<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Debbiethurtle</id>
		<title>GcatWiki - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Debbiethurtle"/>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Special:Contributions/Debbiethurtle"/>
		<updated>2026-10-02T07:17:00Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.28.2</generator>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Sequence_DNA_for_Bio113&amp;diff=19270</id>
		<title>Sequence DNA for Bio113</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Sequence_DNA_for_Bio113&amp;diff=19270"/>
				<updated>2018-11-02T18:17:33Z</updated>
		
		<summary type="html">&lt;p&gt;Debbiethurtle: /* Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
== Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence ==&lt;br /&gt;
# For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample. &lt;br /&gt;
# Add water to your DNA until the combined volume is 8 µL. &lt;br /&gt;
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.&lt;br /&gt;
# Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
'''Sequencing Primers to confirm Inserts v2.0'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_Red_SeqFor&amp;lt;br&amp;gt;&lt;br /&gt;
CTAATTCAACAAGAATTGGGAC Tm = 60° C  71bp upstream first base of new DNA part&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_Red_SeqFor &amp;lt;br&amp;gt;&lt;br /&gt;
CCTTCGTACGGACGACCTTC Tm = 58° C  112bp downstream first base of new DNA part&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_mScarlet_SeqFor&amp;lt;br&amp;gt;&lt;br /&gt;
CTAATTCAACAAGAATTGGGAC Tm = 60° C  71bp upstream first base of new DNA part&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_mScarlet_SeqRev&amp;lt;br&amp;gt;&lt;br /&gt;
CACTTTGAAGCGCATGAATTC Tm = 55° C 118 bp upstream first base of new DNA part&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Debbiethurtle</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19248</id>
		<title>PCR for Bio113</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19248"/>
				<updated>2018-09-16T15:15:45Z</updated>
		
		<summary type="html">&lt;p&gt;Debbiethurtle: /* PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PCR Verification of Successful GGA==&lt;br /&gt;
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel). &lt;br /&gt;
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template. &lt;br /&gt;
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred. &lt;br /&gt;
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid. &lt;br /&gt;
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells. &lt;br /&gt;
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
# 95° C for 5 minutes, 1 time&lt;br /&gt;
# 95° C for 30 seconds&lt;br /&gt;
# 54° C for 30 seconds&lt;br /&gt;
#72° C for 1 minute&lt;br /&gt;
# return to step #2 29 more times&lt;br /&gt;
# store at 22° C indefinitely&lt;br /&gt;
&lt;br /&gt;
* When the PCR is completed, they will be stored until next week when you will load 10 µL of each into the wells of a 2% agarose gel. &lt;br /&gt;
&lt;br /&gt;
== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==&lt;br /&gt;
'''J119137; pClone Red  (remove 70 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
177 bp amplicon for J119137&amp;lt;br&amp;gt;&lt;br /&gt;
167 bp amplicon for 60 bp insertion&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100384; pClone mScarlet  (remove 70 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
228 bp amplicon for J100384&amp;lt;br&amp;gt;&lt;br /&gt;
220 bp amplicon for 60 bp insertion&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J119384; rClone Red  (remove 819 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C&amp;lt;br&amp;gt;&lt;br /&gt;
856 bp amplicon for J119384&amp;lt;br&amp;gt;&lt;br /&gt;
58 bp amplicon for 15 bp insertion &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100419; rClone mScarlet  (remove 819 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C&amp;lt;br&amp;gt;&lt;br /&gt;
914 bp amplicon for J100419&amp;lt;br&amp;gt;&lt;br /&gt;
95 bp amplicon for 15 bp insertion &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Previous plasmids used in 113'''&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100204; actClone Red (remove 119 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG  Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
250 bp amplicon for J100204 &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100205; repClone Red (remove 129 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C&amp;lt;br&amp;gt;&lt;br /&gt;
424 bp amplicon for J100205&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Debbiethurtle</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19247</id>
		<title>PCR for Bio113</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19247"/>
				<updated>2018-09-16T15:12:27Z</updated>
		
		<summary type="html">&lt;p&gt;Debbiethurtle: /* PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PCR Verification of Successful GGA==&lt;br /&gt;
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel). &lt;br /&gt;
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template. &lt;br /&gt;
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred. &lt;br /&gt;
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid. &lt;br /&gt;
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells. &lt;br /&gt;
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
# 95° C for 5 minutes, 1 time&lt;br /&gt;
# 95° C for 30 seconds&lt;br /&gt;
# 54° C for 30 seconds&lt;br /&gt;
#72° C for 1 minute&lt;br /&gt;
# return to step #2 29 more times&lt;br /&gt;
# store at 22° C indefinitely&lt;br /&gt;
&lt;br /&gt;
* When the PCR is completed, they will be stored until next week when you will load 10 µL of each into the wells of a 2% agarose gel. &lt;br /&gt;
&lt;br /&gt;
== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==&lt;br /&gt;
'''J119137; pClone Red  (remove 70 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
177 bp amplicon for J119137&amp;lt;br&amp;gt;&lt;br /&gt;
167 bp amplicon for 60 bp insertion&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100384; pClone mScarlet  (remove 70 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
228 bp amplicon for J100384&amp;lt;br&amp;gt;&lt;br /&gt;
220 bp amplicon for 60 bp insertion&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J119384; rClone Red  (remove 819 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C&amp;lt;br&amp;gt;&lt;br /&gt;
856 bp amplicon for J119384&amp;lt;br&amp;gt;&lt;br /&gt;
58 bp amplicon for 15 bp insertion &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100419; rClone mScarlet  (remove 819 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C&amp;lt;br&amp;gt;&lt;br /&gt;
914 bp amplicon for J100419&amp;lt;br&amp;gt;&lt;br /&gt;
95 bp amplicon for 15 bp insertion &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''J100204; actClone Red (remove 119 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG  Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
250 bp amplicon for J100204 &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100205; repClone Red (remove 129 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C&amp;lt;br&amp;gt;&lt;br /&gt;
424 bp amplicon for J100205&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Debbiethurtle</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19246</id>
		<title>PCR for Bio113</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19246"/>
				<updated>2018-09-16T15:09:52Z</updated>
		
		<summary type="html">&lt;p&gt;Debbiethurtle: /* PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PCR Verification of Successful GGA==&lt;br /&gt;
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel). &lt;br /&gt;
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template. &lt;br /&gt;
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred. &lt;br /&gt;
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid. &lt;br /&gt;
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells. &lt;br /&gt;
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
# 95° C for 5 minutes, 1 time&lt;br /&gt;
# 95° C for 30 seconds&lt;br /&gt;
# 54° C for 30 seconds&lt;br /&gt;
#72° C for 1 minute&lt;br /&gt;
# return to step #2 29 more times&lt;br /&gt;
# store at 22° C indefinitely&lt;br /&gt;
&lt;br /&gt;
* When the PCR is completed, they will be stored until next week when you will load 10 µL of each into the wells of a 2% agarose gel. &lt;br /&gt;
&lt;br /&gt;
== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==&lt;br /&gt;
'''J119137; pClone Red  (remove 70 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
177 bp amplicon for J119137&amp;lt;br&amp;gt;&lt;br /&gt;
167 bp amplicon for 60 bp insertion&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100384; pClone mScarlet  (remove 70 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
228 bp amplicon for J100384&amp;lt;br&amp;gt;&lt;br /&gt;
220 bp amplicon for 60 bp insertion&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J119384; rClone Red  (remove 815 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C&amp;lt;br&amp;gt;&lt;br /&gt;
856 bp amplicon for J119384&amp;lt;br&amp;gt;&lt;br /&gt;
58 bp amplicon for 15 bp insertion &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100419; rClone mScarlet  (remove 819 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C&amp;lt;br&amp;gt;&lt;br /&gt;
914 bp amplicon for J100419&amp;lt;br&amp;gt;&lt;br /&gt;
95 bp amplicon for 15 bp insertion &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''J100204; actClone Red (remove 119 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG  Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
250 bp amplicon for J100204 &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100205; repClone Red (remove 129 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C&amp;lt;br&amp;gt;&lt;br /&gt;
424 bp amplicon for J100205&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Debbiethurtle</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19245</id>
		<title>PCR for Bio113</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19245"/>
				<updated>2018-09-16T15:08:59Z</updated>
		
		<summary type="html">&lt;p&gt;Debbiethurtle: /* PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PCR Verification of Successful GGA==&lt;br /&gt;
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel). &lt;br /&gt;
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template. &lt;br /&gt;
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred. &lt;br /&gt;
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid. &lt;br /&gt;
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells. &lt;br /&gt;
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
# 95° C for 5 minutes, 1 time&lt;br /&gt;
# 95° C for 30 seconds&lt;br /&gt;
# 54° C for 30 seconds&lt;br /&gt;
#72° C for 1 minute&lt;br /&gt;
# return to step #2 29 more times&lt;br /&gt;
# store at 22° C indefinitely&lt;br /&gt;
&lt;br /&gt;
* When the PCR is completed, they will be stored until next week when you will load 10 µL of each into the wells of a 2% agarose gel. &lt;br /&gt;
&lt;br /&gt;
== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==&lt;br /&gt;
'''J119137; pClone Red  (remove 70 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
177 bp amplicon for J119137&amp;lt;br&amp;gt;&lt;br /&gt;
167 bp amplicon for 60 bp insertion&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100384; pClone mScarlet  (remove 70 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
228 bp amplicon for J100384&amp;lt;br&amp;gt;&lt;br /&gt;
220 bp amplicon for 60 bp insertion&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J119384; rClone Red  (remove 815 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C&amp;lt;br&amp;gt;&lt;br /&gt;
856 bp amplicon for J119384&amp;lt;br&amp;gt;&lt;br /&gt;
58 bp amplicon for 15 bp insertion &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J119384; rClone Red  (remove 819 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C&amp;lt;br&amp;gt;&lt;br /&gt;
914 bp amplicon for J119384&amp;lt;br&amp;gt;&lt;br /&gt;
95 bp amplicon for 15 bp insertion &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''J100204; actClone Red (remove 119 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG  Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
250 bp amplicon for J100204 &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100205; repClone Red (remove 129 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C&amp;lt;br&amp;gt;&lt;br /&gt;
424 bp amplicon for J100205&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Debbiethurtle</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19177</id>
		<title>PCR for Bio113</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19177"/>
				<updated>2018-02-06T18:28:34Z</updated>
		
		<summary type="html">&lt;p&gt;Debbiethurtle: /* PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PCR Verification of Successful GGA==&lt;br /&gt;
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel). &lt;br /&gt;
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template. &lt;br /&gt;
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred. &lt;br /&gt;
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid. &lt;br /&gt;
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells. &lt;br /&gt;
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
# 95° C for 5 minutes, 1 time&lt;br /&gt;
# 95° C for 30 seconds&lt;br /&gt;
# 54° C for 30 seconds&lt;br /&gt;
#72° C for 1 minute&lt;br /&gt;
# return to step #2 29 more times&lt;br /&gt;
# store at 22° C indefinitely&lt;br /&gt;
&lt;br /&gt;
* When the PCR is completed, they will be stored until next week when you will load 10 µL of each into the wells of a 2% agarose gel. &lt;br /&gt;
&lt;br /&gt;
== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==&lt;br /&gt;
&lt;br /&gt;
'''J119137; pClone Red  (remove 70 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
210 bp amplicon for J119137&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J119384; rClone Red  (remove 815 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC TM = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C&amp;lt;br&amp;gt;&lt;br /&gt;
856 bp amplicon for J119384&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100204; actClone Red (remove 119 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG  Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
250 bp amplicon for J100204 &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100205; repClone Red (remove 129 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C&amp;lt;br&amp;gt;&lt;br /&gt;
424 bp amplicon for J100205&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Debbiethurtle</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Sequence_DNA_for_Bio113&amp;diff=19096</id>
		<title>Sequence DNA for Bio113</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Sequence_DNA_for_Bio113&amp;diff=19096"/>
				<updated>2017-11-15T20:55:22Z</updated>
		
		<summary type="html">&lt;p&gt;Debbiethurtle: /* Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
== Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence ==&lt;br /&gt;
# For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample. &lt;br /&gt;
# Add water to your DNA until the combined volume is 8 µL. &lt;br /&gt;
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.&lt;br /&gt;
# Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
'''Sequencing Primers to confirm Inserts v2.0'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_SeqFor&amp;lt;br&amp;gt;&lt;br /&gt;
CTAATTCAACAAGAATTGGGAC Tm = 60° C  71bp upstream first base&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_SeqFor &amp;lt;br&amp;gt;&lt;br /&gt;
CCTTCGTACGGACGACCTTC Tm = 58° C  112bp downstream first base&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_SeqFor&amp;lt;br&amp;gt;&lt;br /&gt;
GCATTAGAAACCGTCCATCG Tm = 64° C 73bp upstream first base&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone SeqRev&amp;lt;br&amp;gt;&lt;br /&gt;
CCATTAGAAACCATCCCTCG Tm = 63° C 119bp downstream first base&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_SeqFor&amp;lt;br&amp;gt;&lt;br /&gt;
CTAATTCAACAAGAATTGGGAC Tm = 60° C 65bp upstream first base&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Debbiethurtle</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Sequence_DNA_for_Bio113&amp;diff=19095</id>
		<title>Sequence DNA for Bio113</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Sequence_DNA_for_Bio113&amp;diff=19095"/>
				<updated>2017-11-15T20:47:54Z</updated>
		
		<summary type="html">&lt;p&gt;Debbiethurtle: /* Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
== Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence ==&lt;br /&gt;
# For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample. &lt;br /&gt;
# Add water to your DNA until the combined volume is 8 µL. &lt;br /&gt;
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.&lt;br /&gt;
# Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
'''Sequencing Primers to confirm Inserts v2.0'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_SeqFor&amp;lt;br&amp;gt;&lt;br /&gt;
CTAATTCAACAAGAATTGGGAC Tm = 60° C  65bp upstream first base&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_SeqFor &amp;lt;br&amp;gt;&lt;br /&gt;
CCTTCGTACGGACGACCTTC Tm = 58° C  112bp downstream first base&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_SeqFor&amp;lt;br&amp;gt;&lt;br /&gt;
GCATTAGAAACCGTCCATCG Tm = 64° C 73bp upstream first base&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone SeqRev&amp;lt;br&amp;gt;&lt;br /&gt;
CCATTAGAAACCATCCCTCG Tm = 63° C 107bp downstream first base&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_SeqFor&amp;lt;br&amp;gt;&lt;br /&gt;
CTAATTCAACAAGAATTGGGAC Tm = 60° C 67bp upstream first base&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Debbiethurtle</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19090</id>
		<title>PCR for Bio113</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=PCR_for_Bio113&amp;diff=19090"/>
				<updated>2017-08-18T20:05:29Z</updated>
		
		<summary type="html">&lt;p&gt;Debbiethurtle: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PCR Verification of Successful GGA==&lt;br /&gt;
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel). &lt;br /&gt;
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template. &lt;br /&gt;
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred. &lt;br /&gt;
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid. &lt;br /&gt;
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells. &lt;br /&gt;
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
# 95° C for 5 minutes, 1 time&lt;br /&gt;
# 95° C for 30 seconds&lt;br /&gt;
# 54° C for 30 seconds&lt;br /&gt;
#72° C for 1 minute&lt;br /&gt;
# return to step #2 29 more times&lt;br /&gt;
# store at 22° C indefinitely&lt;br /&gt;
&lt;br /&gt;
* When the PCR is completed, they will be stored until next week when you will load 10 µL of each into the wells of a 2% agarose gel. &lt;br /&gt;
&lt;br /&gt;
== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==&lt;br /&gt;
&lt;br /&gt;
'''J119137; pClone Red  (remove 70 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
210 bp amplicon for J119137&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J119384; rClone Red  (remove 815 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC TM = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C&amp;lt;br&amp;gt;&lt;br /&gt;
856 bp amplicon for J119384&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100204; actClone Red (remove 119 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG  Tm = 61 C&amp;lt;br&amp;gt;&lt;br /&gt;
250 bp amplicon for J100204 &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''J100205; repClone Red (remove 129 bp, insert &amp;lt;61 bp)'''&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C&amp;lt;br&amp;gt;&lt;br /&gt;
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C&amp;lt;br&amp;gt;&lt;br /&gt;
424 bp amplicon for J100205&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Debbiethurtle</name></author>	</entry>

	</feed>