets for future investigations. &lt;br /&gt;
&lt;br /&gt;
'''Controllability of complex networks &lt;br /&gt;
'''Author(s): Yang-Yu Liu, Jean-Jacques Slotine, &amp;amp; Albert-La ́szlo ́ Baraba ́si&lt;br /&gt;
This research demonstrates the power of mathematical modeling, through which Liu et al. were able to analyze and predict the controllability of directed networks based on the number of driver nodes that have to be regulated in order to achieve full governance over the system. Their model presents bad news for synthetic biology research, because, as it turns out, sparse heterogenic networks such as most biologically-relevant pathways require the biggest number of driver nodes to be controlled.&lt;br /&gt;
&lt;br /&gt;
'''Next-generation synthetic gene networks &lt;br /&gt;
'''Author(s): Timothy K Lu, Ahmad S Khalil &amp;amp; James J Collins&lt;br /&gt;
There are a number of areas in need of improvement in synthetic biology. The development of modular standardized techniques and toolkits of all sorts open the door to networks of higher complexity that possibly have real-world applications.&lt;br /&gt;
&lt;br /&gt;
'''Word selection affects perceptions of synthetic biology&lt;br /&gt;
'''Author(s): Brianna Pearson, Sam Snell, Kyri Bye-Nagel, Scott Tonidandel, Laurie J Heyer and A. Malcolm Campbell&lt;br /&gt;
Word selection has proven to be immensely important in communicating synthetic biology research to the open public. In order to improve the perception of the field in people’s eyes, it might be better to avoid using words such as “create” that commonly carry a pejorative connotation. &lt;br /&gt;
&lt;br /&gt;
'''Toward the Second Generation of Optogenetic Tools&lt;br /&gt;
'''Author(s): Thomas Kno¨pfel, Michael Z. Lin, Anselm Levskaya, Lin Tian, John Y. Lin,and Edward S. Boyden&lt;br /&gt;
Optogenetics is a newly developing field in synthetic biology that uses light for the control and monitoring of gene expression in cells. Improvements in light-mediated tools such as voltage reporters, neural silencers, and fluorescent proteins gradually eliminate the obstacles that stand before their widespread application. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Phototaxis in the magnetotactic bacterium Magnetospirillum magneticum strain AMB-1 is independent of magnetic fields&lt;br /&gt;
'''Author(s): Chuanfang Chen, Qiufeng Ma, Wei Jiang and Tao Song&lt;br /&gt;
Magnetotaxic bacteria repond differently to combinations of stimuli such as light, heat, and magnetic field. The ability of AMB-1 bacteria to simultaneously perform magnetotaxis and thermotaxis suggests an extensive correlation between the genetic circuitry responsible for both of them. This presents yet another challenge in identifying the genes that encode for one of them specifically.&lt;br /&gt;
&lt;br /&gt;
'''Synthetic Gene Networks That Count&lt;br /&gt;
'''Author(s): Ari E. Friedland, Timothy K. Lu, Xiao Wang, David Shi, George Church, and James J. Collins&lt;br /&gt;
Different approaches can be used when rewiring genetic circuitry so that it emulates digital counting mechanisms. Using various predetermined inputs, such modular mechanisms present yet another promising method for bacterial computing. &lt;br /&gt;
&lt;br /&gt;
'''C. dog&lt;br /&gt;
'''Author(s):?&lt;br /&gt;
C. dog is a system utilizing a pair of ribosomal binding sites to control translation intensity levels. By straightening mRNA coiling, the second variable RBS can be independently combined with any promoter and reporter gene so that it produces an optimal level of gene expression, an emergent property that could undoubtedly prove to be very beneficial for the purposes of bioengineering. &lt;br /&gt;
&lt;br /&gt;
'''Programming Bacteria for Optimization of Genetic Circuits&lt;br /&gt;
'''Author(s): ?&lt;br /&gt;
Noise can be beneficial or deleterious to a system, and there are various ways to control or ignore it. From an engineer’s perspective though, random noise is undesirable. If the input causes noise, one should aim to make the genetic pathway longer, while if the output causes noise, one should aim to make it shorter.&lt;br /&gt;
&lt;br /&gt;
'''CRIM Plasmids, Degradation Tags, and Transposons&lt;br /&gt;
'''Author(s): ?&lt;br /&gt;
CRIM plasmids offer obvious benefits for bioengineering such as modularity and high specificity. Degradation tags can be used to control cellular functioning in a very quick and decisive manner. Transposons provide a high copy number of desired elements. All of these provide innovative and useful tools for the improvement of genetic engineering.&lt;br /&gt;
&lt;br /&gt;
'''Multichromatic Control of Gene Expression in Escherichia coli&lt;br /&gt;
'''Author(s): Jeffrey J. Tabor, Anselm Levskaya, and Christopher A. Voigt &lt;br /&gt;
Optogenetic tools can be applied to control cells in vivo across space and over time. A multichromatic bi-stable switch utilizes reversible sensory mechanisms that differentiate between light inputs, and can be adapted to produce the desired output levels. This system allows for reversible expression that is quicker and with higher resolution than most previously-known similar mechanisms.&lt;br /&gt;
&lt;br /&gt;
'''Robust multicellular computing using genetically encoded NOR gates and chemical ‘wires’&lt;br /&gt;
'''Author(s): Alvin Tamsir, Jeffrey J. Tabor &amp;amp; Christopher A. Voigt&lt;br /&gt;
The modularity of OR/NOR gates can serve to design other, more complex logic gates/pathways with far more variable expression. By combining those gates with cells capablel of quorum-sensation, Tamsir et al. create a novel biological computational system that operates across space. The research is a proof-of-concept of how simple individual motifs can be used to make complex systematic emergent properties.&lt;br /&gt;
&lt;br /&gt;
'''Automated Design of Synthetic Ribosome Binding Sites to Precisely Control Protein Expression&lt;br /&gt;
'''Authors: Howard M. Salis, Ethan A. Mirsky, and Christopher A. Voigt&lt;br /&gt;
Salis et al. have developed an algorithm to predict the reporter gene expression rates based on differently engineered ribosomal binding sites. The method can be very useful in the optimization of system output levels. The “forward” engineering approach described within serves to aid the construction of systems of higher complexity.&lt;br /&gt;
&lt;br /&gt;
'''A sensing array of radically coupled genetic ‘biopixels’&lt;br /&gt;
'''Author(s): Arthur Prindle, Phillip Samayoa, Ivan Razinkov, Tal Danino, Lev S. Tsimring &amp;amp; Jeff Hasty&lt;br /&gt;
“Biopixels” are individual colonies whose oscillations were synthetically synchronized using quorum sensing or gas signaling. This offers yet another valuable resource for biological engineering, by providing a mechanism to coordinate cellular behavior over large distances. In addition, the invention has some readily-available applications, such as the detection of harmful substances in drinking water. &lt;br /&gt;
&lt;br /&gt;
'''BglBrick vectors and datasheets: A syntheticbiology platform for gene expression&lt;br /&gt;
'''Author(s): Taek Soon Lee, Rachel A Krupa, Fuzhong Zhang, Meghdad Hajimorad, William J Holtz, Nilu Prasad, Sung Kuk Lee and Jay D Keasling&lt;br /&gt;
Increasing complexity of synthetically designed genetic systems has necessitated the creation of a library of compatible vectors to enable simultaneous expression of operons from different plasmids on the same host cell. To solve this issue, Lee et al. have designed and characterized a standardized collection of 96 Bgl-Brick-compatible plasmids that opens the door to a faster and easier construction of multi-gene networks.&lt;/div&gt;</summary>
		<author><name>Dapenev</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_TWELVE_(April_2_-_6)&amp;diff=14119</id>
		<title>WEEK TWELVE (April 2 - 6)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_TWELVE_(April_2_-_6)&amp;diff=14119"/>
				<updated>2012-04-10T22:25:24Z</updated>
		
		<summary type="html">&lt;p&gt;Dapenev: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Discuss what we have learned so far and start thinking about project for this summer. &lt;br /&gt;
&lt;br /&gt;
What can be done in small pilot projects to generate preliminary data?  Remember that we do not have to complete the project in one summer.&lt;br /&gt;
&lt;br /&gt;
Journals due at Friday meeting, 3:00 p.m.&lt;br /&gt;
&lt;br /&gt;
'''Meet in Think Tank at 3:00. Video conference with MWSU 3:30 - 4:30 eastern.'''&lt;br /&gt;
&lt;br /&gt;
Be prepared to answer questions from MWSU and have questions to ask them.&lt;br /&gt;
&lt;br /&gt;
Discuss this paper about [http://www.jbioleng.org/content/pdf/1754-1611-5-12.pdf data sheets for standardized parts].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Relevant PRESENTATIONS'''&amp;lt;br&amp;gt;&lt;br /&gt;
This PPT file contains all the slides from student presentations addressing the idea proposed by MWSU. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:Reports_on_Circuits.pptx]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This PPT contains slides summarizing some of the best and most complicated papers. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:Week_11.pptx]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Bibliography of all the papers that we've read collectively so far:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''The Allure of Synthetic Biology'''&lt;br /&gt;
Author(s): Valda Vinson and Elizabeth Pennisi&lt;br /&gt;
Synthetic biology is a newly emerging field that promises to revolutionize our knowledge of life. From modifying the genetic code, through do-it-yourself labs, or studying and rewriting cellular circuitry, bioengineering should enable us to design biological systems to serve our own needs. &lt;br /&gt;
&lt;br /&gt;
'''The Life Hacker'''&lt;br /&gt;
Author(s): John Bohannon&lt;br /&gt;
George Church, a biologist working for Harvard University, has built a device for multiplex automated genome engineering (MAGE) that can prove to be of great use in humanity’s attempt to reinvent the genetic code. Just one of the ambitious options that lie ahead of this new technology is modifying a cell’s DNA to make the organism impervious to viruses. If that is possible, who’s to say what isn’t?&lt;br /&gt;
&lt;br /&gt;
'''Algae’s Second Try'''&lt;br /&gt;
Author(s): Robert F. Service&lt;br /&gt;
Synthetic biology has revitalized the attempt to produce algal fuels as an alternative industrial source of energy. The rapid progress of the field in the last 15 years has enabled technology to catch up with science, and with the development of new bioengineering tools it has become a lot easier to manipulate algae. Innovative solutions to algal fueling systems are now produced every day, and it would hardly surprise anyone when green technologies soon become far more efficient than regular oil.&lt;br /&gt;
&lt;br /&gt;
'''A Lab of Their Own&lt;br /&gt;
'''Author(s): Sam Kean&lt;br /&gt;
A community of do-it-yourself bioengineers has sprout up in the heart of New York City, combining science, learning, and fun in a way that attracts more and more people every day. The phenomenon is beginning to spread across the United States and outside as well. By making cutting-edge synthetic biology research accessible to people with limited scientific knowledge coming from various backgrounds, such undertakings can truly revolutionize our approach to technological progress. &lt;br /&gt;
&lt;br /&gt;
'''Visions of Synthetic Biology&lt;br /&gt;
'''Author(s): Sara Reardon&lt;br /&gt;
The world’s first art exhibition dedicated to biological engineering sends a controversial message to its audience. The artists behind the Bio:Fiction film festival and its sister art show, Synth-ethic, represented in Vienna’s Museum of Natural History,  have drawn inspiration from the progress of field. Nevertheless, it is evident from the ridicule in their works that they remain skeptical to the audacious promises of synthetic biology.&lt;br /&gt;
&lt;br /&gt;
'''Engineering bacteria to solve the Burnt Pancake Problem. &lt;br /&gt;
'''Author(s): Karmella A Haynes, Marian L Broderick, Adam D Brown, Trevor L Butner, James O Dickson, W Lance Harden, Lane H Heard, Eric L Jessen, Kelly J Malloy, Brad J Ogden, Sabriya Rosemond, Samantha Simpson, Erin Zwack, A Malcolm Campbell, Todd T Eckdahl, Laurie J Heyer and Jeffrey L Poet&lt;br /&gt;
Haynes et al. designed a system using Hin/hix DNA recombinase that could inverse genetic segments independently, representative of the “pancakes” in the NP-complete Burnt Pancake Problem. In addition to providing a new tool for in vivo genetic manipulation, the concept behind the study can be scaled up to solve larger, more complicated computational problems.&lt;br /&gt;
&lt;br /&gt;
'''Solving a Hamiltonian Path Problem with a Bacterial Computer. &lt;br /&gt;
'''Author(s): Jordan Baumgardner, Karen Acker, Oyinade Adefuye, Samuel T Crowley, Will DeLoache, James O Dickson, Lane Heard, Andrew T Martens, Nickolaus Morton,Michelle Ritter, Amber Shoecraft, Jessica Treece, Matthew Unzicker, Amanda Valencia, Mike Waters, A Malcolm Campbell, Laurie J Heyer, Jeffrey L Poet and Todd T Eckdahl&lt;br /&gt;
Using a Hin/hix DNA recombinase system, Baumgradner et al. programmed bacteria to solve the NP-complete Hamiltonian Path Problem, or to find the shortest route from the start to the end of a directed graph, visiting each node (gene) exactly once. The experiment validates synthetic biology as an alternative to regular computing.&lt;br /&gt;
&lt;br /&gt;
'''Bacterial Hash Function Using DNA-Based XOR Logic Reveals Unexpected Behavior of the LuxR Promoter.&lt;br /&gt;
'''Author(s): Brianna Pearson, Kin H. Lau, Alicia Allen, James Barron, Robert Cool, Kelly Davis, Will DeLoache, Erin Feeney, Andrew Gordon, John Igo, Aaron Lewis, Kristi Muscalino, Madeline Parra, Pallavi Penumetcha, Victoria G. Rinker, Karlesha Roland, Xiao Zhu, Jeffrey L. Poet, Todd T. Eckdahl, Laurie J. Heyer and A Malcolm Campbell&lt;br /&gt;
Pearson et al. designed a DNA-based model for time-delayed bacterial growth capable of performing Hash function calculations. The system is based on an XOR logic gate comprised of two opposing promoters. The researchers also discovered that Plux could be manipulated to activate backwards transcription, a notion which advances our understanding of the promoter and its functions.&lt;br /&gt;
&lt;br /&gt;
'''DNA assembly for synthetic biology: from parts to pathways and beyond&lt;br /&gt;
'''Author(s): Tom Ellis,Tom Adie and Geoﬀ S. Baldwin&lt;br /&gt;
The construction of chromosomal pathways has improved dramatically with the development of DNA combinatorial techniques, as well as the creation of standardized registries of genetic parts and tools. There is no “perfect” assembly method, which is why it is important to consider the characteristics of each one when choosing a way to approach the construction of a new system.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Talking the Talk&lt;br /&gt;
'''Author(s): Colin Mcilswain&lt;br /&gt;
Loss of public trust in genetically modified organisms (GMOs) in Europe has caused the progress of synthetic biology to come to a halt. Increased public awareness of the speculative risks implicit to bioengineering research has made people reluctant to further their support for the field. It has thus become necessary that the science should be regulated by a form of active public involvement, and it is up to the countries’ governments to make that change happen. &lt;br /&gt;
&lt;br /&gt;
'''Noise in Gene Expression: Origins, Consequences, and Control&lt;br /&gt;
'''Author(s): Jonathan M. Raser and Erin K. O’Shea  &lt;br /&gt;
Noise is an inherent property of genetic pathways, and it could be both beneficial and detrimental depending on the specifics of the system. Noise levels can be controlled through varying the size of the network, the number of gene copies, or through positive and negative feedback loops. &lt;br /&gt;
&lt;br /&gt;
'''Synthetic Biology: Integrated Gene Circuits&lt;br /&gt;
'''Author(s): Nagarajan Nandagopal and Michael B. Elowitz&lt;br /&gt;
This review paper looks at different techniques to diversify endogenous gene circuits and signal transduction pathways. Noise levels, network specificity, and dynamics are all characteristics of DNA-based systems that can be controlled in a variety of ways, some of the most useful ones of which are presented hereby. &lt;br /&gt;
&lt;br /&gt;
'''Network Motifs: Simple Building Blocks of Complex Networks&lt;br /&gt;
''' Author(s): R. Milo, S. Shen-Orr, et al&lt;br /&gt;
Network motifs are repetitive operational units within a system that would be favored by the process of natural selection. Such motifs represent the building blocks of most complex networks, which is why it is important to create registries with their characteristics, which would be immensely useful for the construction of synthetically designed pathways.&lt;br /&gt;
&lt;br /&gt;
'''DNA and the Brain&lt;br /&gt;
'''Author(s): Anne Condon&lt;br /&gt;
One of the long-existing goals of biological engineering has been to design a neural network based on molecular components. Qian et al. have pushed forward the progress in the area by creating a system made up of four DNA-comprised neurons capable of recognizing writing. The fact that the artificial system has been made capable of memory through complex chemical interactions and adjustments makes the research an important stepping stone for the development of “biochemical systems that can learn.”&lt;br /&gt;
&lt;br /&gt;
'''Scientific Link-Up Yields ‘Control Panel’ for Networks&lt;br /&gt;
'''Author(s): Adrian Cho&lt;br /&gt;
Scientists Yiu et al. have developed an algorithm to calculate the minimum number of nodes that need to be controlled in a network so that it can be fully-manipulated.  The researchers have demonstrated that their approach is applicable to a wide range of fields, amongst which synthetic biological systems, and have thus developed a powerful tool for evaluating chaos levels in any network.&lt;br /&gt;
&lt;br /&gt;
'''Comprehensive genetic dissection of the magnetosome gene island reveals the step-wise assembly of a prokaryotic organelle&lt;br /&gt;
'''Author(s): Dorothée Murata, Anna Quinlanb, Hojatollah Valic, and Arash Komeili &lt;br /&gt;
Murata et al. investigate organelle biogenesis in magnetotaxic bacteria, an area of biology that has been poorly understood previously. By studying various deletion mutants for magnetosome formation, the researchers were able to identify essential and non-essential encoding regions of the magnetosome island (MAI). This knowledge is necessary for the synthetic reconstruction of the magnetotaxic pathway.&lt;br /&gt;
&lt;br /&gt;
'''Comparative genome analysis of four Magnetotactic bacteria reveals a complex set of group-specific genes implicated in magnetosome biomineralization and function.&lt;br /&gt;
'''Author(s): Michael Richter,  Michael Kube, Dennis A. Bazylinski, Thierry Lombardot, Frank Oliver Glöckner, Richard Reinhardt, and Dirk Schüler &lt;br /&gt;
Richter et al. identified gene clusters that were specifically associated with magnetotaxis by comparing the DNA-sequences of four different strains of bacteria that exhibit the phenotype. Through detection of conserved genes within all of them, the researchers were able to find the parts that are of primary importance for the functioning of the pathway. Such parts would be the prime targets for future investigations. &lt;br /&gt;
&lt;br /&gt;
'''Controllability of complex networks &lt;br /&gt;
'''Author(s): Yang-Yu Liu, Jean-Jacques Slotine, &amp;amp; Albert-La ́szlo ́ Baraba ́si&lt;br /&gt;
This research demonstrates the power of mathematical modeling, through which Liu et al. were able to analyze and predict the controllability of directed networks based on the number of driver nodes that have to be regulated in order to achieve full governance over the system. Their model presents bad news for synthetic biology research, because, as it turns out, sparse heterogenic networks such as most biologically-relevant pathways require the biggest number of driver nodes to be controlled.&lt;br /&gt;
&lt;br /&gt;
'''Next-generation synthetic gene networks &lt;br /&gt;
'''Author(s): Timothy K Lu, Ahmad S Khalil &amp;amp; James J Collins&lt;br /&gt;
There are a number of areas in need of improvement in synthetic biology. The development of modular standardized techniques and toolkits of all sorts open the door to networks of higher complexity that possibly have real-world applications.&lt;br /&gt;
&lt;br /&gt;
'''Word selection affects perceptions of synthetic biology&lt;br /&gt;
'''Author(s): Brianna Pearson, Sam Snell, Kyri Bye-Nagel, Scott Tonidandel, Laurie J Heyer and A. Malcolm Campbell&lt;br /&gt;
Word selection has proven to be immensely important in communicating synthetic biology research to the open public. In order to improve the perception of the field in people’s eyes, it might be better to avoid using words such as “create” that commonly carry a pejorative connotation. &lt;br /&gt;
&lt;br /&gt;
'''Toward the Second Generation of Optogenetic Tools&lt;br /&gt;
'''Author(s): Thomas Kno¨pfel, Michael Z. Lin, Anselm Levskaya, Lin Tian, John Y. Lin,and Edward S. Boyden&lt;br /&gt;
Optogenetics is a newly developing field in synthetic biology that uses light for the control and monitoring of gene expression in cells. Improvements in light-mediated tools such as voltage reporters, neural silencers, and fluorescent proteins gradually eliminate the obstacles that stand before their widespread application. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Phototaxis in the magnetotactic bacterium Magnetospirillum magneticum strain AMB-1 is independent of magnetic fields&lt;br /&gt;
'''Author(s): Chuanfang Chen, Qiufeng Ma, Wei Jiang and Tao Song&lt;br /&gt;
Magnetotaxic bacteria repond differently to combinations of stimuli such as light, heat, and magnetic field. The ability of AMB-1 bacteria to simultaneously perform magnetotaxis and thermotaxis suggests an extensive correlation between the genetic circuitry responsible for both of them. This presents yet another challenge in identifying the genes that encode for one of them specifically.&lt;br /&gt;
&lt;br /&gt;
'''Synthetic Gene Networks That Count&lt;br /&gt;
'''Author(s): Ari E. Friedland, Timothy K. Lu, Xiao Wang, David Shi, George Church, and James J. Collins&lt;br /&gt;
Different approaches can be used when rewiring genetic circuitry so that it emulates digital counting mechanisms. Using various predetermined inputs, such modular mechanisms present yet another promising method for bacterial computing. &lt;br /&gt;
&lt;br /&gt;
'''C. dog&lt;br /&gt;
'''Author(s):?&lt;br /&gt;
C. dog is a system utilizing a pair of ribosomal binding sites to control translation intensity levels. By straightening mRNA coiling, the second variable RBS can be independently combined with any promoter and reporter gene so that it produces an optimal level of gene expression, an emergent property that could undoubtedly prove to be very beneficial for the purposes of bioengineering. &lt;br /&gt;
&lt;br /&gt;
'''Programming Bacteria for Optimization of Genetic Circuits&lt;br /&gt;
'''Author(s): ?&lt;br /&gt;
Noise can be beneficial or deleterious to a system, and there are various ways to control or ignore it. From an engineer’s perspective though, random noise is undesirable. If the input causes noise, one should aim to make the genetic pathway longer, while if the output causes noise, one should aim to make it shorter.&lt;br /&gt;
&lt;br /&gt;
'''CRIM Plasmids, Degradation Tags, and Transposons&lt;br /&gt;
'''Author(s): ?&lt;br /&gt;
CRIM plasmids offer obvious benefits for bioengineering such as modularity and high specificity. Degradation tags can be used to control cellular functioning in a very quick and decisive manner. Transposons provide a high copy number of desired elements. All of these provide innovative and useful tools for the improvement of genetic engineering.&lt;br /&gt;
&lt;br /&gt;
'''Multichromatic Control of Gene Expression in Escherichia coli&lt;br /&gt;
'''Author(s): Jeffrey J. Tabor, Anselm Levskaya, and Christopher A. Voigt &lt;br /&gt;
Optogenetic tools can be applied to control cells in vivo across space and over time. A multichromatic bi-stable switch utilizes reversible sensory mechanisms that differentiate between light inputs, and can be adapted to produce the desired output levels. This system allows for reversible expression that is quicker and with higher resolution than most previously-known similar mechanisms.&lt;br /&gt;
&lt;br /&gt;
'''Robust multicellular computing using genetically encoded NOR gates and chemical ‘wires’&lt;br /&gt;
'''Author(s): Alvin Tamsir, Jeffrey J. Tabor &amp;amp; Christopher A. Voigt&lt;br /&gt;
The modularity of OR/NOR gates can serve to design other, more complex logic gates/pathways with far more variable expression. By combining those gates with cells capablel of quorum-sensation, Tamsir et al. create a novel biological computational system that operates across space. The research is a proof-of-concept of how simple individual motifs can be used to make complex systematic emergent properties.&lt;br /&gt;
&lt;br /&gt;
'''Automated Design of Synthetic Ribosome Binding Sites to Precisely Control Protein Expression&lt;br /&gt;
'''Authors: Howard M. Salis, Ethan A. Mirsky, and Christopher A. Voigt&lt;br /&gt;
Salis et al. have developed an algorithm to predict the reporter gene expression rates based on differently engineered ribosomal binding sites. The method can be very useful in the optimization of system output levels. The “forward” engineering approach described within serves to aid the construction of systems of higher complexity.&lt;br /&gt;
&lt;br /&gt;
'''A sensing array of radically coupled genetic ‘biopixels’&lt;br /&gt;
'''Author(s): Arthur Prindle, Phillip Samayoa, Ivan Razinkov, Tal Danino, Lev S. Tsimring &amp;amp; Jeff Hasty&lt;br /&gt;
“Biopixels” are individual colonies whose oscillations were synthetically synchronized using quorum sensing or gas signaling. This offers yet another valuable resource for biological engineering, by providing a mechanism to coordinate cellular behavior over large distances. In addition, the invention has some readily-available applications, such as the detection of harmful substances in drinking water. &lt;br /&gt;
&lt;br /&gt;
'''BglBrick vectors and datasheets: A syntheticbiology platform for gene expression&lt;br /&gt;
'''Author(s): Taek Soon Lee, Rachel A Krupa, Fuzhong Zhang, Meghdad Hajimorad, William J Holtz, Nilu Prasad, Sung Kuk Lee and Jay D Keasling&lt;br /&gt;
Increasing complexity of synthetically designed genetic systems has necessitated the creation of a library of compatible vectors to enable simultaneous expression of operons from different plasmids on the same host cell. To solve this issue, Lee et al. have designed and characterized a standardized collection of 96 Bgl-Brick-compatible plasmids that opens the door to a faster and easier construction of multi-gene networks.&lt;/div&gt;</summary>
		<author><name>Dapenev</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_TWELVE_(April_2_-_6)&amp;diff=14118</id>
		<title>WEEK TWELVE (April 2 - 6)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_TWELVE_(April_2_-_6)&amp;diff=14118"/>
				<updated>2012-04-10T22:20:48Z</updated>
		
		<summary type="html">&lt;p&gt;Dapenev: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Discuss what we have learned so far and start thinking about project for this summer. &lt;br /&gt;
&lt;br /&gt;
What can be done in small pilot projects to generate preliminary data?  Remember that we do not have to complete the project in one summer.&lt;br /&gt;
&lt;br /&gt;
Journals due at Friday meeting, 3:00 p.m.&lt;br /&gt;
&lt;br /&gt;
'''Meet in Think Tank at 3:00. Video conference with MWSU 3:30 - 4:30 eastern.'''&lt;br /&gt;
&lt;br /&gt;
Be prepared to answer questions from MWSU and have questions to ask them.&lt;br /&gt;
&lt;br /&gt;
Discuss this paper about [http://www.jbioleng.org/content/pdf/1754-1611-5-12.pdf data sheets for standardized parts].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Relevant PRESENTATIONS'''&amp;lt;br&amp;gt;&lt;br /&gt;
This PPT file contains all the slides from student presentations addressing the idea proposed by MWSU. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:Reports_on_Circuits.pptx]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This PPT contains slides summarizing some of the best and most complicated papers. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:Week_11.pptx]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Bibliography of all the papers that we've read collectively so far:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The Allure of Synthetic Biology&lt;br /&gt;
Author(s): Valda Vinson and Elizabeth Pennisi&lt;br /&gt;
Synthetic biology is a newly emerging field that promises to revolutionize our knowledge of life. From modifying the genetic code, through do-it-yourself labs, or studying and rewriting cellular circuitry, bioengineering should enable us to design biological systems to serve our own needs. &lt;br /&gt;
&lt;br /&gt;
The Life Hacker&lt;br /&gt;
Author(s): John Bohannon&lt;br /&gt;
George Church, a biologist working for Harvard University, has built a device for multiplex automated genome engineering (MAGE) that can prove to be of great use in humanity’s attempt to reinvent the genetic code. Just one of the ambitious options that lie ahead of this new technology is modifying a cell’s DNA to make the organism impervious to viruses. If that is possible, who’s to say what isn’t?&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Algae’s Second Try&lt;br /&gt;
&lt;br /&gt;
Author(s): Robert F. Service&lt;br /&gt;
Synthetic biology has revitalized the attempt to produce algal fuels as an alternative industrial source of energy. The rapid progress of the field in the last 15 years has enabled technology to catch up with science, and with the development of new bioengineering tools it has become a lot easier to manipulate algae. Innovative solutions to algal fueling systems are now produced every day, and it would hardly surprise anyone when green technologies soon become far more efficient than regular oil.&lt;br /&gt;
&lt;br /&gt;
A Lab of Their Own&lt;br /&gt;
Author(s): Sam Kean&lt;br /&gt;
A community of do-it-yourself bioengineers has sprout up in the heart of New York City, combining science, learning, and fun in a way that attracts more and more people every day. The phenomenon is beginning to spread across the United States and outside as well. By making cutting-edge synthetic biology research accessible to people with limited scientific knowledge coming from various backgrounds, such undertakings can truly revolutionize our approach to technological progress. &lt;br /&gt;
&lt;br /&gt;
Visions of Synthetic Biology&lt;br /&gt;
Author(s): Sara Reardon&lt;br /&gt;
The world’s first art exhibition dedicated to biological engineering sends a controversial message to its audience. The artists behind the Bio:Fiction film festival and its sister art show, Synth-ethic, represented in Vienna’s Museum of Natural History,  have drawn inspiration from the progress of field. Nevertheless, it is evident from the ridicule in their works that they remain skeptical to the audacious promises of synthetic biology.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Engineering bacteria to solve the Burnt Pancake Problem. &lt;br /&gt;
Author(s): Karmella A Haynes, Marian L Broderick, Adam D Brown, Trevor L Butner, James O Dickson, W Lance Harden, Lane H Heard, Eric L Jessen, Kelly J Malloy, Brad J Ogden, Sabriya Rosemond, Samantha Simpson, Erin Zwack, A Malcolm Campbell, Todd T Eckdahl, Laurie J Heyer and Jeffrey L Poet&lt;br /&gt;
Haynes et al. designed a system using Hin/hix DNA recombinase that could inverse genetic segments independently, representative of the “pancakes” in the NP-complete Burnt Pancake Problem. In addition to providing a new tool for in vivo genetic manipulation, the concept behind the study can be scaled up to solve larger, more complicated computational problems.&lt;br /&gt;
&lt;br /&gt;
Solving a Hamiltonian Path Problem with a Bacterial Computer. &lt;br /&gt;
Author(s): Jordan Baumgardner, Karen Acker, Oyinade Adefuye, Samuel T Crowley, Will DeLoache, James O Dickson, Lane Heard, Andrew T Martens, Nickolaus Morton,Michelle Ritter, Amber Shoecraft, Jessica Treece, Matthew Unzicker, Amanda Valencia, Mike Waters, A Malcolm Campbell, Laurie J Heyer, Jeffrey L Poet and Todd T Eckdahl&lt;br /&gt;
Using a Hin/hix DNA recombinase system, Baumgradner et al. programmed bacteria to solve the NP-complete Hamiltonian Path Problem, or to find the shortest route from the start to the end of a directed graph, visiting each node (gene) exactly once. The experiment validates synthetic biology as an alternative to regular computing.&lt;br /&gt;
&lt;br /&gt;
Bacterial Hash Function Using DNA-Based XOR Logic Reveals Unexpected Behavior of the LuxR Promoter.&lt;br /&gt;
Author(s): Brianna Pearson, Kin H. Lau, Alicia Allen, James Barron, Robert Cool, Kelly Davis, Will DeLoache, Erin Feeney, Andrew Gordon, John Igo, Aaron Lewis, Kristi Muscalino, Madeline Parra, Pallavi Penumetcha, Victoria G. Rinker, Karlesha Roland, Xiao Zhu, Jeffrey L. Poet, Todd T. Eckdahl, Laurie J. Heyer and A Malcolm Campbell&lt;br /&gt;
Pearson et al. designed a DNA-based model for time-delayed bacterial growth capable of performing Hash function calculations. The system is based on an XOR logic gate comprised of two opposing promoters. The researchers also discovered that Plux could be manipulated to activate backwards transcription, a notion which advances our understanding of the promoter and its functions.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
DNA assembly for synthetic biology: from parts to pathways and beyond&lt;br /&gt;
Author(s): Tom Ellis,Tom Adie and Geoﬀ S. Baldwin&lt;br /&gt;
The construction of chromosomal pathways has improved dramatically with the development of DNA combinatorial techniques, as well as the creation of standardized registries of genetic parts and tools. There is no “perfect” assembly method, which is why it is important to consider the characteristics of each one when choosing a way to approach the construction of a new system.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Talking the Talk&lt;br /&gt;
&lt;br /&gt;
Author(s): Colin Mcilswain&lt;br /&gt;
Loss of public trust in genetically modified organisms (GMOs) in Europe has caused the progress of synthetic biology to come to a halt. Increased public awareness of the speculative risks implicit to bioengineering research has made people reluctant to further their support for the field. It has thus become necessary that the science should be regulated by a form of active public involvement, and it is up to the countries’ governments to make that change happen. &lt;br /&gt;
&lt;br /&gt;
Noise in Gene Expression: Origins, Consequences, and Control&lt;br /&gt;
Author(s): Jonathan M. Raser and Erin K. O’Shea  &lt;br /&gt;
Noise is an inherent property of genetic pathways, and it could be both beneficial and detrimental depending on the specifics of the system. Noise levels can be controlled through varying the size of the network, the number of gene copies, or through positive and negative feedback loops. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Synthetic Biology: Integrated Gene Circuits&lt;br /&gt;
Author(s): Nagarajan Nandagopal and Michael B. Elowitz&lt;br /&gt;
This review paper looks at different techniques to diversify endogenous gene circuits and signal transduction pathways. Noise levels, network specificity, and dynamics are all characteristics of DNA-based systems that can be controlled in a variety of ways, some of the most useful ones of which are presented hereby. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Network Motifs: Simple Building Blocks of Complex Networks&lt;br /&gt;
 Author(s): R. Milo, S. Shen-Orr, et al&lt;br /&gt;
Network motifs are repetitive operational units within a system that would be favored by the process of natural selection. Such motifs represent the building blocks of most complex networks, which is why it is important to create registries with their characteristics, which would be immensely useful for the construction of synthetically designed pathways.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
DNA and the Brain&lt;br /&gt;
Author(s): Anne Condon&lt;br /&gt;
One of the long-existing goals of biological engineering has been to design a neural network based on molecular components. Qian et al. have pushed forward the progress in the area by creating a system made up of four DNA-comprised neurons capable of recognizing writing. The fact that the artificial system has been made capable of memory through complex chemical interactions and adjustments makes the research an important stepping stone for the development of “biochemical systems that can learn.”&lt;br /&gt;
&lt;br /&gt;
Scientific Link-Up Yields ‘Control Panel’ for Networks&lt;br /&gt;
Author(s): Adrian Cho&lt;br /&gt;
Scientists Yiu et al. have developed an algorithm to calculate the minimum number of nodes that need to be controlled in a network so that it can be fully-manipulated.  The researchers have demonstrated that their approach is applicable to a wide range of fields, amongst which synthetic biological systems, and have thus developed a powerful tool for evaluating chaos levels in any network.&lt;br /&gt;
&lt;br /&gt;
Comprehensive genetic dissection of the magnetosome gene island reveals the step-wise assembly of a prokaryotic organelle&lt;br /&gt;
Author(s): Dorothée Murata, Anna Quinlanb, Hojatollah Valic, and Arash Komeili &lt;br /&gt;
Murata et al. investigate organelle biogenesis in magnetotaxic bacteria, an area of biology that has been poorly understood previously. By studying various deletion mutants for magnetosome formation, the researchers were able to identify essential and non-essential encoding regions of the magnetosome island (MAI). This knowledge is necessary for the synthetic reconstruction of the magnetotaxic pathway.&lt;br /&gt;
&lt;br /&gt;
Comparative genome analysis of four Magnetotactic bacteria reveals a complex set of group-specific genes implicated in magnetosome biomineralization and function.&lt;br /&gt;
&lt;br /&gt;
Author(s): Michael Richter,  Michael Kube, Dennis A. Bazylinski, Thierry Lombardot, Frank Oliver Glöckner, Richard Reinhardt, and Dirk Schüler &lt;br /&gt;
&lt;br /&gt;
Richter et al. identified gene clusters that were specifically associated with magnetotaxis by comparing the DNA-sequences of four different strains of bacteria that exhibit the phenotype. Through detection of conserved genes within all of them, the researchers were able to find the parts that are of primary importance for the functioning of the pathway. Such parts would be the prime targets for future investigations. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Controllability of complex networks &lt;br /&gt;
&lt;br /&gt;
Author(s): Yang-Yu Liu, Jean-Jacques Slotine, &amp;amp; Albert-La ́szlo ́ Baraba ́si&lt;br /&gt;
This research demonstrates the power of mathematical modeling, through which Liu et al. were able to analyze and predict the controllability of directed networks based on the number of driver nodes that have to be regulated in order to achieve full governance over the system. Their model presents bad news for synthetic biology research, because, as it turns out, sparse heterogenic networks such as most biologically-relevant pathways require the biggest number of driver nodes to be controlled.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Next-generation synthetic gene networks &lt;br /&gt;
&lt;br /&gt;
Author(s): Timothy K Lu, Ahmad S Khalil &amp;amp; James J Collins&lt;br /&gt;
&lt;br /&gt;
There are a number of areas in need of improvement in synthetic biology. The development of modular standardized techniques and toolkits of all sorts open the door to networks of higher complexity that possibly have real-world applications.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Word selection affects perceptions of synthetic biology&lt;br /&gt;
&lt;br /&gt;
Author(s): Brianna Pearson, Sam Snell, Kyri Bye-Nagel, Scott Tonidandel, Laurie J Heyer and A. Malcolm Campbell&lt;br /&gt;
&lt;br /&gt;
Word selection has proven to be immensely important in communicating synthetic biology research to the open public. In order to improve the perception of the field in people’s eyes, it might be better to avoid using words such as “create” that commonly carry a pejorative connotation. &lt;br /&gt;
&lt;br /&gt;
Toward the Second Generation of Optogenetic Tools&lt;br /&gt;
&lt;br /&gt;
Author(s): Thomas Kno¨pfel, Michael Z. Lin, Anselm Levskaya, Lin Tian, John Y. Lin,and Edward S. Boyden&lt;br /&gt;
&lt;br /&gt;
Optogenetics is a newly developing field in synthetic biology that uses light for the control and monitoring of gene expression in cells. Improvements in light-mediated tools such as voltage reporters, neural silencers, and fluorescent proteins gradually eliminate the obstacles that stand before their widespread application. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Phototaxis in the magnetotactic bacterium Magnetospirillum magneticum strain AMB-1 is independent of magnetic fields&lt;br /&gt;
&lt;br /&gt;
Author(s): Chuanfang Chen, Qiufeng Ma, Wei Jiang and Tao Song&lt;br /&gt;
&lt;br /&gt;
Magnetotaxic bacteria repond differently to combinations of stimuli such as light, heat, and magnetic field. The ability of AMB-1 bacteria to simultaneously perform magnetotaxis and thermotaxis suggests an extensive correlation between the genetic circuitry responsible for both of them. This presents yet another challenge in identifying the genes that encode for one of them specifically.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Synthetic Gene Networks That Count&lt;br /&gt;
&lt;br /&gt;
Author(s): Ari E. Friedland, Timothy K. Lu, Xiao Wang, David Shi, George Church, and James J. Collins&lt;br /&gt;
&lt;br /&gt;
Different approaches can be used when rewiring genetic circuitry so that it emulates digital counting mechanisms. Using various predetermined inputs, such modular mechanisms present yet another promising method for bacterial computing. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
C. dog&lt;br /&gt;
&lt;br /&gt;
Author(s):?&lt;br /&gt;
&lt;br /&gt;
C. dog is a system utilizing a pair of ribosomal binding sites to control translation intensity levels. By straightening mRNA coiling, the second variable RBS can be independently combined with any promoter and reporter gene so that it produces an optimal level of gene expression, an emergent property that could undoubtedly prove to be very beneficial for the purposes of bioengineering. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Programming Bacteria for Optimization of Genetic Circuits&lt;br /&gt;
&lt;br /&gt;
Author(s): ?&lt;br /&gt;
&lt;br /&gt;
Noise can be beneficial or deleterious to a system, and there are various ways to control or ignore it. From an engineer’s perspective though, random noise is undesirable. If the input causes noise, one should aim to make the genetic pathway longer, while if the output causes noise, one should aim to make it shorter.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
CRIM Plasmids, Degradation Tags, and Transposons&lt;br /&gt;
Author(s): ?&lt;br /&gt;
CRIM plasmids offer obvious benefits for bioengineering such as modularity and high specificity. Degradation tags can be used to control cellular functioning in a very quick and decisive manner. Transposons provide a high copy number of desired elements. All of these provide innovative and useful tools for the improvement of genetic engineering.&lt;br /&gt;
&lt;br /&gt;
Multichromatic Control of Gene Expression in Escherichia coli&lt;br /&gt;
Author(s): Jeffrey J. Tabor, Anselm Levskaya, and Christopher A. Voigt &lt;br /&gt;
Optogenetic tools can be applied to control cells in vivo across space and over time. A multichromatic bi-stable switch utilizes reversible sensory mechanisms that differentiate between light inputs, and can be adapted to produce the desired output levels. This system allows for reversible expression that is quicker and with higher resolution than most previously-known similar mechanisms.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Robust multicellular computing using genetically encoded NOR gates and chemical ‘wires’&lt;br /&gt;
Author(s): Alvin Tamsir, Jeffrey J. Tabor &amp;amp; Christopher A. Voigt&lt;br /&gt;
&lt;br /&gt;
The modularity of OR/NOR gates can serve to design other, more complex logic gates/pathways with far more variable expression. By combining those gates with cells capablel of quorum-sensation, Tamsir et al. create a novel biological computational system that operates across space. The research is a proof-of-concept of how simple individual motifs can be used to make complex systematic emergent properties.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Automated Design of Synthetic Ribosome Binding Sites to Precisely Control Protein Expression&lt;br /&gt;
&lt;br /&gt;
Authors: Howard M. Salis, Ethan A. Mirsky, and Christopher A. Voigt&lt;br /&gt;
&lt;br /&gt;
Salis et al. have developed an algorithm to predict the reporter gene expression rates based on differently engineered ribosomal binding sites. The method can be very useful in the optimization of system output levels. The “forward” engineering approach described within serves to aid the construction of systems of higher complexity.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
A sensing array of radically coupled genetic ‘biopixels’&lt;br /&gt;
Author(s): Arthur Prindle, Phillip Samayoa, Ivan Razinkov, Tal Danino, Lev S. Tsimring &amp;amp; Jeff Hasty&lt;br /&gt;
“Biopixels” are individual colonies whose oscillations were synthetically synchronized using quorum sensing or gas signaling. This offers yet another valuable resource for biological engineering, by providing a mechanism to coordinate cellular behavior over large distances. In addition, the invention has some readily-available applications, such as the detection of harmful substances in drinking water. &lt;br /&gt;
&lt;br /&gt;
BglBrick vectors and datasheets: A syntheticbiology platform for gene expression&lt;br /&gt;
Author(s): Taek Soon Lee, Rachel A Krupa, Fuzhong Zhang, Meghdad Hajimorad, William J Holtz, Nilu Prasad, Sung Kuk Lee and Jay D Keasling&lt;br /&gt;
Increasing complexity of synthetically designed genetic systems has necessitated the creation of a library of compatible vectors to enable simultaneous expression of operons from different plasmids on the same host cell. To solve this issue, Lee et al. have designed and characterized a standardized collection of 96 Bgl-Brick-compatible plasmids that opens the door to a faster and easier construction of multi-gene networks.&lt;/div&gt;</summary>
		<author><name>Dapenev</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_TWELVE_(April_2_-_6)&amp;diff=14117</id>
		<title>WEEK TWELVE (April 2 - 6)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_TWELVE_(April_2_-_6)&amp;diff=14117"/>
				<updated>2012-04-10T05:49:18Z</updated>
		
		<summary type="html">&lt;p&gt;Dapenev: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Discuss what we have learned so far and start thinking about project for this summer. &lt;br /&gt;
&lt;br /&gt;
What can be done in small pilot projects to generate preliminary data?  Remember that we do not have to complete the project in one summer.&lt;br /&gt;
&lt;br /&gt;
Journals due at Friday meeting, 3:00 p.m.&lt;br /&gt;
&lt;br /&gt;
'''Meet in Think Tank at 3:00. Video conference with MWSU 3:30 - 4:30 eastern.'''&lt;br /&gt;
&lt;br /&gt;
Be prepared to answer questions from MWSU and have questions to ask them.&lt;br /&gt;
&lt;br /&gt;
Discuss this paper about [http://www.jbioleng.org/content/pdf/1754-1611-5-12.pdf data sheets for standardized parts].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Relevant PRESENTATIONS'''&amp;lt;br&amp;gt;&lt;br /&gt;
This PPT file contains all the slides from student presentations addressing the idea proposed by MWSU. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:Reports_on_Circuits.pptx]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This PPT contains slides summarizing some of the best and most complicated papers. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:Week_11.pptx]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Bibliography of all the papers that we've read collectively so far:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The Allure of Synthetic Biology&lt;br /&gt;
&lt;br /&gt;
Author(s): Valda Vinson and Elizabeth Pennisi&lt;br /&gt;
&lt;br /&gt;
Synthetic biology is a newly emerging field that promises to revolutionize our knowledge of life. From modifying the genetic code, through do-it-yourself labs, or studying and rewriting cellular circuitry, bioengineering should enable us to design biological systems to serve our own needs. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The Life Hacker&lt;br /&gt;
&lt;br /&gt;
Author(s): John Bohannon&lt;br /&gt;
&lt;br /&gt;
George Church, a biologist working for Harvard University, has built a device for multiplex automated genome engineering (MAGE) that can prove to be of great use in humanity’s attempt to reinvent the genetic code. Just one of the ambitious options that lie ahead of this new technology is modifying a cell’s DNA to make the organism impervious to viruses. If that is possible, who’s to say what isn’t?&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Algae’s Second Try&lt;br /&gt;
&lt;br /&gt;
Author(s): Robert F. Service&lt;br /&gt;
&lt;br /&gt;
Synthetic biology has revitalized the attempt to produce algal fuels as an alternative industrial source of energy. The rapid progress of the field in the last 15 years has enabled technology to catch up with science, and with the development of new bioengineering tools it has become a lot easier to manipulate algae. Innovative solutions to algal fueling systems are now produced every day, and it would hardly surprise anyone when green technologies soon become far more efficient than regular oil.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
A Lab of Their Own&lt;br /&gt;
&lt;br /&gt;
Author(s): Sam Kean&lt;br /&gt;
&lt;br /&gt;
A community of do-it-yourself bioengineers has sprout up in the heart of New York City, combining science, learning, and fun in a way that attracts more and more people every day. The phenomenon is beginning to &lt;br /&gt;
spread across the United States and outside as well. By making cutting-edge synthetic biology research accessible to people with limited scientific knowledge coming from various backgrounds, such undertakings can truly revolutionize our approach to technological progress. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Visions of Synthetic Biology&lt;br /&gt;
&lt;br /&gt;
Author(s): Sara Reardon&lt;br /&gt;
&lt;br /&gt;
The world’s first art exhibition dedicated to biological engineering sends a controversial message to its audience. The artists behind the Bio:Fiction film festival and its sister art show, Synth-ethic, represented in Vienna’s Museum of Natural History,  have drawn inspiration from the progress of field. Nevertheless, it is evident from the ridicule in their works that they remain skeptical to the audacious promises of synthetic biology.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Talking the Talk&lt;br /&gt;
&lt;br /&gt;
Author(s): Colin Mcilswain&lt;br /&gt;
&lt;br /&gt;
Loss of public trust in genetically modified organisms (GMOs) in Europe has caused the progress of synthetic biology to come to a halt. Increased public awareness of the speculative risks implicit to bioengineering research has made people reluctant to further their support for the field. It has thus become necessary that the science should be regulated by a form of active public involvement, and it is up to the countries’ governments to make that change happen. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
DNA and the Brain&lt;br /&gt;
&lt;br /&gt;
Author(s): Anne Condon&lt;br /&gt;
&lt;br /&gt;
One of the long-existing goals of biological engineering has been to design a neural network based on molecular components. Qian et al. have pushed forward the progress in the area by creating a system made up of four DNA-comprised neurons capable of recognizing writing. The fact that the artificial system has been made capable of memory through complex chemical interactions and adjustments makes the research an important stepping stone for the development of “biochemical systems that can learn.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Scientific Link-Up Yields ‘Control Panel’ for Networks&lt;br /&gt;
&lt;br /&gt;
Author(s): Adrian Cho&lt;br /&gt;
&lt;br /&gt;
Scientists Yiu et al. have developed an algorithm to calculate the minimum number of nodes that need to be controlled in a network so that it can be fully-manipulated.  The researchers have demonstrated that their approach is applicable to a wide range of fields, amongst which synthetic biological systems, and have thus developed a powerful tool for evaluating chaos levels in any network.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Word selection affects perceptions of synthetic biology&lt;br /&gt;
&lt;br /&gt;
Author(s): Brianna Pearson, Sam Snell, Kyri Bye-Nagel, Scott Tonidandel, Laurie J Heyer and A. Malcolm Campbell&lt;br /&gt;
&lt;br /&gt;
Word selection has proven to be immensely important in communicating synthetic biology research to the open public. In order to improve the perception of the field in people’s eyes, it might be better to avoid using words such as “create” that commonly carry a pejorative connotation. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
BglBrick vectors and datasheets: A syntheticbiology platform for gene expression&lt;br /&gt;
&lt;br /&gt;
Author(s): Taek Soon Lee, Rachel A Krupa, Fuzhong Zhang, Meghdad Hajimorad, William J Holtz, Nilu Prasad, Sung Kuk Lee and Jay D Keasling&lt;br /&gt;
&lt;br /&gt;
Increasing complexity of synthetically designed genetic systems has necessitated the creation of a library of compatible vectors to enable simultaneous expression of operons from different plasmids on the same host cell. To solve this issue, Lee et al. have designed and characterized a standardized collection of 96 Bgl-Brick-compatible plasmids that opens the door to a faster and easier construction of multi-gene networks.&lt;/div&gt;</summary>
		<author><name>Dapenev</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13777</id>
		<title>WEEK FOUR (February 6 - 10)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13777"/>
				<updated>2012-02-14T07:27:06Z</updated>
		
		<summary type="html">&lt;p&gt;Dapenev: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We have been given the DNA encoding [http://2011.igem.org/Team:Washington/Magnetosomes/Magnet_Toolkit 18 genes in 10 different clones] and we need to get the DNA into cells, verify the inserts, freeze down glycerol stocks, enter them into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog], and send some cells to our colleagues at MWSU. &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Davidson_Protocols Davidson Protocols]&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
* '''Everyone should register''' for a [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog account (v2.5.4 or higher)]. &lt;br /&gt;
* The plan this week is to do all wet lab stuff. Dr. Heyer will be out of town and we need to get the magnetasome DNA into ''E. coli'' cells (strain JM109). I know none of you can come to all these meetings, but we will be doing each step as outlined over the week. Come to the ones you can attend. Each person should be able to do at least 3 of these. You can choose which three. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 3 9:30 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transform JM109] &amp;amp; plate on appropriate media. ([http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Confirm with UW team])&amp;lt;br&amp;gt;&lt;br /&gt;
take about 45 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Saturday February 4''' I ''need one volunteer''&amp;lt;br&amp;gt;&lt;br /&gt;
take out of incubator put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
take about 15 minutes and must be done before 9 am&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Sunday February 5 mid-afternoon: 3 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
pick colonies from each plate and put into 2 mL appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
take about 30 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Monday February 6 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
Do [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html minipreps] but SAVE THE CELLS on plates&amp;lt;br&amp;gt;&lt;br /&gt;
takes about 1 hour&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tuesday February 7 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
set up [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html digestions], run 30 min to 1 hr and put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
Determine insert sizes from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Wednesday February 8 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html determine the percent agarose] needed for the inserts&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html pour and run gel(s)] then photograph gel(s)&amp;lt;br&amp;gt;&lt;br /&gt;
verify insert sizes (get this from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry])&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/DNA-RNA-Purification-Analysis/Nucleic-Acid-Gel-Electrophoresis/DNA-Ladders/1kb-Plus-Ladders.html?s_kwcid=TC|12123|1kB%20DNA%20ladder||S|b|9891564060 molecular weight marker]&amp;lt;br&amp;gt;&lt;br /&gt;
[[File:IS_gel.jpg]] [[File:lanes.JPG]]&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamE''' = 2253 bp, '''insert looks correct''' based on gel (Ben)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamO''' = 1914 bp or 1975 bp '''insert looks correct''' based on gel (Erich)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamQRB''' = 2029 bp or 2108 bp, '''insert looks correct''' based on gel (Dancho)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamPA''' = 1584 bp, '''insert looks correct''' based on gel (Ellen)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamV''' = 1168 bp, '''insert looks correct''' based on gel (Malcolm)&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamSTU''' = 2030 bp or 2160 bp (Kirsten)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamMN''' = 2323 bp or 2367 bp, ''' insert looks correct''' based on gel (Nishita)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamJ''' = 1521 bp or 1626 bp (Becca)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamKL'''= 1336 or 1439 bp ''' insert looks correct''' base on gel (Alex)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamHI''' = 1600 bp or 1626 (Duke) -- insert looks incorrect &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;&lt;br /&gt;
[[File:eDigested_mamV.png]]&amp;lt;br&amp;gt;&lt;br /&gt;
ApE digestion of mamV using BamHI (0 sites) and EcoRI (1 site) produces two fragments of 1032 bp and 136 bp. &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;/center&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;&lt;br /&gt;
[[File:Digested_mamPA.png]]&amp;lt;br&amp;gt;&lt;br /&gt;
ApE digestion of mamPA using BamHI (0 sites) and EcoRI (0 sites) produces one fragment of 1573 bp.&lt;br /&gt;
&lt;br /&gt;
'''Thursday February 9 11 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
grow overnight cultures of clones with correct inserts sizes&amp;lt;br&amp;gt;&lt;br /&gt;
pick from plate and put into 2 mL of appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
streak out on new plate for shipping to MWSU. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 10 4 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
take cells out of incubator&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Glycerolstocks_How_to_Make_Glycerol_Stocks_of_Bacteria freeze down cells] and enter into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog].&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Primers used for fragment extraction:&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_fwd	GGTACCTTCGTATGAACCCTGTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_rev	CGTCTTCTACGTCACCATTGAAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_fwd	CCGCTTCAGACCCTGACA&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_rev	        CGATCTCGCCGGTTATTC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_fwd    	CAGATTTTGCTGAAGGTCAACC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_rev	        CGTTCGCGTGCTAAATGAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_fwd	CTGGCAGCCGTCAATTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_rev	CCTCATCCTTACTCACTCCAAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_fwd	ATCCCTTCGCTTGGGTTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_rev	AATCATGGCTGAGTTCCAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_fwd	GAGATGACGACAGGAATCCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_rev	CCAATCCCAGCATCATGATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_fwd	TGCTGACCTCGGTGTGATG&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_rev	GAAGGAAACGCCCCACATAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_fwd	CTTGCCGCATTTCAAGAAG&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_rev	GGCTCAACATACGCTCTGG&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_fwd	CGCATCCAGGAGGAAATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_rev	AACCGCACCACCTTGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_fwd	GCTGGTGCCCAAATAATCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_rev	        CAATCGCCAACAGCGTAG&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[media:MamAB_copy.txt]] ApE file for the mamAB operon]] with the primers, genes, native promoter, and terminator sequences annotated. Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)]. &amp;lt;br&amp;gt;&lt;br /&gt;
[[media:pGA1C3_pLac-GFP.txt]] pGA1C3 plasmid map (with pLac GFP insert). Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''mamV''' = 1002 bp or 1168 bp, depending on how we verify the insert. (Malcolm)&lt;br /&gt;
&lt;br /&gt;
'''mamO''' = 1914 bp or 1975 bp (Erich)&lt;br /&gt;
&lt;br /&gt;
'''mamPA''' = 1493 bp or 1584 bp (Ellen)&lt;br /&gt;
&lt;br /&gt;
'''mamSTU''' = 2030 bp or 2160 bp (Kirsten)&lt;br /&gt;
&lt;br /&gt;
'''mamQRB''' = 2029 bp or 2108 bp (Dancho)&lt;br /&gt;
&lt;br /&gt;
'''mamE''' = 2172 bp or 2253 bp (Ben)&lt;br /&gt;
&lt;br /&gt;
'''mamHI''' = 1600 bp or 1626 (Duke)&lt;br /&gt;
&lt;br /&gt;
'''mamKL'''= 1336 or 1439 bp (Alex)&lt;br /&gt;
&lt;br /&gt;
'''mamMN''' = 2323 bp or 2367 bp (Nishita)&lt;br /&gt;
&lt;br /&gt;
'''mamJ''' = 1521 bp or 1626 bp (Becca)&lt;/div&gt;</summary>
		<author><name>Dapenev</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13710</id>
		<title>WEEK FOUR (February 6 - 10)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13710"/>
				<updated>2012-02-06T07:47:59Z</updated>
		
		<summary type="html">&lt;p&gt;Dapenev: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We have been given the DNA encoding [http://2011.igem.org/Team:Washington/Magnetosomes/Magnet_Toolkit 18 genes in 10 different clones] and we need to get the DNA into cells, verify the inserts, freeze down glycerol stocks, enter them into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog], and send some cells to our colleagues at MWSU. &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Davidson_Protocols Davidson Protocols]&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
* '''Everyone should register''' for a [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog account (v2.5.4 or higher)]. &lt;br /&gt;
* The plan this week is to do all wet lab stuff. Dr. Heyer will be out of town and we need to get the magnetasome DNA into ''E. coli'' cells (strain JM109). I know none of you can come to all these meetings, but we will be doing each step as outlined over the week. Come to the ones you can attend. Each person should be able to do at least 3 of these. You can choose which three. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 3 9:30 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transform JM109] &amp;amp; plate on appropriate media. ([http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Confirm with UW team])&amp;lt;br&amp;gt;&lt;br /&gt;
take about 45 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Saturday February 4''' I ''need one volunteer''&amp;lt;br&amp;gt;&lt;br /&gt;
take out of incubator put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
take about 15 minutes and must be done before 9 am&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Sunday February 5 mid-afternoon: 3 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
pick colonies from each plate and put into 2 mL appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
take about 30 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Monday February 6 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
Do [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html minipreps] but SAVE THE CELLS on plates&amp;lt;br&amp;gt;&lt;br /&gt;
takes about 1 hour&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tuesday February 7 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
set up [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html digestions], run 30 min to 1 hr and put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
Determine insert sizes from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Wednesday February 8 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html determine the percent agarose] needed for the inserts&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html pour and run gel(s)] then photograph gel(s)&amp;lt;br&amp;gt;&lt;br /&gt;
verify insert sizes (get this from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry])&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Thursday February 9 11 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
grow overnight cultures of clones with correct inserts sizes&amp;lt;br&amp;gt;&lt;br /&gt;
pick from plate and put into 2 mL of appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 10 4 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
take cells out of incubator&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Glycerolstocks_How_to_Make_Glycerol_Stocks_of_Bacteria freeze down cells] and enter into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog].&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Primers used for fragment extraction:&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_fwd	GGTACCTTCGTATGAACCCTGTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_rev	CGTCTTCTACGTCACCATTGAAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_fwd	CCGCTTCAGACCCTGACA&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_rev	        CGATCTCGCCGGTTATTC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_fwd    	CAGATTTTGCTGAAGGTCAACC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_rev	        CGTTCGCGTGCTAAATGAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_fwd	CTGGCAGCCGTCAATTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_rev	CCTCATCCTTACTCACTCCAAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_fwd	ATCCCTTCGCTTGGGTTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_rev	AATCATGGCTGAGTTCCAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_fwd	GAGATGACGACAGGAATCCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_rev	CCAATCCCAGCATCATGATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_fwd	TGCTGACCTCGGTGTGATG&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_rev	GAAGGAAACGCCCCACATAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_fwd	CTTGCCGCATTTCAAGAAG&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_rev	GGCTCAACATACGCTCTGG&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_fwd	CGCATCCAGGAGGAAATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_rev	AACCGCACCACCTTGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_fwd	GCTGGTGCCCAAATAATCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_rev	        CAATCGCCAACAGCGTAG&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[media:MamAB_copy.txt]] ApE file for the mamAB operon]] with the primers, genes, native promoter, and terminator sequences annotated. Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)]. &amp;lt;br&amp;gt;&lt;br /&gt;
[[media:pGA1C3_pLac-GFP.txt]] pGA1C3 plasmid map (with pLac GFP insert). Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''mamV''' = 1002 bp or 1168 bp, depending on how we verify the insert. (Malcolm)&lt;br /&gt;
&lt;br /&gt;
'''mamO''' = 1914 bp or 1975 bp (Erich)&lt;br /&gt;
&lt;br /&gt;
'''mamPA''' = 1493 bp or 1584 bp (Ellen)&lt;br /&gt;
&lt;br /&gt;
'''mamSTU''' = 2030 bp or 2160 bp (Kirsten)&lt;br /&gt;
&lt;br /&gt;
'''mamQRB''' = 2029 bp or 2108 bp (Dancho)&lt;/div&gt;</summary>
		<author><name>Dapenev</name></author>	</entry>

	</feed>