GcatWiki - User contributions [en]

M13 Bacteriophage Production Protocol

2017-05-17T23:01:10Z

Dymaghini:

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in LB + 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (~1-3mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

[[File:plaques.jpg|500px|thumb|left|Example Plate with Plaques]] [[File:plaques2.png|500px|thumb|center|Example Plate with Plaques]]

== Summary ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. '''Host cells:''' Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. '''Antibiotics:''' S1030 cells should be grown in or plated with 10ug/mL tetracycline. Bottom agar should have the antibiotic that host cells are resistant to, but not the antibiotic that the phage genome produces resistance to. This is because a phage only confers resistance to a cell that it has infected, at which point the cell’s growth is already inhibited by infection.

M13 Bacteriophage Production Protocol

2017-05-17T22:59:32Z

Dymaghini:

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in LB + 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (~1-3mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

[[File:plaques.jpg|500px|thumb|left|Example Plate with Plaques]] [[File:plaques2.png|500px|thumb|center|Example Plate with Plaques]]

== Summary and Troubleshooting ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. '''Host cells:''' Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. '''Antibiotics:''' S1030 cells should be grown in or plated with 10ug/mL tetracycline. Bottom agar should have the antibiotic that host cells are resistant to, but not the antibiotic that the phage genome produces resistance to. This is because a phage only confers resistance to a cell that it has infected, at which point the cell’s growth is already inhibited by infection.

M13 Bacteriophage Production Protocol

2017-05-17T22:58:27Z

Dymaghini:

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (~1-3mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

[[File:plaques.jpg|500px|thumb|left|Example Plate with Plaques]] [[File:plaques2.png|500px|thumb|center|Example Plate with Plaques]]

== Summary and Troubleshooting ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. '''Host cells:''' Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. '''Antibiotics:''' S1030 cells should be grown in or plated with 10ug/mL tetracycline. Bottom agar should have the antibiotic that host cells are resistant to, but not the antibiotic that the phage genome produces resistance to. This is because a phage only confers resistance to a cell that it has infected, at which point the cell’s growth is already inhibited by infection.

M13 Bacteriophage Production Protocol

2017-05-17T22:58:06Z

Dymaghini:

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (~1-3mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

[[File:plaques.jpg|500px|thumb|left|Example Plate with Plaques]] [[File:plaques2.png|500px|thumb|right|Example Plate with Plaques]]

== Summary and Troubleshooting ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. '''Host cells:''' Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. '''Antibiotics:''' S1030 cells should be grown in or plated with 10ug/mL tetracycline. Bottom agar should have the antibiotic that host cells are resistant to, but not the antibiotic that the phage genome produces resistance to. This is because a phage only confers resistance to a cell that it has infected, at which point the cell’s growth is already inhibited by infection.

M13 Bacteriophage Production Protocol

2017-05-17T22:57:53Z

Dymaghini:

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (~1-3mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

[[File:plaques.jpg|500px|thumb|left|Example Plate with Plaques]] [[File:plaques2.png|500px|thumb|right|Example Plate with Plaques]]

== Summary and Troubleshooting ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. '''Host cells:''' Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. '''Antibiotics:''' S1030 cells should be grown in or plated with 10ug/mL tetracycline. Bottom agar should have the antibiotic that host cells are resistant to, but not the antibiotic that the phage genome produces resistance to. This is because a phage only confers resistance to a cell that it has infected, at which point the cell’s growth is already inhibited by infection.

M13 Bacteriophage Production Protocol

2017-05-17T22:57:17Z

Dymaghini:

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (1mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

[[File:plaques.jpg|500px|thumb|left|Example Plate with Plaques]]
[[File:plaques2.png|500px|thumb|left|Example Plate with Plaques]]

== Summary and Troubleshooting ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. '''Host cells:''' Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. '''Antibiotics:''' S1030 cells should be grown in or plated with 10ug/mL tetracycline. Bottom agar should have the antibiotic that host cells are resistant to, but not the antibiotic that the phage genome produces resistance to. This is because a phage only confers resistance to a cell that it has infected, at which point the cell’s growth is already inhibited by infection.

File:Plaques2.png

2017-05-17T22:56:45Z

Dymaghini:

M13 Bacteriophage Production Protocol

2017-05-17T22:54:50Z

Dymaghini:

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (1mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

[[File:plaques.jpg|500px|thumb|left|Example Plate with Plaques]]

== Summary and Troubleshooting ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. '''Host cells:''' Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. '''Antibiotics:''' S1030 cells should be grown in or plated with 10ug/mL tetracycline. Bottom agar should have the antibiotic that host cells are resistant to, but not the antibiotic that the phage genome produces resistance to. This is because a phage only confers resistance to a cell that it has infected, at which point the cell’s growth is already inhibited by infection.

M13 Bacteriophage Production Protocol

2017-05-17T22:54:24Z

Dymaghini:

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (1mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

[[File:plaques.jpg|200px|thumb|left|alt text]]

== Summary and Troubleshooting ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. '''Host cells:''' Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. '''Antibiotics:''' S1030 cells should be grown in or plated with 10ug/mL tetracycline. Bottom agar should have the antibiotic that host cells are resistant to, but not the antibiotic that the phage genome produces resistance to. This is because a phage only confers resistance to a cell that it has infected, at which point the cell’s growth is already inhibited by infection.

File:Plaques.jpg

2017-05-17T22:53:49Z

Dymaghini: Dymaghini uploaded a new version of File:Plaques.jpg

M13 Bacteriophage Production Protocol

2017-05-17T22:52:43Z

Dymaghini:

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (1mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

[[File:plaques.jpg]]
== Summary and Troubleshooting ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. '''Host cells:''' Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. '''Antibiotics:''' S1030 cells should be grown in or plated with 10ug/mL tetracycline. Bottom agar should have the antibiotic that host cells are resistant to, but not the antibiotic that the phage genome produces resistance to. This is because a phage only confers resistance to a cell that it has infected, at which point the cell’s growth is already inhibited by infection.

File:Plaques.jpg

2017-05-17T22:52:03Z

Dymaghini: Dymaghini uploaded a new version of File:Plaques.jpg

File:Plaques.jpg

2017-05-17T22:50:53Z

Dymaghini:

M13 Bacteriophage Production Protocol

2017-05-17T22:48:07Z

Dymaghini: /* Summary and Troubleshooting */

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (1mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

== Summary and Troubleshooting ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. '''Host cells:''' Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. '''Antibiotics:''' S1030 cells should be grown in or plated with 10ug/mL tetracycline. Bottom agar should have the antibiotic that host cells are resistant to, but not the antibiotic that the phage genome produces resistance to. This is because a phage only confers resistance to a cell that it has infected, at which point the cell’s growth is already inhibited by infection.

M13 Bacteriophage Production Protocol

2017-05-17T22:47:48Z

Dymaghini: /* Summary and Troubleshooting */

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (1mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

== Summary and Troubleshooting ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. '''Host cells:''' Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. '''Antibiotics:’'’ S1030 cells should be grown in or plated with 10ug/mL tetracycline. Bottom agar should have the antibiotic that host cells are resistant to, but not the antibiotic that the phage genome produces resistance to. This is because a phage only confers resistance to a cell that it has infected, at which point the cell’s growth is already inhibited by infection.

M13 Bacteriophage Production Protocol

2017-05-17T22:45:19Z

Dymaghini:

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (1mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

== Summary and Troubleshooting ==

1. Grow S1030 cells with J100265 and J100270 plasmids overnight to produce SPT7-spec phage. J100269 or J100271 could take the place of the J100270 plasmid for producing promiscuous and wild type phage, respectively.

2. Host cells: Use J100265 cells as host cells. These are the easiest host cells, as geneIII on the J100265 plasmid follows the T7 promoter, and T7 RNAP is produced by the phage genome. J100284 can also be used as host cells, however they must be plated with ATc in top agar or geneIII will not be produced and phage will not be able to produce progeny. J100268 can also be used as host cells, but with the addition of ATc and glucose to repress mutagenesis.

3. Antibiotics:

M13 Bacteriophage Production Protocol

2017-05-17T22:39:05Z

Dymaghini:

This protocol describes how to produce plaques using M13 bacteriophage, and how to then harvest phage from these plaques. This is a multistep process which requires making both bottom agar (a lower layer of agar with antibiotics) and top agar (a top layer of agar with MgCl2), as well as growing host cells and performing phage dilutions.

== Preparing Phage ==

1. Grow 3mL of cells with the phage plasmid in liquid media overnight. These cells produce M13 phage which can then be isolated from the liquid media. For example, grow J100265 + J100270 S1030 cells in 50ug/mL carbenicillin + 50ug/mL kanamycin to produce SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube and discard the tube with the pelleted cells. The phage will remain viable for weeks if stored at 4°C.

3. When preparing to plate phage, make serial dilutions of the phage stock in LB broth. Each dilution should have a final volume of >10uL. Create a broad range of dilutions for plating, as too high of a phage concentration will produce many small, crowded plaques, while too low of a concentration may not produce plaques. Generally, a range from 10^-3 to 10^-9 should be sufficient.

== Preparing Top and Bottom Agar ==

1. Bottom agar should be produced following the same recipe for creating plates for plating cells. Plates with the appropriate antibiotics that were already made for other purposes are acceptable. There’s no need to pour plates with a thinner layer of agar. Bottom agar should have the antibiotics that the host cells are resistant to, but not the antibiotics that the phage genome creates resistance for. For example, if using J100265 cells, bottom agar should have 50ug/mL carbenicillin, but not kanamycin. If host cells are S1030s, bottom agar should also have 10ug/mL tetracycline to select for the F’ plasmid.

2. Make top agar with 7g/L LB agar, 20g/L LB broth, and 1M MgCl2. Autoclave top agar, then transfer in 3mL aliquots to sterile tubes. Incubate in a water bath at 47°C until use. Make certain that the top agar has cooled to 47°C if it’s being used immediately after autoclaving. If top agar is too hot, it will kill host cells and phage.

== Plating Top Agar with Phage and Host Cells ==

1. Grow J100265 S1030 host cells overnight in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline. After overnight growth, dilute the cells in LB broth + 50μg/mL carbenicillin + 10μg/mL tetracycline to an OD600 of between 0.15 and 0.25. Grow up the diluted cells with shaking and incubation at 37°C until they reach log phase (OD600 between 0.4 and 0.6).

2. While cells are growing to log phase, label bottom agar plates and place them in the incubator in a sealed container for 30 minutes to warm them up. If the plates are moist, they can be left with the lids askew in the incubator for 10 minutes to dry out, and then be transferred to a sealed container.

3. Once cells reach log phase, they are ready for plating. Add 200uL of log phase host cells and 10uL of the diluted phage to a tube of top agar. Vortex the top agar for five seconds, then pour the top agar onto a bottom agar plate. Gently tilt the plate back and forth to evenly spread the top agar. Allow each plate to sit upright on the bench for five minutes before inverting. Plate each top agar tube one by one, so that tubes do not cool too much on the bench before pouring.

4. After allowing the plates five minutes on the bench for the top agar to set, invert the plates and put them into a sealed container in a 37°C incubator. Incubate the plates overnight.

== Coring Plaques ==

1. After the plates have incubated for 12-18hrs, remove them from the incubator and inspect them for plaques. Plaques are small (1mm diameter) translucent circles. They are best seen when held up to light.

2. Identify a plate which has plaques that are clearly defined and isolated from one another. Prepare multiple 1.5mL microfuge tubes with 1mL of LB broth. Using an inverted 200uL pipette tip, press down on the agar over a plaque to take out a core of agar. Transfer the core into a prepared microfuge tube. Repeat this step for each microfuge tube. Try to keep this process as sterile as possible- for example, use forceps to remove the pipette tip from the box without grabbing the top, which will come in contact with the core.

3. Save the microfuge tubes at 4°C. The phage in the cores will become suspended in the liquid media.

M13 Bacteriophage Production Protocol

2017-05-17T22:30:41Z

Dymaghini:

M13 Bacteriophage Production Protocol

2017-05-17T22:24:22Z

Dymaghini:

M13 Bacteriophage Production Protocol

2017-05-17T22:16:57Z

Dymaghini:

M13 Bacteriophage Production Protocol

2017-05-17T22:15:20Z

Dymaghini:

M13 Bacteriophage Production Protocol

2017-05-17T22:07:21Z

Dymaghini:

M13 Bacteriophage Production Protocol

2017-05-17T22:03:01Z

Dymaghini:

M13 Bacteriophage Production Protocol

2017-05-17T21:54:38Z

Dymaghini:

== Preparing Phage ==

1. Grow 3mL of cells with phage plasmid in liquid media overnight. These cells will produce M13 phage which can then be isolated. For example, grow J100265 + J100270 S1030 cells in 50ug/mLCarb + 50ug/mL Kan + 10ug/mL Tet for SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube. The phage will remain viable if stored at 4C.

== Preparing Top and Bottom Agar ==

== Plating Top Agar with Phage and Host Cells ==

M13 Bacteriophage Production Protocol

2017-05-17T21:53:32Z

Dymaghini:

1. Grow 3mL of cells with phage plasmid in liquid media overnight. These cells will produce M13 phage which can then be isolated. For example, grow J100265 + J100270 S1030 cells in 50ug/mLCarb + 50ug/mL Kan + 10ug/mL Tet for SPT7-spec phage.

2. Centrifuge 1.5mL of cells at full speed (~15,500 RPM) for at least two minutes. The cells will be spun down into a pellet, while the phage will remain in the supernatant. Save the supernatant in a separate microfuge tube. The phage will remain viable if stored at 4C.

Spin down
Host cells to log phase, after O/N

M13 Bacteriophage Production Protocol

2017-05-15T04:35:56Z

Dymaghini: Created page with "Placeholder: Grow O/N culture Spin down Host cells to log phase, after O/N"

Placeholder:

Grow O/N culture
Spin down
Host cells to log phase, after O/N

Davidson Protocols

2017-05-15T04:34:24Z

Dymaghini:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation - Campbell Old School Method]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]
# [[M13 Bacteriophage Production Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Davidson Protocols

2016-06-09T14:45:21Z

Dymaghini:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Davidson Protocols

2016-06-09T14:44:56Z

Dymaghini:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [[http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

DM Notes 4.7.16

2016-04-07T18:53:33Z

Dymaghini:

Today, went through and found our diff expression scores for all of the genes in the hippo pathway and some in the wnt pathway. Going through and finding functions for each gene and predicting up/down regulation of gene if the snake is fed/organs are growing. Going through and marking genes that support or disagree w/ our hypothesis.

Also looking more into wnt pathway, cytoscape, and how to best convey these #s in a concise way.

Back to home [[Dylan Maghini]]

DM Notes 4.7.16

2016-04-07T17:04:59Z

Dymaghini: Created page with " Back to home Dylan Maghini"

Back to home [[Dylan Maghini]]

Dylan Maghini

2016-04-07T17:04:49Z

Dymaghini:

'''Class Notes'''
[[Group 1 intestines]]

[[Literature summary]]

[[DM Notes 1.12.16]]

[[DM Notes 1.14.16]]

[[DM Notes 1.21.16]]

[[DM Notes 1.26.16]]

[[DM Notes 1.28.16]]

[[DM Notes 2.02.16]]

[[DM Notes 2.04.16]]

[[DM Notes 2.09.16]]

[[DM Notes 2.11.16]]

[[DM Notes 2.16.16]]

[[DM Notes 2.18.16]]

[[DM Notes 2.23.16]]

[[DM Notes 2.25.16]]

[[DM Notes 3.8.16]]

[[DM Notes 3.10.16]]

[[DM Notes 3.17.16]]

[[DM Notes 3.22.16]]

[[DM Notes 3.24.16]]

[[DM Notes 3.31.16]]

[[DM Notes 4.5.16]]

[[DM Notes 4.7.16]]

DM Notes 4.5.16

2016-04-05T18:12:34Z

Dymaghini: Created page with " Back to home Dylan Maghini"

Back to home [[Dylan Maghini]]

Dylan Maghini

2016-04-05T18:11:04Z

Dymaghini:

DM Notes 3.31.16

2016-03-31T18:56:32Z

Dymaghini:

Genes that interact with TEAD3 (hippo):
*STUB1: protein homodimerization, ligase activity. Proteasomal degradation. Misfiled protein binding.
*VGLL4:Transcription cofactor vestigial-like protein 4. Competes with YAP for binding TEADs. Acts as a tumor/growth suppressor, inhibits activity of YAP-TEAD transcriptional complex.
*GTPBP8: GTP binding, ferrous iron transmembrane transporter activity. GTP binding could be significant, it's an energy source in metabolic reactions (specifically for protein synthesis, gluconeogenesis).

Early genes in the pathway:
*STK3: down regulated across the board. Encodes serine/threonin protein kinase, acts as a growth suppressor. "Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis." Involved in the MAPK signaling pathway-- communicates signal from receptor on surface of cell to DNA in nucleus of cell. Defect in MAPK can lead to uncontrolled cell growth. STK3/MST2 and STK4/MST1 are required to repress proliferation of mature hepatocytes, to prevent activation of facultative adult liver stem cells (oval cells), and to inhibit tumor formation
*WWC1: regulates Hippo pathway, not much further info
*NF2: probable regulator of Hippo pathway, production of merlin protein. Merlin controls cell shape, cell movement, communication between cells. Merlin functions as tumor suppressor (prevents cells from growing/dividing too fast).
*Merlin protein: tumor suppressor, found at adherens junctions, associated with contact-mediated growth inhibition.
*FRMD6: human orthologue of Expanded in drosophila. FRMd6 causes increase in phosphorylation of core Hippo signaling pathway LATS1 and YAP. Activates kinase cassette.
*FRMD1 parallel of FRMD1

MAPK pathway: cell proliferation, differentiation, development, transformation, apoptosis.

Back to home [[Dylan Maghini]]

DM Notes 3.31.16

2016-03-31T18:55:13Z

Dymaghini:

Genes that interact with TEAD3 (hippo):
*STUB1: protein homodimerization, ligase activity. Proteasomal degradation. Misfiled protein binding.
*VGLL4:Transcription cofactor vestigial-like protein 4. Competes with YAP for binding TEADs. Acts as a tumor/growth suppressor, inhibits activity of YAP-TEAD transcriptional complex.
*GTPBP8: GTP binding, ferrous iron transmembrane transporter activity. GTP binding could be significant, it's an energy source in metabolic reactions (specifically for protein synthesis, gluconeogenesis).

Early genes in the pathway:
*STK3: down regulated across the board. Encodes serine/threonin protein kinase, acts as a growth suppressor. "Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis." Involved in the MAPK signaling pathway-- communicates signal from receptor on surface of cell to DNA in nucleus of cell. Defect in MAPK can lead to uncontrolled cell growth. STK3/MST2 and STK4/MST1 are required to repress proliferation of mature hepatocytes, to prevent activation of facultative adult liver stem cells (oval cells), and to inhibit tumor formation
*WWC1: regulates Hippo pathway, not much further info
*NF2: probable regulator of Hippo pathway, production of merlin protein. Merlin controls cell shape, cell movement, communication between cells. Merlin functions as tumor suppressor (prevents cells from growing/dividing too fast).
*Merlin protein: tumor suppressor, found at adherens junctions, associated with contact-mediated growth inhibition.
*FRMD6: human orthologue of Expanded in drosophila. FRMd6 causes increase in phosphorylation of core Hippo signaling pathway LATS1 and YAP. Activates kinase cassette.
*FRMD1

MAPK pathway: cell proliferation, differentiation, development, transformation, apoptosis.

Back to home [[Dylan Maghini]]

DM Notes 3.31.16

2016-03-31T18:53:24Z

Dymaghini:

Genes that interact with TEAD3 (hippo):
*STUB1: protein homodimerization, ligase activity. Proteasomal degradation. Misfiled protein binding.
*VGLL4:Transcription cofactor vestigial-like protein 4. Competes with YAP for binding TEADs. Acts as a tumor/growth suppressor, inhibits activity of YAP-TEAD transcriptional complex.
*GTPBP8: GTP binding, ferrous iron transmembrane transporter activity. GTP binding could be significant, it's an energy source in metabolic reactions (specifically for protein synthesis, gluconeogenesis).

Early genes in the pathway:
*STK3: down regulated across the board. Encodes serine/threonin protein kinase, acts as a growth suppressor. "Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis." Involved in the MAPK signaling pathway-- communicates signal from receptor on surface of cell to DNA in nucleus of cell. Defect in MAPK can lead to uncontrolled cell growth. STK3/MST2 and STK4/MST1 are required to repress proliferation of mature hepatocytes, to prevent activation of facultative adult liver stem cells (oval cells), and to inhibit tumor formation
*WWC1: regulates Hippo pathway, not much further info
*NF2: probable regulator of Hippo pathway, production of merlin protein. Merlin controls cell shape, cell movement, communication between cells. Merlin functions as tumor suppressor (prevents cells from growing/dividing too fast).
*Merlin protein: tumor suppressor, found at adherens junctions, associated with contact-mediated growth inhibition.
*FRMD6
*FRMD1

MAPK pathway: cell proliferation, differentiation, development, transformation, apoptosis.

Back to home [[Dylan Maghini]]

DM Notes 3.31.16

2016-03-31T18:44:37Z

Dymaghini:

Genes that interact with TEAD3 (hippo):
*STUB1: protein homodimerization, ligase activity. Proteasomal degradation. Misfiled protein binding.
*VGLL4:Transcription cofactor vestigial-like protein 4. Competes with YAP for binding TEADs. Acts as a tumor/growth suppressor, inhibits activity of YAP-TEAD transcriptional complex.
*GTPBP8: GTP binding, ferrous iron transmembrane transporter activity. GTP binding could be significant, it's an energy source in metabolic reactions (specifically for protein synthesis, gluconeogenesis).

Early genes in the pathway:
*STK3: down regulated across the board. Encodes serine/threonin protein kinase, acts as a growth suppressor. "Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis." Involved in the MAPK signaling pathway-- communicates signal from receptor on surface of cell to DNA in nucleus of cell. Defect in MAPK can lead to uncontrolled cell growth. STK3/MST2 and STK4/MST1 are required to repress proliferation of mature hepatocytes, to prevent activation of facultative adult liver stem cells (oval cells), and to inhibit tumor formation
*WWC1: regulates Hippo pathway, not much further info
*NF2: probable regulator of Hippo pathway,
*FRMD6
*FRMD1

MAPK pathway: cell proliferation, differentiation, development, transformation, apoptosis.

Back to home [[Dylan Maghini]]

DM Notes 3.31.16

2016-03-31T17:56:46Z

Dymaghini:

Genes that interact with TEAD3 (hippo):
*STUB1: protein homodimerization, ligase activity. Proteasomal degradation.
*VGLL4:
*GTPBP8

Back to home [[Dylan Maghini]]

Group 1 intestines

2016-03-31T17:45:00Z

Dymaghini:

Hello

[[Dylan Maghini]]

[[Nick Balanda]]

[[Dustin Atchley]]

[[Housekeeping genes for intestines]]

To do list:
*Approach I
*Approach II- tweak
*Unknown proteins -- not gonna happen
*Other GAFs -- also probably not gonna happen
*missed homo sapiens

Current status:
*Cytoscape representation of Gene Ontology, can filter to find groups of GO terms, see how terms are related, etc. Filter based off of scores that we've given them.
*Approach 1: Have looked at most up-regulated and down-regulated genes, and their functions.

Analysis Modules:
[http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/3%20Analysis%20Modules/]

Group 1 intestines

2016-03-31T17:35:41Z

Dymaghini:

Hello

[[Dylan Maghini]]

[[Nick Balanda]]

[[Dustin Atchley]]

[[Housekeeping genes for intestines]]

To do list:
*Approach I
*Approach II- tweak
*Unknown proteins -- not gonna happen
*Other GAFs -- also probably not gonna happen
*missed homo sapiens

Analysis Modules:
[http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/3%20Analysis%20Modules/]

DM Notes 3.31.16

2016-03-31T16:59:08Z

Dymaghini: Created page with " Back to home Dylan Maghini"

Back to home [[Dylan Maghini]]

Dylan Maghini

2016-03-31T16:58:55Z

Dymaghini:

Group 1 intestines

2016-03-24T18:54:58Z

Dymaghini:

Hello

[[Dylan Maghini]]

[[Nick Balanda]]

[[Dustin Atchley]]

[[Housekeeping genes for intestines]]

To do list:
*Approach I
*Approach II- tweak
*Unknown proteins -- not gonna happen
*Other GAFs -- also not gonna happen
*missed homo sapiens

Analysis Modules:
[http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/3%20Analysis%20Modules/]

DM Notes 3.24.16

2016-03-24T18:17:28Z

Dymaghini:

I'm working on filtering in Cytoscape. Was able to add attributes such that filtering works. GO IDs that don't show up as associated w/ our python genes show up as having 0 interacting genes, so those can be filtered out pretty easily.

Back to home [[Dylan Maghini]]

DM Notes 3.24.16

2016-03-24T17:05:00Z

Dymaghini: Created page with " Back to home Dylan Maghini"

Back to home [[Dylan Maghini]]

Dylan Maghini

2016-03-24T17:04:48Z

Dymaghini:

DM Notes 3.22.16

2016-03-22T18:55:06Z

Dymaghini:

Procured some data for approach 2 and loaded into cytoscape.

We don't have data for a lot of GO IDs, so those are messing up filtering. Need to remove those or give them scores of 0.

Back to home [[Dylan Maghini]]

DM Notes 3.22.16

2016-03-22T17:42:04Z

Dymaghini: Created page with " Back to home Dylan Maghini"

Back to home [[Dylan Maghini]]

Dylan Maghini

2016-03-22T17:41:45Z

Dymaghini: