<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Dudeloache</id>
		<title>GcatWiki - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Dudeloache"/>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Special:Contributions/Dudeloache"/>
		<updated>2026-07-01T16:11:06Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.28.2</generator>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Team_R2D2&amp;diff=14309</id>
		<title>Team R2D2</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Team_R2D2&amp;diff=14309"/>
				<updated>2012-04-25T21:28:28Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==To Do==&lt;br /&gt;
*Connect to iRobot &amp;amp; Send Command with MatLab (with laptop) - Cyrus &lt;br /&gt;
*Decide on Camera - Leland &amp;amp; Corey&lt;br /&gt;
*Subgroup Make Outline&lt;br /&gt;
&lt;br /&gt;
[https://docs.google.com/document/d/1xU78yDOxWieFpKtT_QhTrIGgYQCLwbA970CSFqemvBQ/edit Abstract Draft]&lt;br /&gt;
&lt;br /&gt;
==Imaging==&lt;br /&gt;
===Summary===&lt;br /&gt;
*Camera will be attached and set - to move the camera left or right we will move the robot&lt;br /&gt;
**We will have to decide if we want to create a contraption to raise/lower the camera&lt;br /&gt;
*We need to get a camera that we can also connect to via bluetooth... at first this could be a wired, but we need direct usb connection in final version&lt;br /&gt;
*[http://www.zagrosrobotics.com/shop/custom.aspx?recid=17 Good Link]&lt;br /&gt;
&lt;br /&gt;
===[http://www.mathworks.com/products/imaq/ Matlab Imaging]===&lt;br /&gt;
*[http://www.mathworks.com/products/imaq/ Image Acquisition Toolbox] - I think this costs money&lt;br /&gt;
*[http://www2.cs.uh.edu/~somalley/camerabox.html Matlab toolbox to control cannon cameras]&lt;br /&gt;
&lt;br /&gt;
===[http://opencv.willowgarage.com/wiki/ OpenCV]===&lt;br /&gt;
*Has some nice functions that could be used to detect opjects&lt;br /&gt;
*OpenCV (Open Source Computer Vision) is a library of programming functions for real time computer vision.&lt;br /&gt;
**&amp;quot;applications of the OpenCV library are Human-Computer Interaction (HCI); Object Identification, Segmentation and Recognition; Face Recognition; Gesture Recognition; Motion Tracking, Ego Motion, Motion Understanding; Structure From Motion (SFM); Stereo and Multi-Camera Calibration and Depth Computation; Mobile Robotics.&amp;quot;&lt;br /&gt;
*[http://docs.opencv.org/ OpenCV Documentation]&lt;br /&gt;
**[http://opencv.willowgarage.com/documentation/python/index.html Python Interface]&lt;br /&gt;
**C++ Interface&lt;br /&gt;
*[http://opencv.willowgarage.com/wiki/Welcome/OS List of compatible cameras]&lt;br /&gt;
**Camera used in FLAIL project: [http://www.logitech.com/webcam-communications/webcams/devices/6333 Logitech Webcam Pro 9000]&lt;br /&gt;
***This camera will work with openCV and matlab camera control features (see [http://www.mathworks.com/matlabcentral/newsreader/view_thread/245473 here])&lt;br /&gt;
&lt;br /&gt;
Below is python code taken from [http://www.cs.duke.edu/~mac/flail.py FLAIL v2]&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
##################&lt;br /&gt;
# Camera Control #&lt;br /&gt;
##################&lt;br /&gt;
class FlailCam:&lt;br /&gt;
  &amp;quot;&amp;quot;&amp;quot;&lt;br /&gt;
  Controls a USB webcam. Uses OpenCV to control the camera, and should&lt;br /&gt;
  therefore work with any V4L2-compatible camera (in linux) or just about&lt;br /&gt;
  anything (in Mac OS). Webcam support being what it is in Linux, though, it&lt;br /&gt;
  may not work at all.&lt;br /&gt;
 &lt;br /&gt;
  If you find yourself in the it-doesn't-even-begin-to-work boat, take a look&lt;br /&gt;
  at flailcam.py from FLAIL 1.0. It has a (terrible, kludgy, slow) workaround&lt;br /&gt;
  that sometimes worked better.&lt;br /&gt;
 &lt;br /&gt;
  The important method (get_image) returns a Python Imaging Library (or PIL)&lt;br /&gt;
  object; these are well-documented on the PIL website, at&lt;br /&gt;
  &amp;lt;http://www.pythonware.com/library/pil/handbook/image.htm&amp;gt;. You're probably&lt;br /&gt;
  most interested in the getpixel, putpixel, and save methods. &lt;br /&gt;
 &lt;br /&gt;
  FLAIL 1.0 had a FlailImage class, which wrapped the same PIL image class&lt;br /&gt;
  used here; if you'd like an extremely simplified interface, take a look at&lt;br /&gt;
  that code.&lt;br /&gt;
   &lt;br /&gt;
  If you'd prefer an OpenCV object, just take a look at the get_image source&lt;br /&gt;
  code, and you'll see what to do.&lt;br /&gt;
  &amp;quot;&amp;quot;&amp;quot;&lt;br /&gt;
  def __init__(self, index = 0):&lt;br /&gt;
    &amp;quot;&amp;quot;&amp;quot;&lt;br /&gt;
    Connect to a camera. OpenCV (which we use for camera control) numbers&lt;br /&gt;
    these starting from 0; the index parameter tells which camera to use. In&lt;br /&gt;
    Linux, an index of X implies the device /dev/videoX.&lt;br /&gt;
    &amp;quot;&amp;quot;&amp;quot;&lt;br /&gt;
    self.cap = opencv.highgui.cvCreateCameraCapture(index)&lt;br /&gt;
 &lt;br /&gt;
  def get_image(self):&lt;br /&gt;
    &amp;quot;&amp;quot;&amp;quot;&lt;br /&gt;
    Take a picture. Return it as a PIL image. &lt;br /&gt;
    &amp;quot;&amp;quot;&amp;quot;&lt;br /&gt;
    return opencv.adaptors.Ipl2PIL(opencv.highgui.cvQueryFrame(self.cap))&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Issues===&lt;br /&gt;
*How do we connect to the camera wirelessly?&lt;br /&gt;
**http://www.youtube.com/watch?v=LG8zX68lxI0&lt;br /&gt;
&lt;br /&gt;
*New leads:&lt;br /&gt;
**http://bitshift.bi.funpic.de/en/dslr-remote/manual/bluetooth.php&lt;br /&gt;
**http://www.informationweek.com/news/cloud-computing/software/228800042&lt;br /&gt;
**Pros: we can use almost any dslr camera.&lt;br /&gt;
**Cons: A lot of (potentially very difficult) coding. And we still need how to send the photo back to our laptop.&lt;br /&gt;
&lt;br /&gt;
*MATLAB approach:&lt;br /&gt;
**http://www.mathworks.com/matlabcentral/newsreader/view_thread/154601&lt;br /&gt;
**Pros: it's been done before (though maybe not without the acquisition toolbox, but I think it's possible). It looks very straightforward.&lt;br /&gt;
**Cons: Acquisition toolbox is a lot of money. Couldn't find anything about using newer versions of MATLAB to do this. Have to use low res webcam.&lt;br /&gt;
&lt;br /&gt;
===Possible Cameras===&lt;br /&gt;
*[http://www.lightinthebox.com/Popular/Bluetooth_Wireless_Webcam.html Something]&lt;br /&gt;
*[http://www.ecamm.com/mac/webcam/bt1/index.html BT-1] - 640x480&lt;br /&gt;
*[http://www.aztekcomputers.com/TVIP110-TRENDNET-426191.html For obtaining online images via MATLAB]&lt;br /&gt;
*[http://www.robotshop.com/4d-systems-microcam-serial-jpeg-camera-module-rs232-2.html Serial port integrated camera--looks good]&lt;br /&gt;
&lt;br /&gt;
==Navigation==&lt;br /&gt;
&lt;br /&gt;
==Notes==&lt;br /&gt;
Jack and Duke met on 4/20 to discuss navigation. The consensus was that our first goal is to figure out how to design a virtual map of a space and write commands to get the robot to go to a target location in the space. Once we do that, we will work on mapping out chambers, hopefully using the robot to gather data of the shape of our chambers floor (which one are we going to do?) and turn that data into a map. We also discussed the possibility of using traveling salesman problem model to get the robot to our target locations as quickly as possible.&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=IRobot_Energy_Saver_Project&amp;diff=14287</id>
		<title>IRobot Energy Saver Project</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=IRobot_Energy_Saver_Project&amp;diff=14287"/>
				<updated>2012-04-22T23:09:20Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: /* Useful Links */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Team Pages==&lt;br /&gt;
[[Team R2D2]] &amp;lt;br&amp;gt;&lt;br /&gt;
[[Team Commando]]&lt;br /&gt;
&lt;br /&gt;
==Tools/Packages==&lt;br /&gt;
*[http://www.usna.edu/Users/weapsys/esposito/roomba.matlab/ MatLab Package]&lt;br /&gt;
*[http://www.rose-hulman.edu/class/csse/resources/Robotics/ PyCreate]&lt;br /&gt;
*[http://cgi.cs.duke.edu/~mac/flail/index.cgi?page=home FLAIL]&lt;br /&gt;
&lt;br /&gt;
==Useful Links==&lt;br /&gt;
*[http://www.irobot.com/hrd_right_rail/create_rr/create_fam/createFam_rr_manuals.html All Manuals]&lt;br /&gt;
**May be really useful to command module team&lt;br /&gt;
*[http://www.elementdirect.com/files/10542B.pdf BAM documentation]&lt;br /&gt;
*[http://www.robotiklubi.ee/_media/kursused/roomba_sumo/failid/hacking_roomba.pdf iRobot Hacking Guide]&lt;br /&gt;
*[http://www.usna.edu/Users/weapsys/esposito/roomba.matlab/Matlab_Toolbox_iRobot_create_doc.pdf MATLAB Create Toolbox User Guide]&lt;br /&gt;
&lt;br /&gt;
==General To Do==&lt;br /&gt;
*Navigation&lt;br /&gt;
**Check out this SLAM [http://ocw.mit.edu/courses/aeronautics-and-astronautics/16-412j-cognitive-robotics-spring-2005/projects/1aslam_blas_repo.pdf tutorial]&lt;br /&gt;
*Aiming Camera&lt;br /&gt;
*Image Processing&lt;br /&gt;
&lt;br /&gt;
==Dr. Heyer's To Do==&lt;br /&gt;
&lt;br /&gt;
* Laptops are in the cabinet, along with the robots and all accessories. &lt;br /&gt;
**Macbook is for BAM group (R2D2) and Dell laptop is for Command module group (Commandos) &lt;br /&gt;
**MATLAB and statistics toolbox are installed and now (as of 4-22-12) activated on both&lt;br /&gt;
**Cyrus, Leland and Duke are already admin on Macbook, others can be made admin by them&lt;br /&gt;
**All Commandos are admin on Dell&lt;br /&gt;
**EVERYONE must log in once on wired connection before wireless will work&lt;br /&gt;
&lt;br /&gt;
* Standing by for camera specs. Need to figure this out soon.&lt;br /&gt;
&lt;br /&gt;
*Wiki accounts have been requested, coming soon&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Team_R2D2&amp;diff=14250</id>
		<title>Team R2D2</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Team_R2D2&amp;diff=14250"/>
				<updated>2012-04-20T19:36:35Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: /* To Do */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==To Do==&lt;br /&gt;
*Connect to iRobot &amp;amp; Send Command with MatLab (with laptop) - Cyrus &lt;br /&gt;
*Decide on Camera - Leland &amp;amp; Corey&lt;br /&gt;
*Subgroup Make Outline&lt;br /&gt;
&lt;br /&gt;
Jack and Duke met on 4/20 to discuss navigation. The consensus was that our first goal is to figure out how to design a virtual map of a space and write commands to get the robot to go to a target location in the space. Once we do that, we will work on mapping out chambers, hopefully using the robot to gather data of the shape of our chambers floor (which one are we going to do?) and turn that data into a map. We also discussed the possibility of using traveling salesman problem model to get the robot to our target locations as quickly as possible.&lt;br /&gt;
&lt;br /&gt;
==Navigation==&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13740</id>
		<title>WEEK FOUR (February 6 - 10)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13740"/>
				<updated>2012-02-10T21:58:59Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We have been given the DNA encoding [http://2011.igem.org/Team:Washington/Magnetosomes/Magnet_Toolkit 18 genes in 10 different clones] and we need to get the DNA into cells, verify the inserts, freeze down glycerol stocks, enter them into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog], and send some cells to our colleagues at MWSU. &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Davidson_Protocols Davidson Protocols]&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
* '''Everyone should register''' for a [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog account (v2.5.4 or higher)]. &lt;br /&gt;
* The plan this week is to do all wet lab stuff. Dr. Heyer will be out of town and we need to get the magnetasome DNA into ''E. coli'' cells (strain JM109). I know none of you can come to all these meetings, but we will be doing each step as outlined over the week. Come to the ones you can attend. Each person should be able to do at least 3 of these. You can choose which three. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 3 9:30 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transform JM109] &amp;amp; plate on appropriate media. ([http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Confirm with UW team])&amp;lt;br&amp;gt;&lt;br /&gt;
take about 45 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Saturday February 4''' I ''need one volunteer''&amp;lt;br&amp;gt;&lt;br /&gt;
take out of incubator put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
take about 15 minutes and must be done before 9 am&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Sunday February 5 mid-afternoon: 3 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
pick colonies from each plate and put into 2 mL appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
take about 30 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Monday February 6 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
Do [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html minipreps] but SAVE THE CELLS on plates&amp;lt;br&amp;gt;&lt;br /&gt;
takes about 1 hour&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tuesday February 7 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
set up [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html digestions], run 30 min to 1 hr and put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
Determine insert sizes from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Wednesday February 8 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html determine the percent agarose] needed for the inserts&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html pour and run gel(s)] then photograph gel(s)&amp;lt;br&amp;gt;&lt;br /&gt;
verify insert sizes (get this from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry])&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/DNA-RNA-Purification-Analysis/Nucleic-Acid-Gel-Electrophoresis/DNA-Ladders/1kb-Plus-Ladders.html?s_kwcid=TC|12123|1kB%20DNA%20ladder||S|b|9891564060 molecular weight marker]&amp;lt;br&amp;gt;&lt;br /&gt;
[[File:IS_gel.jpg]] [[File:lanes.JPG]]&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamE''' = 2253 bp, '''insert looks correct''' based on gel (Ben)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamO''' = 1914 bp or 1975 bp '''insert looks correct''' based on gel (Erich)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamQRB''' = 2029 bp or 2108 bp (Dancho)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamPA''' = 1584 bp, '''insert looks correct''' based on gel (Ellen)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamV''' = 1168 bp, '''insert looks correct''' based on gel (Malcolm)&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamSTU''' = 2030 bp or 2160 bp (Kirsten)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamMN''' = 2323 bp or 2367 bp (Nishita)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamJ''' = 1521 bp or 1626 bp (Becca)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamKL'''= 1336 or 1439 bp (Alex)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamHI''' = 1600 bp or 1626 (Duke) -- insert looks incorrect &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;&lt;br /&gt;
[[File:eDigested_mamV.png]]&amp;lt;br&amp;gt;&lt;br /&gt;
ApE digestion of mamV using BamHI (0 sites) and EcoRI (1 site) produces two fragments of 1032 bp and 136 bp. &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;/center&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;&lt;br /&gt;
[[File:Digested_mamPA.png]]&amp;lt;br&amp;gt;&lt;br /&gt;
ApE digestion of mamPA using BamHI (0 sites) and EcoRI (0 sites) produces one fragment of 1573 bp.&lt;br /&gt;
&lt;br /&gt;
'''Thursday February 9 11 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
grow overnight cultures of clones with correct inserts sizes&amp;lt;br&amp;gt;&lt;br /&gt;
pick from plate and put into 2 mL of appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
streak out on new plate for shipping to MWSU. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 10 4 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
take cells out of incubator&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Glycerolstocks_How_to_Make_Glycerol_Stocks_of_Bacteria freeze down cells] and enter into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog].&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Primers used for fragment extraction:&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_fwd	GGTACCTTCGTATGAACCCTGTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_rev	CGTCTTCTACGTCACCATTGAAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_fwd	CCGCTTCAGACCCTGACA&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_rev	        CGATCTCGCCGGTTATTC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_fwd    	CAGATTTTGCTGAAGGTCAACC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_rev	        CGTTCGCGTGCTAAATGAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_fwd	CTGGCAGCCGTCAATTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_rev	CCTCATCCTTACTCACTCCAAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_fwd	ATCCCTTCGCTTGGGTTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_rev	AATCATGGCTGAGTTCCAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_fwd	GAGATGACGACAGGAATCCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_rev	CCAATCCCAGCATCATGATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_fwd	TGCTGACCTCGGTGTGATG&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_rev	GAAGGAAACGCCCCACATAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_fwd	CTTGCCGCATTTCAAGAAG&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_rev	GGCTCAACATACGCTCTGG&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_fwd	CGCATCCAGGAGGAAATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_rev	AACCGCACCACCTTGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_fwd	GCTGGTGCCCAAATAATCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_rev	        CAATCGCCAACAGCGTAG&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[media:MamAB_copy.txt]] ApE file for the mamAB operon]] with the primers, genes, native promoter, and terminator sequences annotated. Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)]. &amp;lt;br&amp;gt;&lt;br /&gt;
[[media:pGA1C3_pLac-GFP.txt]] pGA1C3 plasmid map (with pLac GFP insert). Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''mamV''' = 1002 bp or 1168 bp, depending on how we verify the insert. (Malcolm)&lt;br /&gt;
&lt;br /&gt;
'''mamO''' = 1914 bp or 1975 bp (Erich)&lt;br /&gt;
&lt;br /&gt;
'''mamPA''' = 1493 bp or 1584 bp (Ellen)&lt;br /&gt;
&lt;br /&gt;
'''mamSTU''' = 2030 bp or 2160 bp (Kirsten)&lt;br /&gt;
&lt;br /&gt;
'''mamQRB''' = 2029 bp or 2108 bp (Dancho)&lt;br /&gt;
&lt;br /&gt;
'''mamE''' = 2172 bp or 2253 bp (Ben)&lt;br /&gt;
&lt;br /&gt;
'''mamHI''' = 1600 bp or 1626 (Duke)&lt;br /&gt;
&lt;br /&gt;
'''mamKL'''= 1336 or 1439 bp (Alex)&lt;br /&gt;
&lt;br /&gt;
'''mamMN''' = 2323 bp or 2367 bp (Nishita)&lt;br /&gt;
&lt;br /&gt;
'''mamJ''' = 1521 bp or 1626 bp (Becca)&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13721</id>
		<title>WEEK FOUR (February 6 - 10)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13721"/>
				<updated>2012-02-08T23:32:54Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We have been given the DNA encoding [http://2011.igem.org/Team:Washington/Magnetosomes/Magnet_Toolkit 18 genes in 10 different clones] and we need to get the DNA into cells, verify the inserts, freeze down glycerol stocks, enter them into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog], and send some cells to our colleagues at MWSU. &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Davidson_Protocols Davidson Protocols]&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
* '''Everyone should register''' for a [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog account (v2.5.4 or higher)]. &lt;br /&gt;
* The plan this week is to do all wet lab stuff. Dr. Heyer will be out of town and we need to get the magnetasome DNA into ''E. coli'' cells (strain JM109). I know none of you can come to all these meetings, but we will be doing each step as outlined over the week. Come to the ones you can attend. Each person should be able to do at least 3 of these. You can choose which three. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 3 9:30 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transform JM109] &amp;amp; plate on appropriate media. ([http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Confirm with UW team])&amp;lt;br&amp;gt;&lt;br /&gt;
take about 45 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Saturday February 4''' I ''need one volunteer''&amp;lt;br&amp;gt;&lt;br /&gt;
take out of incubator put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
take about 15 minutes and must be done before 9 am&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Sunday February 5 mid-afternoon: 3 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
pick colonies from each plate and put into 2 mL appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
take about 30 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Monday February 6 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
Do [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html minipreps] but SAVE THE CELLS on plates&amp;lt;br&amp;gt;&lt;br /&gt;
takes about 1 hour&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tuesday February 7 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
set up [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html digestions], run 30 min to 1 hr and put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
Determine insert sizes from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Wednesday February 8 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html determine the percent agarose] needed for the inserts&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html pour and run gel(s)] then photograph gel(s)&amp;lt;br&amp;gt;&lt;br /&gt;
verify insert sizes (get this from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry])&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Thursday February 9 11 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
grow overnight cultures of clones with correct inserts sizes&amp;lt;br&amp;gt;&lt;br /&gt;
pick from plate and put into 2 mL of appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 10 4 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
take cells out of incubator&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Glycerolstocks_How_to_Make_Glycerol_Stocks_of_Bacteria freeze down cells] and enter into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog].&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Primers used for fragment extraction:&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_fwd	GGTACCTTCGTATGAACCCTGTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_rev	CGTCTTCTACGTCACCATTGAAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_fwd	CCGCTTCAGACCCTGACA&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_rev	        CGATCTCGCCGGTTATTC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_fwd    	CAGATTTTGCTGAAGGTCAACC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_rev	        CGTTCGCGTGCTAAATGAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_fwd	CTGGCAGCCGTCAATTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_rev	CCTCATCCTTACTCACTCCAAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_fwd	ATCCCTTCGCTTGGGTTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_rev	AATCATGGCTGAGTTCCAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_fwd	GAGATGACGACAGGAATCCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_rev	CCAATCCCAGCATCATGATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_fwd	TGCTGACCTCGGTGTGATG&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_rev	GAAGGAAACGCCCCACATAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_fwd	CTTGCCGCATTTCAAGAAG&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_rev	GGCTCAACATACGCTCTGG&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_fwd	CGCATCCAGGAGGAAATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_rev	AACCGCACCACCTTGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_fwd	GCTGGTGCCCAAATAATCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_rev	        CAATCGCCAACAGCGTAG&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[media:MamAB_copy.txt]] ApE file for the mamAB operon]] with the primers, genes, native promoter, and terminator sequences annotated. Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)]. &amp;lt;br&amp;gt;&lt;br /&gt;
[[media:pGA1C3_pLac-GFP.txt]] pGA1C3 plasmid map (with pLac GFP insert). Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''mamV''' = 1002 bp or 1168 bp, depending on how we verify the insert. (Malcolm)&lt;br /&gt;
&lt;br /&gt;
'''mamO''' = 1914 bp or 1975 bp (Erich)&lt;br /&gt;
&lt;br /&gt;
'''mamPA''' = 1493 bp or 1584 bp (Ellen)&lt;br /&gt;
&lt;br /&gt;
'''mamSTU''' = 2030 bp or 2160 bp (Kirsten)&lt;br /&gt;
&lt;br /&gt;
'''mamQRB''' = 2029 bp or 2108 bp (Dancho)&lt;br /&gt;
&lt;br /&gt;
'''mamE''' = 2172 bp or 2253 bp (Ben)&lt;br /&gt;
&lt;br /&gt;
'''mamHI''' = 1600 bp or 1626 (Duke)&lt;br /&gt;
&lt;br /&gt;
'''mamKL'''= 1336 or 1439 bp (Alex)&lt;br /&gt;
&lt;br /&gt;
'''mamMN''' = 2323 bp or 2367 bp (Nishita)&lt;br /&gt;
&lt;br /&gt;
'''mamJ''' = 1521 bp or 1626 bp (Becca)&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13715</id>
		<title>WEEK FOUR (February 6 - 10)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13715"/>
				<updated>2012-02-06T19:53:04Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We have been given the DNA encoding [http://2011.igem.org/Team:Washington/Magnetosomes/Magnet_Toolkit 18 genes in 10 different clones] and we need to get the DNA into cells, verify the inserts, freeze down glycerol stocks, enter them into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog], and send some cells to our colleagues at MWSU. &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Davidson_Protocols Davidson Protocols]&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
* '''Everyone should register''' for a [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog account (v2.5.4 or higher)]. &lt;br /&gt;
* The plan this week is to do all wet lab stuff. Dr. Heyer will be out of town and we need to get the magnetasome DNA into ''E. coli'' cells (strain JM109). I know none of you can come to all these meetings, but we will be doing each step as outlined over the week. Come to the ones you can attend. Each person should be able to do at least 3 of these. You can choose which three. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 3 9:30 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transform JM109] &amp;amp; plate on appropriate media. ([http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Confirm with UW team])&amp;lt;br&amp;gt;&lt;br /&gt;
take about 45 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Saturday February 4''' I ''need one volunteer''&amp;lt;br&amp;gt;&lt;br /&gt;
take out of incubator put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
take about 15 minutes and must be done before 9 am&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Sunday February 5 mid-afternoon: 3 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
pick colonies from each plate and put into 2 mL appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
take about 30 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Monday February 6 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
Do [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html minipreps] but SAVE THE CELLS on plates&amp;lt;br&amp;gt;&lt;br /&gt;
takes about 1 hour&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tuesday February 7 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
set up [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html digestions], run 30 min to 1 hr and put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
Determine insert sizes from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Wednesday February 8 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html determine the percent agarose] needed for the inserts&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html pour and run gel(s)] then photograph gel(s)&amp;lt;br&amp;gt;&lt;br /&gt;
verify insert sizes (get this from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry])&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Thursday February 9 11 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
grow overnight cultures of clones with correct inserts sizes&amp;lt;br&amp;gt;&lt;br /&gt;
pick from plate and put into 2 mL of appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 10 4 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
take cells out of incubator&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Glycerolstocks_How_to_Make_Glycerol_Stocks_of_Bacteria freeze down cells] and enter into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog].&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Primers used for fragment extraction:&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_fwd	GGTACCTTCGTATGAACCCTGTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_rev	CGTCTTCTACGTCACCATTGAAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_fwd	CCGCTTCAGACCCTGACA&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_rev	        CGATCTCGCCGGTTATTC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_fwd    	CAGATTTTGCTGAAGGTCAACC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_rev	        CGTTCGCGTGCTAAATGAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_fwd	CTGGCAGCCGTCAATTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_rev	CCTCATCCTTACTCACTCCAAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_fwd	ATCCCTTCGCTTGGGTTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_rev	AATCATGGCTGAGTTCCAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_fwd	GAGATGACGACAGGAATCCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_rev	CCAATCCCAGCATCATGATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_fwd	TGCTGACCTCGGTGTGATG&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_rev	GAAGGAAACGCCCCACATAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_fwd	CTTGCCGCATTTCAAGAAG&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_rev	GGCTCAACATACGCTCTGG&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_fwd	CGCATCCAGGAGGAAATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_rev	AACCGCACCACCTTGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_fwd	GCTGGTGCCCAAATAATCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_rev	        CAATCGCCAACAGCGTAG&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[media:MamAB_copy.txt]] ApE file for the mamAB operon]] with the primers, genes, native promoter, and terminator sequences annotated. Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)]. &amp;lt;br&amp;gt;&lt;br /&gt;
[[media:pGA1C3_pLac-GFP.txt]] pGA1C3 plasmid map (with pLac GFP insert). Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''mamV''' = 1002 bp or 1168 bp, depending on how we verify the insert. (Malcolm)&lt;br /&gt;
&lt;br /&gt;
'''mamO''' = 1914 bp or 1975 bp (Erich)&lt;br /&gt;
&lt;br /&gt;
'''mamPA''' = 1493 bp or 1584 bp (Ellen)&lt;br /&gt;
&lt;br /&gt;
'''mamSTU''' = 2030 bp or 2160 bp (Kirsten)&lt;br /&gt;
&lt;br /&gt;
'''mamQRB''' = 2029 bp or 2108 bp (Dancho)&lt;br /&gt;
&lt;br /&gt;
'''mamE''' = 2172 bp or 2253 bp (Ben)&lt;br /&gt;
&lt;br /&gt;
'''mamHI''' = 1600 bp or (supposedly) 4291 bp...but I think this is wrong. See [http://partsregistry.org/wiki/index.php?title=Part:BBa_K590000 here] (Duke)&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13714</id>
		<title>WEEK FOUR (February 6 - 10)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13714"/>
				<updated>2012-02-06T19:52:42Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We have been given the DNA encoding [http://2011.igem.org/Team:Washington/Magnetosomes/Magnet_Toolkit 18 genes in 10 different clones] and we need to get the DNA into cells, verify the inserts, freeze down glycerol stocks, enter them into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog], and send some cells to our colleagues at MWSU. &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Davidson_Protocols Davidson Protocols]&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
* '''Everyone should register''' for a [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog account (v2.5.4 or higher)]. &lt;br /&gt;
* The plan this week is to do all wet lab stuff. Dr. Heyer will be out of town and we need to get the magnetasome DNA into ''E. coli'' cells (strain JM109). I know none of you can come to all these meetings, but we will be doing each step as outlined over the week. Come to the ones you can attend. Each person should be able to do at least 3 of these. You can choose which three. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 3 9:30 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transform JM109] &amp;amp; plate on appropriate media. ([http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Confirm with UW team])&amp;lt;br&amp;gt;&lt;br /&gt;
take about 45 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Saturday February 4''' I ''need one volunteer''&amp;lt;br&amp;gt;&lt;br /&gt;
take out of incubator put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
take about 15 minutes and must be done before 9 am&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Sunday February 5 mid-afternoon: 3 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
pick colonies from each plate and put into 2 mL appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
take about 30 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Monday February 6 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
Do [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html minipreps] but SAVE THE CELLS on plates&amp;lt;br&amp;gt;&lt;br /&gt;
takes about 1 hour&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tuesday February 7 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
set up [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html digestions], run 30 min to 1 hr and put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
Determine insert sizes from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Wednesday February 8 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html determine the percent agarose] needed for the inserts&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html pour and run gel(s)] then photograph gel(s)&amp;lt;br&amp;gt;&lt;br /&gt;
verify insert sizes (get this from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry])&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Thursday February 9 11 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
grow overnight cultures of clones with correct inserts sizes&amp;lt;br&amp;gt;&lt;br /&gt;
pick from plate and put into 2 mL of appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 10 4 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
take cells out of incubator&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Glycerolstocks_How_to_Make_Glycerol_Stocks_of_Bacteria freeze down cells] and enter into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog].&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Primers used for fragment extraction:&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_fwd	GGTACCTTCGTATGAACCCTGTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_rev	CGTCTTCTACGTCACCATTGAAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_fwd	CCGCTTCAGACCCTGACA&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_rev	        CGATCTCGCCGGTTATTC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_fwd    	CAGATTTTGCTGAAGGTCAACC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_rev	        CGTTCGCGTGCTAAATGAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_fwd	CTGGCAGCCGTCAATTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_rev	CCTCATCCTTACTCACTCCAAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_fwd	ATCCCTTCGCTTGGGTTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_rev	AATCATGGCTGAGTTCCAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_fwd	GAGATGACGACAGGAATCCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_rev	CCAATCCCAGCATCATGATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_fwd	TGCTGACCTCGGTGTGATG&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_rev	GAAGGAAACGCCCCACATAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_fwd	CTTGCCGCATTTCAAGAAG&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_rev	GGCTCAACATACGCTCTGG&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_fwd	CGCATCCAGGAGGAAATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_rev	AACCGCACCACCTTGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_fwd	GCTGGTGCCCAAATAATCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_rev	        CAATCGCCAACAGCGTAG&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[media:MamAB_copy.txt]] ApE file for the mamAB operon]] with the primers, genes, native promoter, and terminator sequences annotated. Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)]. &amp;lt;br&amp;gt;&lt;br /&gt;
[[media:pGA1C3_pLac-GFP.txt]] pGA1C3 plasmid map (with pLac GFP insert). Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''mamV''' = 1002 bp or 1168 bp, depending on how we verify the insert. (Malcolm)&lt;br /&gt;
&lt;br /&gt;
'''mamO''' = 1914 bp or 1975 bp (Erich)&lt;br /&gt;
&lt;br /&gt;
'''mamPA''' = 1493 bp or 1584 bp (Ellen)&lt;br /&gt;
&lt;br /&gt;
'''mamSTU''' = 2030 bp or 2160 bp (Kirsten)&lt;br /&gt;
&lt;br /&gt;
'''mamQRB''' = 2029 bp or 2108 bp (Dancho)&lt;br /&gt;
&lt;br /&gt;
'''mamE''' = 2172 bp or 2253 bp (Ben)&lt;br /&gt;
&lt;br /&gt;
'''mamHI''' = 1600 bp or (supposedly) 4291 bp...but I think this is wrong. See [http://partsregistry.org/wiki/index.php?title=Part:BBa_K590000 here]&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:MathematicalConcerns.doc&amp;diff=13298</id>
		<title>File:MathematicalConcerns.doc</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:MathematicalConcerns.doc&amp;diff=13298"/>
				<updated>2011-06-13T13:24:09Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:MathematicalConcerns.docx&amp;diff=13297</id>
		<title>File:MathematicalConcerns.docx</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:MathematicalConcerns.docx&amp;diff=13297"/>
				<updated>2011-06-13T13:21:53Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson%27s_Suggestions&amp;diff=13296</id>
		<title>Davidson's Suggestions</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson%27s_Suggestions&amp;diff=13296"/>
				<updated>2011-06-13T13:21:16Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[[Media:PrimerSuggestions.doc]] &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Media:MathematicalConcerns.doc]] &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13278</id>
		<title>Set Covering Problem</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13278"/>
				<updated>2011-06-09T20:12:32Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: /* Example: */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== The Set Covering Decision Problem: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Given a universe of elements '''U''' and a family of sets '''S''' whose union covers '''U''', is there a subset of '''S''' of size ''k'' that covers '''U'''? (a yes or no question)&lt;br /&gt;
&lt;br /&gt;
For a more detailed description of the problem, read this: http://en.wikipedia.org/wiki/Set_cover_problem&lt;br /&gt;
&lt;br /&gt;
The Set Covering Decision Problem is an NP complete problem, and we will describe a potential biological method to find a solution below. A similar problem is the optimization problem which asks to find the smallest possible number of sets in '''S''' that will cover '''U'''. The optimization problem is NP-hard and may be worth considering as well.&lt;br /&gt;
&lt;br /&gt;
== The Idea: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Every element of the universe '''U''' is represented by its own reporter gene. We can then build the sets in '''S''', potentially using Golden Gate Assembly. Then we can use the column method, with each column containing every set in '''S'''. The number of columns will be determined by ''k''. If all genes report after Golden Gate Assembly, then a ''yes'' answer has been found.&lt;br /&gt;
&lt;br /&gt;
== Example: ==&lt;br /&gt;
&lt;br /&gt;
'''U''' = {Cre,Bla,CAT,RFP,GFP}&lt;br /&gt;
&lt;br /&gt;
'''S''' = {{Cre, Bla, CAT},{Bla,RFP},{CAT,RFP},{RFP,GFP}}&lt;br /&gt;
&lt;br /&gt;
''k'' = 2&lt;br /&gt;
&lt;br /&gt;
Column 1 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}} each with same sticky end that will attach to beginning of strands in Column 2&lt;br /&gt;
 &lt;br /&gt;
Column 2 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}}&lt;br /&gt;
&lt;br /&gt;
If the answer is ''yes'', then using the Golden Gate Assembly method with these columns will produce a strand of genes expressing Cre, Bla, CAT, RFP, and GFP, formed using only one subset in each column. It is easy to see that there is indeed a solution to the simple problem above. Combining {Cre, Bla, CAT} and {RFP, GFP} in any order will signal that the answer is ''yes''.&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13277</id>
		<title>Set Covering Problem</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13277"/>
				<updated>2011-06-09T20:04:04Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: /* The Set Covering Decision Problem: */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== The Set Covering Decision Problem: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Given a universe of elements '''U''' and a family of sets '''S''' whose union covers '''U''', is there a subset of '''S''' of size ''k'' that covers '''U'''? (a yes or no question)&lt;br /&gt;
&lt;br /&gt;
For a more detailed description of the problem, read this: http://en.wikipedia.org/wiki/Set_cover_problem&lt;br /&gt;
&lt;br /&gt;
The Set Covering Decision Problem is an NP complete problem, and we will describe a potential biological method to find a solution below. A similar problem is the optimization problem which asks to find the smallest possible number of sets in '''S''' that will cover '''U'''. The optimization problem is NP-hard and may be worth considering as well.&lt;br /&gt;
&lt;br /&gt;
== The Idea: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Every element of the universe '''U''' is represented by its own reporter gene. We can then build the sets in '''S''', potentially using Golden Gate Assembly. Then we can use the column method, with each column containing every set in '''S'''. The number of columns will be determined by ''k''. If all genes report after Golden Gate Assembly, then a ''yes'' answer has been found.&lt;br /&gt;
&lt;br /&gt;
== Example: ==&lt;br /&gt;
&lt;br /&gt;
'''U''' = {Cre,Bla,CAT,RFP,GFP}&lt;br /&gt;
'''S''' = {{Cre, Bla, CAT},{Bla,RFP},{CAT,RFP},{RFP,GFP}}&lt;br /&gt;
''k'' = 2&lt;br /&gt;
&lt;br /&gt;
Column 1 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}} each with same sticky end that will attach to beginning of strands in Column 2&lt;br /&gt;
 &lt;br /&gt;
Column 2 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}}&lt;br /&gt;
&lt;br /&gt;
If the answer is ''yes'', then using the Golden Gate Assembly method with these columns will produce a strand of genes expressing Cre, Bla, CAT, RFP, and GFP, formed using only one subset in each column. It is easy to see that there is indeed a solution to the simple problem above. Combining {Cre, Bla, CAT} and {RFP, GFP} in any order will signal that the answer is ''yes''.&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13276</id>
		<title>Set Covering Problem</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13276"/>
				<updated>2011-06-09T20:03:48Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: /* The Idea: */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== The Set Covering Decision Problem: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Given a universe of elements '''U''' and a family of sets '''S''' whose union covers '''U''', is there a subset of '''S''' of size ''k'' that covers '''U'''? (a yes or no question)&lt;br /&gt;
&lt;br /&gt;
For a more detailed description of the problem, read this: http://en.wikipedia.org/wiki/Set_cover_problem&lt;br /&gt;
&lt;br /&gt;
The Set Covering Decision Problem is an NP complete problem, and we will describe a potential biological method to find a solution below. A similar problem is the optimization problem which asks to find the smallest possible number of sets in '''S''' that will cover '''U'''. The optimization problem is NP-hard and may be worth considering as well.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== The Idea: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Every element of the universe '''U''' is represented by its own reporter gene. We can then build the sets in '''S''', potentially using Golden Gate Assembly. Then we can use the column method, with each column containing every set in '''S'''. The number of columns will be determined by ''k''. If all genes report after Golden Gate Assembly, then a ''yes'' answer has been found.&lt;br /&gt;
&lt;br /&gt;
== Example: ==&lt;br /&gt;
&lt;br /&gt;
'''U''' = {Cre,Bla,CAT,RFP,GFP}&lt;br /&gt;
'''S''' = {{Cre, Bla, CAT},{Bla,RFP},{CAT,RFP},{RFP,GFP}}&lt;br /&gt;
''k'' = 2&lt;br /&gt;
&lt;br /&gt;
Column 1 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}} each with same sticky end that will attach to beginning of strands in Column 2&lt;br /&gt;
 &lt;br /&gt;
Column 2 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}}&lt;br /&gt;
&lt;br /&gt;
If the answer is ''yes'', then using the Golden Gate Assembly method with these columns will produce a strand of genes expressing Cre, Bla, CAT, RFP, and GFP, formed using only one subset in each column. It is easy to see that there is indeed a solution to the simple problem above. Combining {Cre, Bla, CAT} and {RFP, GFP} in any order will signal that the answer is ''yes''.&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13275</id>
		<title>Set Covering Problem</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13275"/>
				<updated>2011-06-09T20:03:20Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: /* Example: */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== The Set Covering Decision Problem: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Given a universe of elements '''U''' and a family of sets '''S''' whose union covers '''U''', is there a subset of '''S''' of size ''k'' that covers '''U'''? (a yes or no question)&lt;br /&gt;
&lt;br /&gt;
For a more detailed description of the problem, read this: http://en.wikipedia.org/wiki/Set_cover_problem&lt;br /&gt;
&lt;br /&gt;
The Set Covering Decision Problem is an NP complete problem, and we will describe a potential biological method to find a solution below. A similar problem is the optimization problem which asks to find the smallest possible number of sets in '''S''' that will cover '''U'''. The optimization problem is NP-hard and may be worth considering as well.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== The Idea: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Every element of the universe '''U''' is represented by its own reporter gene. We can then build the sets in '''S''', potentially using Golden Gate Assembly. Then we can use the column method, with each column containing every set in '''S'''. The number of columns will be determined by ''k''. If all genes report after Golden Gate Assembly, then a solution has been found.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Example: ==&lt;br /&gt;
&lt;br /&gt;
'''U''' = {Cre,Bla,CAT,RFP,GFP}&lt;br /&gt;
'''S''' = {{Cre, Bla, CAT},{Bla,RFP},{CAT,RFP},{RFP,GFP}}&lt;br /&gt;
''k'' = 2&lt;br /&gt;
&lt;br /&gt;
Column 1 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}} each with same sticky end that will attach to beginning of strands in Column 2&lt;br /&gt;
 &lt;br /&gt;
Column 2 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}}&lt;br /&gt;
&lt;br /&gt;
If the answer is ''yes'', then using the Golden Gate Assembly method with these columns will produce a strand of genes expressing Cre, Bla, CAT, RFP, and GFP, formed using only one subset in each column. It is easy to see that there is indeed a solution to the simple problem above. Combining {Cre, Bla, CAT} and {RFP, GFP} in any order will signal that the answer is ''yes''.&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13274</id>
		<title>Set Covering Problem</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13274"/>
				<updated>2011-06-09T20:02:36Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: /* Example: */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== The Set Covering Decision Problem: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Given a universe of elements '''U''' and a family of sets '''S''' whose union covers '''U''', is there a subset of '''S''' of size ''k'' that covers '''U'''? (a yes or no question)&lt;br /&gt;
&lt;br /&gt;
For a more detailed description of the problem, read this: http://en.wikipedia.org/wiki/Set_cover_problem&lt;br /&gt;
&lt;br /&gt;
The Set Covering Decision Problem is an NP complete problem, and we will describe a potential biological method to find a solution below. A similar problem is the optimization problem which asks to find the smallest possible number of sets in '''S''' that will cover '''U'''. The optimization problem is NP-hard and may be worth considering as well.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== The Idea: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Every element of the universe '''U''' is represented by its own reporter gene. We can then build the sets in '''S''', potentially using Golden Gate Assembly. Then we can use the column method, with each column containing every set in '''S'''. The number of columns will be determined by ''k''. If all genes report after Golden Gate Assembly, then a solution has been found.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Example: ==&lt;br /&gt;
&lt;br /&gt;
'''U''' = {Cre,Bla,CAT,RFP,GFP}&lt;br /&gt;
'''S''' = {{Cre, Bla, CAT},{Bla,RFP},{CAT,RFP},{RFP,GFP}}&lt;br /&gt;
''k'' = 2&lt;br /&gt;
&lt;br /&gt;
Column 1 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}} each with same sticky end that will attach to beginning of strands in Column 2&lt;br /&gt;
 &lt;br /&gt;
Column 2 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}}&lt;br /&gt;
&lt;br /&gt;
If there is a solution, then using the Golden Gate Assembly method with these columns will produce a strand of genes expressing Cre, Bla, CAT, RFP, and GFP, formed using only one subset in each column. It is easy to see that there is indeed a solution to the simple problem above. Combining {Cre, Bla, CAT} and {RFP, GFP} in any order will signal that the answer is yes.&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13273</id>
		<title>Set Covering Problem</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13273"/>
				<updated>2011-06-09T20:02:15Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== The Set Covering Decision Problem: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Given a universe of elements '''U''' and a family of sets '''S''' whose union covers '''U''', is there a subset of '''S''' of size ''k'' that covers '''U'''? (a yes or no question)&lt;br /&gt;
&lt;br /&gt;
For a more detailed description of the problem, read this: http://en.wikipedia.org/wiki/Set_cover_problem&lt;br /&gt;
&lt;br /&gt;
The Set Covering Decision Problem is an NP complete problem, and we will describe a potential biological method to find a solution below. A similar problem is the optimization problem which asks to find the smallest possible number of sets in '''S''' that will cover '''U'''. The optimization problem is NP-hard and may be worth considering as well.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== The Idea: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Every element of the universe '''U''' is represented by its own reporter gene. We can then build the sets in '''S''', potentially using Golden Gate Assembly. Then we can use the column method, with each column containing every set in '''S'''. The number of columns will be determined by ''k''. If all genes report after Golden Gate Assembly, then a solution has been found.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Example: ==&lt;br /&gt;
&lt;br /&gt;
'''U''' = {Cre,Bla,CAT,RFP,GFP}&lt;br /&gt;
'''S''' = {{Cre, Bla, CAT},{Bla,RFP},{CAT,RFP},{RFP,GFP}}&lt;br /&gt;
''k'' = 2&lt;br /&gt;
&lt;br /&gt;
Column 1 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}} each with sticky end that will attach to beginning of strands in Column 2&lt;br /&gt;
 &lt;br /&gt;
Column 2 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}}&lt;br /&gt;
&lt;br /&gt;
If there is a solution, then using the Golden Gate Assembly method with these columns will produce a strand of genes expressing Cre, Bla, CAT, RFP, and GFP, formed using only one subset in each column. It is easy to see that there is indeed a solution to the simple problem above. Combining {Cre, Bla, CAT} and {RFP, GFP} in any order will signal that the answer is yes.&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13272</id>
		<title>Set Covering Problem</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13272"/>
				<updated>2011-06-09T20:01:36Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== The Set Covering Decision Problem: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Given a universe of elements '''U''' and a family of sets '''S''' whose union covers '''U''', is there a subset of '''S''' of size ''k'' that covers '''U'''? (a yes or no question)&lt;br /&gt;
&lt;br /&gt;
For a more detailed description of the problem, read this: http://en.wikipedia.org/wiki/Set_cover_problem&lt;br /&gt;
&lt;br /&gt;
The Set Covering Decision Problem is an NP complete problem, and we will describe a potential biological method to find a solution below. A similar problem is the optimization problem which asks to find the smallest possible number of sets in '''S''' that will cover '''U'''. The optimization problem is NP-hard and may be worth considering as well.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== The Idea: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Every element of the universe '''U''' is represented by its own reporter gene. We can then build the sets in '''S''', potentially using Golden Gate Assembly. Then we can use the column method, with each column containing every set in '''S'''. The number of columns will be determined by ''k''. If all genes report after Golden Gate Assembly, then a solution has been found.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Example: ==&lt;br /&gt;
&lt;br /&gt;
'''U''' = {Cre,Bla,CAT,RFP,GFP}&lt;br /&gt;
'''S''' = {{Cre, Bla, CAT},{Bla,RFP},{CAT,RFP},{RFP,GFP}}&lt;br /&gt;
''k'' = 2&lt;br /&gt;
&lt;br /&gt;
Column 1 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}} each with sticky end that will attach to beginning of strands in &lt;br /&gt;
             column 2&lt;br /&gt;
 &lt;br /&gt;
Column 2 = {{Cre + Bla + CAT},{Bla + RFP},{CAT + RFP},{RFP + GFP}}&lt;br /&gt;
&lt;br /&gt;
If there is a solution, then using the Golden Gate Assembly method with these columns will produce a strand of genes expressing Cre, Bla, CAT, RFP, and GFP, formed using only one subset in each column. It is easy to see that there is indeed a solution to the simple problem above. Combining {Cre, Bla, CAT} and {RFP, GFP} in any order will signal that the answer is yes.&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13271</id>
		<title>Set Covering Problem</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Set_Covering_Problem&amp;diff=13271"/>
				<updated>2011-06-09T19:45:44Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: Created page with '== The Set Covering Decision Problem: ==   Given a universe of elements '''U''' and a family of sets '''S''' whose union covers '''U''', is there a subset of '''S''' of size ''k'…'&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== The Set Covering Decision Problem: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Given a universe of elements '''U''' and a family of sets '''S''' whose union covers '''U''', is there a subset of '''S''' of size ''k'' that covers '''U'''?&lt;br /&gt;
&lt;br /&gt;
For a more detailed description, read this: http://en.wikipedia.org/wiki/Set_cover_problem&lt;br /&gt;
&lt;br /&gt;
This is an NP complete problem, and we will describe a potential biological method to find a solution below. A similar problem is the optimization problem which asks to find the smallest possible number of sets in '''S''' that will cover '''U'''. The optimization problem is NP-hard and may be worth considering as well.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Our idea: ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Every element of the universe '''U''' is represented by its own reporter gene. We can then build the sets in '''S''', potentially using Golden Gate Assembly. Then we use the column method, with each column containing every set in '''S'''. The number of columns will be determined by ''k''. If all genes report, then a solution has been found.&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Missouri_Western/Davidson_SynBio_2011&amp;diff=13270</id>
		<title>Missouri Western/Davidson SynBio 2011</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Missouri_Western/Davidson_SynBio_2011&amp;diff=13270"/>
				<updated>2011-06-09T19:32:02Z</updated>
		
		<summary type="html">&lt;p&gt;Dudeloache: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This space will be used starting May, 2011 for brainstorming and a shared whiteboard space. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Davidson Protocols]]&amp;lt;br&amp;gt;&lt;br /&gt;
[[MWSU_protocols]] &amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/sybr-u/bmc.html BioMath Connections Page] &amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/GCATalog GCAT-alog Freezer Stocks]&amp;lt;br&amp;gt;&lt;br /&gt;
[[Laboratory_Notebooks]]&amp;lt;br&amp;gt;&lt;br /&gt;
[[Data Folder 2010]]&amp;lt;br&amp;gt;&lt;br /&gt;
[[DNA computing]]&amp;lt;br&amp;gt;&lt;br /&gt;
[[Golden Gate]]&amp;lt;br&amp;gt;&lt;br /&gt;
[[HPP Status]]&amp;lt;br&amp;gt;&lt;br /&gt;
[[Set Covering Problem]]&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Dudeloache</name></author>	</entry>

	</feed>