<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Jolim</id>
		<title>GcatWiki - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Jolim"/>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Special:Contributions/Jolim"/>
		<updated>2026-07-01T15:02:06Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.28.2</generator>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18967</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18967"/>
				<updated>2017-03-23T14:56:17Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Our immediate project: determine what parent-dependent transcription changes exist (in DS and N by themselves), and whether log-fold changes between DS and N are also parent-dependent.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Our five potential genes of interest:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Imprinting, the inheritance of maternal or paternal methylation, will be a huge part of our investigation. Note that paper 2_parent_of_origin reveals that sometimes imprinting doesn't affect transcription at all. This paper also gives great guidelines for searching for imprinting transcription effects. Note that there is a potential for one imprint to regulate transcription in an entire 'imprint-controlled region,' and the authors here used a 4-Mb region (pg 15). While this same paper points out &amp;lt;i&amp;gt;WRB&amp;lt;/i&amp;gt; as an imprinted gene, we won't have epigenome data, only transcriptome data, so that finding isn't relevant.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;What is the critical region of HSA21?&amp;lt;/b&amp;gt; See [www.ds-health.com/trisomy.htm], which states that Robertsonian Translocations between chr21 and chr14 help to narrow down the critical region. In fact, there is a list on that page listing genes with known input...mine references from that page.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Where did the data come from?&amp;lt;br&amp;gt;&lt;br /&gt;
Biological cDNA reads from various sources synthesized from the mRNA transcriptome and tagged with a barcode to label by source; all reads pooled. Reads are demultiplexed by barcodes to sort out the samples. Trimmomatic removes rough edges and barcodes. RSEM maps the reads to ENsembl genes and counts reads. Dustin has preprocessed the data for input to DESeq2.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
02_03: Run DESeq2 comparison between trisomic and disomic, same parent-of-origin. DO THIS SOON SO IT HAS TIME TO RUN.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ts65Dn genetic background&amp;lt;br&amp;gt;&lt;br /&gt;
There are two Ts65Dn strains: 001924 (WT for Pde6b), and 005252 (mut for Pde6b). Pde6b is a protein-coding MMU5 gene, and mutations cause abnormal retinal physiology. Since 005252 is mutant for Pde6b, it is usually bred to C3Sn.BLiA-Pde6b+/DnJ)F1/J (003647) males to eliminate the mutant phenotype. The usual male strain for 001924, however, is B6EiC3SnF1/J (001875).&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ours is 001924, maintained by crossing 1924 females to F1 males, progeny of B6 and C3H. The male sterile phenotype is incompletely penetrant. Each CB# is an embryonic stem cell line, and the P# refers to the passage number. The maternal disomic lines are embryonic stem cells derived from embryos of the same 1924 carrier females, without the 17^16 chromosome. All of the paternal line are embryonic stem cells from embryos in a colony with rare fertile 1924 males. By nature, ES cell lines are XY, and the karyotypes of the cell lines have been monitored for chromosomal aberrations.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt; ESC transcriptome&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;quot;A Meta-analysis&amp;quot; (Assou et al.) -- encompasses (Richards et al), (Li et al. 2006). &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Human - &amp;lt;/b&amp;gt;Great meta-analysis; compiled a list of 1076 genes overexpressed in hESC with three or more references; interestingly only 1 gene was found by all analyses. Published a database listing genes DE in hESC. [http://amazonia.transcriptome.eu/myAmaZonia.php?section=list&amp;amp;zone=StemCells-HESC] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;quot;Transcriptome coexpression&amp;quot; (Li et al 2006) -- &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Human - &amp;lt;/b&amp;gt; Maps chromosomal domains of human ESC and embryoid body transcriptome changes. Only HSA21 DE domain found was in embryoid body, not embryonic stem cells.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;quot;The Transcriptome Profile of Human Embryonic Stem Cells as Defined by SAGE&amp;quot; (Richards et al.) -- &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Human vs mouse - &amp;lt;/b&amp;gt; Introduction references papers showing differences between human and mouse ESCs; the paper might give some new information, too.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;quot;Transcriptome analysis of Mouse Stem Cells and Early Embryos&amp;quot; (Sharov et al) -- &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Mouse - &amp;lt;/b&amp;gt; Contains a figure giving Signature Genes for Specific Groups of Early Embryos and Stem Cells.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;quot;Transcriptome Profiling of Human and Murine ESCs Identifies Divergent Paths Required to Maintain the Stem Cell State&amp;quot; (Wei et al.) -- &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Humans vs mouse - &amp;lt;/b&amp;gt; Compared hESCs and mouse ESCs. Examining Major differences and conserved similarities, found only a small (core) set of genes conserved between humans and mice. Also identified were major differences in leukemia inhibitory factor, transforming growth factor-beta, and Wnt and fibroblast growth factor signaling pathways, as well as the expression of genes encoding metabolic, cytoskeletal, and matrix proteins.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Progress&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
1. Paternal all vs Maternal all (see Emilie Uffman for details)&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
2. Sorted paternal: tri vs di by p-value&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Galaxy &amp;gt; Filter &amp;amp; Sort &amp;gt; Sort (column 6)&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Observation&amp;lt;/b&amp;gt; Some genes have data for base mean, fold change, Wald-Stat data; but p-value and adjusted p-value are NA. These are genes with sample read values detected as outliers by Cook's distance (see [https://bioconductor.org/packages/release/bioc/vignettes/DESeq2/inst/doc/DESeq2.pdf DESeq2 documentation, page 18].&amp;lt;br&amp;gt;&lt;br /&gt;
3. We ignored these data points with outliers using a Galaxy filter.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Output:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Filtering with c6!='NA', kept 69.78% of 99567 valid lines (99567 total lines).Skipped 30091 invalid line(s) &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
NEXT TIME: Use MGI to look up gene names for easier comparison.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
ALSO: Try using DESeq to compare a reduced model (expression ~ condition only) vs a full model (expression ~ condition and parental origin) to find specific effects of parental origin.&amp;lt;br&amp;gt;&lt;br /&gt;
See:&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.bioconductor.org/packages/devel/bioc/vignettes/DESeq/inst/doc/DESeq.pdf Multi-Factor_Designs]&amp;lt;br&amp;gt;&lt;br /&gt;
[https://support.bioconductor.org/p/56948/ comparing_specific_conditions]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Galaxy has tools for displaying gene network associations, looking for correlations with GO terms&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[http://bio.davidson.edu/Courses/Bio343/2017/Galaxy_2013.pdf http://bio.davidson.edu/Courses/Bio343/2017/Galaxy_2013.pdf]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;DeSEQ notes&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Base mean = mean RPKM across all samples&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
log2FC = log(2) of 1st category over 2nd category&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
P-value (not adjusted p-value) is the most relevant value when looking at single genes&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Excel notes&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;left(A1, 18)&amp;lt;/b&amp;gt; - truncate contents of A1 after 18 charinformat&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Pg 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at typical nuclear trios, the neighboring SNP gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Online tools&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.omim.org/ OMIM]&amp;lt;br&amp;gt;&lt;br /&gt;
OMIM can be searched using gene names to find human information.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.genome.jp/kegg/disease/ KEGG Disease database]&amp;lt;br&amp;gt;&lt;br /&gt;
Search this database with protein names from OMIM to find associated diseases. The 'Pathway' field of the disease entry brings up helpful pathway diagrams.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://genome.ucsc.edu/cgi-bin/hgGateway UCSC Genome Browser]&amp;lt;br&amp;gt;&lt;br /&gt;
Human reference genome(s). Consider using a single version for the duration of the project.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
GSEA from the Broad Institute&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;References&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975056/ Court F, Tayama C, Romanelli V, Martin-Trujillo A, Iglesias-Platas I, Okamura K, et al. Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline meth-ylation-independent mechanism of establishment. Genome Res. 2014; 24(4):554–69. doi:10.1101/gr.164913.113PMID:24402520; PubMed Central PMCID: PMCPMC3975056.] &amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3963529/ Docherty LE, Rezwan FI, Poole RL, Jagoe H, Lake H, Lockett GA, et al. Genome-wide DNA methylation anal-ysis of patients with imprinting disorders identifies differentially methylated regions associated with novel can-didate imprinted genes. J Med Genet. 2014; 51(4):229–38. doi:10.1136/jmedgenet-2013-102116PMID:24501229; PubMed Central PMCID: PMCPMC3963529.] &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18959</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18959"/>
				<updated>2017-03-21T14:56:41Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Our immediate project: determine what parent-dependent transcription changes exist (in DS and N by themselves), and whether log-fold changes between DS and N are also parent-dependent.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Our five potential genes of interest:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Imprinting, the inheritance of maternal or paternal methylation, will be a huge part of our investigation. Note that paper 2_parent_of_origin reveals that sometimes imprinting doesn't affect transcription at all. This paper also gives great guidelines for searching for imprinting transcription effects. Note that there is a potential for one imprint to regulate transcription in an entire 'imprint-controlled region,' and the authors here used a 4-Mb region (pg 15). While this same paper points out &amp;lt;i&amp;gt;WRB&amp;lt;/i&amp;gt; as an imprinted gene, we won't have epigenome data, only transcriptome data, so that finding isn't relevant.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;What is the critical region of HSA21?&amp;lt;/b&amp;gt; See [www.ds-health.com/trisomy.htm], which states that Robertsonian Translocations between chr21 and chr14 help to narrow down the critical region. In fact, there is a list on that page listing genes with known input...mine references from that page.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Where did the data come from?&amp;lt;br&amp;gt;&lt;br /&gt;
Biological cDNA reads from various sources synthesized from the mRNA transcriptome and tagged with a barcode to label by source; all reads pooled. Reads are demultiplexed by barcodes to sort out the samples. Trimmomatic removes rough edges and barcodes. RSEM maps the reads to ENsembl genes and counts reads. Dustin has preprocessed the data for input to DESeq2.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
02_03: Run DESeq2 comparison between trisomic and disomic, same parent-of-origin. DO THIS SOON SO IT HAS TIME TO RUN.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ts65Dn genetic background&amp;lt;br&amp;gt;&lt;br /&gt;
There are two Ts65Dn strains: 001924 (WT for Pde6b), and 005252 (mut for Pde6b). Pde6b is a protein-coding MMU5 gene, and mutations cause abnormal retinal physiology. Since 005252 is mutant for Pde6b, it is usually bred to C3Sn.BLiA-Pde6b+/DnJ)F1/J (003647) males to eliminate the mutant phenotype. The usual male strain for 001924, however, is B6EiC3SnF1/J (001875).&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ours is 001924, maintained by crossing 1924 females to F1 males, progeny of B6 and C3H. The male sterile phenotype is incompletely penetrant. Each CB# is an embryonic stem cell line, and the P# refers to the passage number. The maternal disomic lines are embryonic stem cells derived from embryos of the same 1924 carrier females, without the 17^16 chromosome. All of the paternal line are embryonic stem cells from embryos in a colony with rare fertile 1924 males. By nature, ES cell lines are XY, and the karyotypes of the cell lines have been monitored for chromosomal aberrations.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Progress&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
1. Paternal all vs Maternal all (see Emilie Uffman for details)&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
2. Sorted paternal: tri vs di by p-value&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Galaxy &amp;gt; Filter &amp;amp; Sort &amp;gt; Sort (column 6)&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Observation&amp;lt;/b&amp;gt; Some genes have data for base mean, fold change, Wald-Stat data; but p-value and adjusted p-value are NA. These are genes with sample read values detected as outliers by Cook's distance (see [https://bioconductor.org/packages/release/bioc/vignettes/DESeq2/inst/doc/DESeq2.pdf DESeq2 documentation, page 18].&amp;lt;br&amp;gt;&lt;br /&gt;
3. We ignored these data points with outliers using a Galaxy filter.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Output:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Filtering with c6!='NA', kept 69.78% of 99567 valid lines (99567 total lines).Skipped 30091 invalid line(s) &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
NEXT TIME: Use MGI to look up gene names for easier comparison.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
ALSO: Try using DESeq to compare a reduced model (expression ~ condition only) vs a full model (expression ~ condition and parental origin) to find specific effects of parental origin.&amp;lt;br&amp;gt;&lt;br /&gt;
See:&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.bioconductor.org/packages/devel/bioc/vignettes/DESeq/inst/doc/DESeq.pdf Multi-Factor_Designs]&amp;lt;br&amp;gt;&lt;br /&gt;
[https://support.bioconductor.org/p/56948/ comparing_specific_conditions]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Galaxy has tools for displaying gene network associations, looking for correlations with GO terms&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[http://bio.davidson.edu/Courses/Bio343/2017/Galaxy_2013.pdf http://bio.davidson.edu/Courses/Bio343/2017/Galaxy_2013.pdf]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;DeSEQ notes&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Base mean = mean RPKM across all samples&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
log2FC = log(2) of 1st category over 2nd category&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
P-value (not adjusted p-value) is the most relevant value when looking at single genes&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Excel notes&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;left(A1, 18)&amp;lt;/b&amp;gt; - truncate contents of A1 after 18 charinformat&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Pg 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at typical nuclear trios, the neighboring SNP gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Online tools&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.omim.org/ OMIM]&amp;lt;br&amp;gt;&lt;br /&gt;
OMIM can be searched using gene names to find human information.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.genome.jp/kegg/disease/ KEGG Disease database]&amp;lt;br&amp;gt;&lt;br /&gt;
Search this database with protein names from OMIM to find associated diseases. The 'Pathway' field of the disease entry brings up helpful pathway diagrams.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://genome.ucsc.edu/cgi-bin/hgGateway UCSC Genome Browser]&amp;lt;br&amp;gt;&lt;br /&gt;
Human reference genome(s). Consider using a single version for the duration of the project.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
GSEA from the Broad Institute&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;References&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975056/ Court F, Tayama C, Romanelli V, Martin-Trujillo A, Iglesias-Platas I, Okamura K, et al. Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline meth-ylation-independent mechanism of establishment. Genome Res. 2014; 24(4):554–69. doi:10.1101/gr.164913.113PMID:24402520; PubMed Central PMCID: PMCPMC3975056.] &amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3963529/ Docherty LE, Rezwan FI, Poole RL, Jagoe H, Lake H, Lockett GA, et al. Genome-wide DNA methylation anal-ysis of patients with imprinting disorders identifies differentially methylated regions associated with novel can-didate imprinted genes. J Med Genet. 2014; 51(4):229–38. doi:10.1136/jmedgenet-2013-102116PMID:24501229; PubMed Central PMCID: PMCPMC3963529.] &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18870</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18870"/>
				<updated>2017-02-16T12:05:05Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Our immediate project: determine what parent-dependent transcription changes exist (in DS and N by themselves), and whether log-fold changes between DS and N are also parent-dependent.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Our five potential genes of interest:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Imprinting, the inheritance of maternal or paternal methylation, will be a huge part of our investigation. Note that paper 2_parent_of_origin reveals that sometimes imprinting doesn't affect transcription at all. This paper also gives great guidelines for searching for imprinting transcription effects. Note that there is a potential for one imprint to regulate transcription in an entire 'imprint-controlled region,' and the authors here used a 4-Mb region (pg 15). While this same paper points out &amp;lt;i&amp;gt;WRB&amp;lt;/i&amp;gt; as an imprinted gene, we won't have epigenome data, only transcriptome data, so that finding isn't relevant.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;What is the critical region of HSA21?&amp;lt;/b&amp;gt; See [www.ds-health.com/trisomy.htm], which states that Robertsonian Translocations between chr21 and chr14 help to narrow down the critical region. In fact, there is a list on that page listing genes with known input...mine references from that page.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Where did the data come from?&amp;lt;br&amp;gt;&lt;br /&gt;
Biological cDNA reads from various sources synthesized from the mRNA transcriptome and tagged with a barcode to label by source; all reads pooled. Reads are demultiplexed by barcodes to sort out the samples. Trimmomatic removes rough edges and barcodes. RSEM maps the reads to ENsembl genes and counts reads. Dustin has preprocessed the data for input to DESeq2.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
02_03: Run DESeq2 comparison between trisomic and disomic, same parent-of-origin. DO THIS SOON SO IT HAS TIME TO RUN.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ts65Dn genetic background&amp;lt;br&amp;gt;&lt;br /&gt;
There are two Ts65Dn strains: 001924 (WT for Pde6b), and 005252 (mut for Pde6b). Pde6b is a protein-coding MMU5 gene, and mutations cause abnormal retinal physiology. Since 005252 is mutant for Pde6b, it is usually bred to C3Sn.BLiA-Pde6b+/DnJ)F1/J (003647) males to eliminate the mutant phenotype. The usual male strain for 001924, however, is B6EiC3SnF1/J (001875).&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ours is 001924, maintained by crossing 1924 females to F1 males, progeny of B6 and C3H. The male sterile phenotype is incompletely penetrant. Each CB# is an embryonic stem cell line, and the P# refers to the passage number. The maternal disomic lines are embryonic stem cells derived from embryos of the same 1924 carrier females, without the 17^16 chromosome. All of the paternal line are embryonic stem cells from embryos in a colony with rare fertile 1924 males. By nature, ES cell lines are XY, and the karyotypes of the cell lines have been monitored for chromosomal aberrations.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Progress&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
1. Paternal all vs Maternal all (see Emilie Uffman for details)&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
2. Sorted paternal: tri vs di by p-value&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Galaxy &amp;gt; Filter &amp;amp; Sort &amp;gt; Sort (column 6)&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Observation&amp;lt;/b&amp;gt; Some genes have data for base mean, fold change, Wald-Stat data; but p-value and adjusted p-value are NA. These are genes with sample read values detected as outliers by Cook's distance (see [https://bioconductor.org/packages/release/bioc/vignettes/DESeq2/inst/doc/DESeq2.pdf DESeq2 documentation, page 18].&amp;lt;br&amp;gt;&lt;br /&gt;
3. We ignored these data points with outliers using a Galaxy filter.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Output:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Filtering with c6!='NA', kept 69.78% of 99567 valid lines (99567 total lines).Skipped 30091 invalid line(s) &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
NEXT TIME: Use MGI to look up gene names for easier comparison.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
ALSO: Try using DESeq to compare a reduced model (expression ~ condition only) vs a full model (expression ~ condition and parental origin) to find specific effects of parental origin.&amp;lt;br&amp;gt;&lt;br /&gt;
See:&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.bioconductor.org/packages/devel/bioc/vignettes/DESeq/inst/doc/DESeq.pdf Multi-Factor_Designs]&amp;lt;br&amp;gt;&lt;br /&gt;
[https://support.bioconductor.org/p/56948/ comparing_specific_conditions]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Galaxy has tools for displaying gene network associations, looking for correlations with GO terms&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[http://bio.davidson.edu/Courses/Bio343/2017/Galaxy_2013.pdf http://bio.davidson.edu/Courses/Bio343/2017/Galaxy_2013.pdf]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;DeSEQ notes&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Base mean = mean RPKM across all samples&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
log2FC = log(2) of 1st category over 2nd category&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
P-value (not adjusted p-value) is the most relevant value when looking at single genes&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Excel notes&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;left(A1, 18)&amp;lt;/b&amp;gt; - truncate contents of A1 after 18 charinformat&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Pg 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at typical nuclear trios, the neighboring SNP gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Online tools&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.omim.org/ OMIM]&amp;lt;br&amp;gt;&lt;br /&gt;
OMIM can be searched using gene names to find human information.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.genome.jp/kegg/disease/ KEGG Disease database]&amp;lt;br&amp;gt;&lt;br /&gt;
Search this database with protein names from OMIM to find associated diseases. The 'Pathway' field of the disease entry brings up helpful pathway diagrams.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://genome.ucsc.edu/cgi-bin/hgGateway UCSC Genome Browser]&amp;lt;br&amp;gt;&lt;br /&gt;
Human reference genome(s). Consider using a single version for the duration of the project.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;References&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975056/ Court F, Tayama C, Romanelli V, Martin-Trujillo A, Iglesias-Platas I, Okamura K, et al. Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline meth-ylation-independent mechanism of establishment. Genome Res. 2014; 24(4):554–69. doi:10.1101/gr.164913.113PMID:24402520; PubMed Central PMCID: PMCPMC3975056.] &amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3963529/ Docherty LE, Rezwan FI, Poole RL, Jagoe H, Lake H, Lockett GA, et al. Genome-wide DNA methylation anal-ysis of patients with imprinting disorders identifies differentially methylated regions associated with novel can-didate imprinted genes. J Med Genet. 2014; 51(4):229–38. doi:10.1136/jmedgenet-2013-102116PMID:24501229; PubMed Central PMCID: PMCPMC3963529.] &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18846</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18846"/>
				<updated>2017-02-13T18:47:10Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Our immediate project: determine what parent-dependent transcription changes exist (in DS and N by themselves), and whether log-fold changes between DS and N are also parent-dependent.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Our five potential genes of interest:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Imprinting, the inheritance of maternal or paternal methylation, will be a huge part of our investigation. Note that paper 2_parent_of_origin reveals that sometimes imprinting doesn't affect transcription at all. This paper also gives great guidelines for searching for imprinting transcription effects. Note that there is a potential for one imprint to regulate transcription in an entire 'imprint-controlled region,' and the authors here used a 4-Mb region (pg 15). While this same paper points out &amp;lt;i&amp;gt;WRB&amp;lt;/i&amp;gt; as an imprinted gene, we won't have epigenome data, only transcriptome data, so that finding isn't relevant.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;What is the critical region of HSA21?&amp;lt;/b&amp;gt; See [www.ds-health.com/trisomy.htm], which states that Robertsonian Translocations between chr21 and chr14 help to narrow down the critical region. In fact, there is a list on that page listing genes with known input...mine references from that page.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Where did the data come from?&amp;lt;br&amp;gt;&lt;br /&gt;
Biological cDNA reads from various sources synthesized from the mRNA transcriptome and tagged with a barcode to label by source; all reads pooled. Reads are demultiplexed by barcodes to sort out the samples. Trimmomatic removes rough edges and barcodes. RSEM maps the reads to ENsembl genes and counts reads. Dustin has preprocessed the data for input to DESeq2.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
02_03: Run DESeq2 comparison between trisomic and disomic, same parent-of-origin. DO THIS SOON SO IT HAS TIME TO RUN.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ts65Dn genetic background&amp;lt;br&amp;gt;&lt;br /&gt;
There are two Ts65Dn strains: 001924 (WT for Pde6b), and 005252 (mut for Pde6b). Pde6b is a protein-coding MMU5 gene, and mutations cause abnormal retinal physiology. Since 005252 is mutant for Pde6b, it is usually bred to C3Sn.BLiA-Pde6b+/DnJ)F1/J (003647) males to eliminate the mutant phenotype. The usual male strain for 001924, however, is B6EiC3SnF1/J (001875).&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Progress&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
1. Paternal all vs Maternal all (see Emilie Uffman for details)&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
2. Sorted paternal: tri vs di by p-value&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Galaxy &amp;gt; Filter &amp;amp; Sort &amp;gt; Sort (column 6)&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Observation&amp;lt;/b&amp;gt; Some genes have data for base mean, fold change, Wald-Stat data; but p-value and adjusted p-value are NA. These are genes with sample read values detected as outliers by Cook's distance (see [https://bioconductor.org/packages/release/bioc/vignettes/DESeq2/inst/doc/DESeq2.pdf DESeq2 documentation, page 18].&amp;lt;br&amp;gt;&lt;br /&gt;
3. We ignored these data points with outliers using a Galaxy filter.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Output:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Filtering with c6!='NA', kept 69.78% of 99567 valid lines (99567 total lines).Skipped 30091 invalid line(s) &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
NEXT TIME: Use MGI to look up gene names for easier comparison.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
ALSO: Try using DESeq to compare a reduced model (expression ~ condition only) vs a full model (expression ~ condition and parental origin) to find specific effects of parental origin.&amp;lt;br&amp;gt;&lt;br /&gt;
See:&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.bioconductor.org/packages/devel/bioc/vignettes/DESeq/inst/doc/DESeq.pdf Multi-Factor_Designs]&amp;lt;br&amp;gt;&lt;br /&gt;
[https://support.bioconductor.org/p/56948/ comparing_specific_conditions]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Galaxy has tools for displaying gene network associations, looking for correlations with GO terms&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[http://bio.davidson.edu/Courses/Bio343/2017/Galaxy_2013.pdf http://bio.davidson.edu/Courses/Bio343/2017/Galaxy_2013.pdf]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;DeSEQ notes&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Base mean = mean RPKM across all samples&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
log2FC = log(2) of 1st category over 2nd category&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
P-value (not adjusted p-value) is the most relevant value when looking at single genes&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Excel notes&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;left(A1, 18)&amp;lt;/b&amp;gt; - truncate contents of A1 after 18 charinformat&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Pg 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at typical nuclear trios, the neighboring SNP gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Online tools&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.omim.org/ OMIM]&amp;lt;br&amp;gt;&lt;br /&gt;
OMIM can be searched using gene names to find human information.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.genome.jp/kegg/disease/ KEGG Disease database]&amp;lt;br&amp;gt;&lt;br /&gt;
Search this database with protein names from OMIM to find associated diseases. The 'Pathway' field of the disease entry brings up helpful pathway diagrams.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://genome.ucsc.edu/cgi-bin/hgGateway UCSC Genome Browser]&amp;lt;br&amp;gt;&lt;br /&gt;
Human reference genome(s). Consider using a single version for the duration of the project.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;References&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975056/ Court F, Tayama C, Romanelli V, Martin-Trujillo A, Iglesias-Platas I, Okamura K, et al. Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline meth-ylation-independent mechanism of establishment. Genome Res. 2014; 24(4):554–69. doi:10.1101/gr.164913.113PMID:24402520; PubMed Central PMCID: PMCPMC3975056.] &amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3963529/ Docherty LE, Rezwan FI, Poole RL, Jagoe H, Lake H, Lockett GA, et al. Genome-wide DNA methylation anal-ysis of patients with imprinting disorders identifies differentially methylated regions associated with novel can-didate imprinted genes. J Med Genet. 2014; 51(4):229–38. doi:10.1136/jmedgenet-2013-102116PMID:24501229; PubMed Central PMCID: PMCPMC3963529.] &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18816</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18816"/>
				<updated>2017-02-07T15:56:58Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Our immediate project: determine what parent-dependent transcription changes exist (in DS and N by themselves), and whether log-fold changes between DS and N are also parent-dependent.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Our five potential genes of interest:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Imprinting, the inheritance of maternal or paternal methylation, will be a huge part of our investigation. Note that paper 2_parent_of_origin reveals that sometimes imprinting doesn't affect transcription at all. This paper also gives great guidelines for searching for imprinting transcription effects. Note that there is a potential for one imprint to regulate transcription in an entire 'imprint-controlled region,' and the authors here used a 4-Mb region (pg 15). While this same paper points out &amp;lt;i&amp;gt;WRB&amp;lt;/i&amp;gt; as an imprinted gene, we won't have epigenome data, only transcriptome data, so that finding isn't relevant.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;What is the critical region of HSA21?&amp;lt;/b&amp;gt; See [www.ds-health.com/trisomy.htm], which states that Robertsonian Translocations between chr21 and chr14 help to narrow down the critical region. In fact, there is a list on that page listing genes with known input...mine references from that page.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Where did the data come from?&amp;lt;br&amp;gt;&lt;br /&gt;
Biological cDNA reads from various sources synthesized from the mRNA transcriptome and tagged with a barcode to label by source; all reads pooled. Reads are demultiplexed by barcodes to sort out the samples. Trimmomatic removes rough edges and barcodes. RSEM maps the reads to ENsembl genes and counts reads. Dustin has preprocessed the data for input to DESeq2.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
02_03: Run DESeq2 comparison between trisomic and disomic, same parent-of-origin. DO THIS SOON SO IT HAS TIME TO RUN.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ts65Dn genetic background&amp;lt;br&amp;gt;&lt;br /&gt;
There are two Ts65Dn strains: 001924 (WT for Pde6b), and 005252 (mut for Pde6b). Pde6b is a protein-coding MMU5 gene, and mutations cause abnormal retinal physiology. Since 005252 is mutant for Pde6b, it is usually bred to C3Sn.BLiA-Pde6b+/DnJ)F1/J (003647) males to eliminate the mutant phenotype. The usual male strain for 001924, however, is B6EiC3SnF1/J (001875).&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Progress&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
1. Paternal all vs Maternal all (see Emilie Uffman for details)&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
2. Sorted paternal: tri vs di by p-value&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Galaxy &amp;gt; Filter &amp;amp; Sort &amp;gt; Sort (column 6)&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Observation&amp;lt;/b&amp;gt; Some genes have data for base mean, fold change, Wald-Stat data; but p-value and adjusted p-value are NA. These are genes with sample read values detected as outliers by Cook's distance (see [https://bioconductor.org/packages/release/bioc/vignettes/DESeq2/inst/doc/DESeq2.pdf DESeq2 documentation, page 18].&amp;lt;br&amp;gt;&lt;br /&gt;
3. We ignored these data points with outliers using a Galaxy filter.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Output:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Filtering with c6!='NA', kept 69.78% of 99567 valid lines (99567 total lines).Skipped 30091 invalid line(s) &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
NEXT TIME: Use MGI to look up gene names for easier comparison.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Galaxy has tools for displaying gene network associations, looking for correlations with GO terms&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[http://bio.davidson.edu/Courses/Bio343/2017/Galaxy_2013.pdf http://bio.davidson.edu/Courses/Bio343/2017/Galaxy_2013.pdf]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;DeSEQ notes&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Base mean = mean RPKM across all samples&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
log2FC = log(2) of 1st category over 2nd category&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
P-value (not adjusted p-value) is the most relevant value when looking at single genes&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Excel notes&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;left(A1, 18)&amp;lt;/b&amp;gt; - truncate contents of A1 after 18 charinformat&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Pg 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at typical nuclear trios, the neighboring SNP gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Online tools&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.omim.org/ OMIM]&amp;lt;br&amp;gt;&lt;br /&gt;
OMIM can be searched using gene names to find human information.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.genome.jp/kegg/disease/ KEGG Disease database]&amp;lt;br&amp;gt;&lt;br /&gt;
Search this database with protein names from OMIM to find associated diseases. The 'Pathway' field of the disease entry brings up helpful pathway diagrams.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://genome.ucsc.edu/cgi-bin/hgGateway UCSC Genome Browser]&amp;lt;br&amp;gt;&lt;br /&gt;
Human reference genome(s). Consider using a single version for the duration of the project.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;References&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975056/ Court F, Tayama C, Romanelli V, Martin-Trujillo A, Iglesias-Platas I, Okamura K, et al. Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline meth-ylation-independent mechanism of establishment. Genome Res. 2014; 24(4):554–69. doi:10.1101/gr.164913.113PMID:24402520; PubMed Central PMCID: PMCPMC3975056.] &amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3963529/ Docherty LE, Rezwan FI, Poole RL, Jagoe H, Lake H, Lockett GA, et al. Genome-wide DNA methylation anal-ysis of patients with imprinting disorders identifies differentially methylated regions associated with novel can-didate imprinted genes. J Med Genet. 2014; 51(4):229–38. doi:10.1136/jmedgenet-2013-102116PMID:24501229; PubMed Central PMCID: PMCPMC3963529.] &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18800</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18800"/>
				<updated>2017-02-02T15:54:37Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Our immediate project: determine what parent-dependent transcription changes exist (in DS and N by themselves), and whether log-fold changes between DS and N are also parent-dependent.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Our five potential genes of interest:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Imprinting, the inheritance of maternal or paternal methylation, will be a huge part of our investigation. Note that paper 2_parent_of_origin reveals that sometimes imprinting doesn't affect transcription at all. This paper also gives great guidelines for searching for imprinting transcription effects. Note that there is a potential for one imprint to regulate transcription in an entire 'imprint-controlled region,' and the authors here used a 4-Mb region (pg 15). While this same paper points out &amp;lt;i&amp;gt;WRB&amp;lt;/i&amp;gt; as an imprinted gene, we won't have epigenome data, only transcriptome data, so that finding isn't relevant.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;What is the critical region of HSA21?&amp;lt;/b&amp;gt; See [www.ds-health.com/trisomy.htm], which states that Robertsonian Translocations between chr21 and chr14 help to narrow down the critical region. In fact, there is a list on that page listing genes with known input...mine references from that page.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Where did the data come from?&amp;lt;br&amp;gt;&lt;br /&gt;
Biological cDNA reads from various sources synthesized from the mRNA transcriptome and tagged with a barcode to label by source; all reads pooled. Reads are demultiplexed by barcodes to sort out the samples. Trimmomatic removes rough edges and barcodes. RSEM maps the reads to ENsembl genes and counts reads. Dustin has preprocessed the data for input to DESeq2.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
02_03: Run DESeq2 comparison between trisomic and disomic, same parent-of-origin. DO THIS SOON SO IT HAS TIME TO RUN.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Ts65Dn genetic background&amp;lt;br&amp;gt;&lt;br /&gt;
There are two Ts65Dn strains: 001924 (WT for Pde6b), and 005252 (mut for Pde6b). Pde6b is a protein-coding MMU5 gene, and mutations cause abnormal retinal physiology. Since 005252 is mutant for Pde6b, it is usually bred to C3Sn.BLiA-Pde6b+/DnJ)F1/J (003647) males to eliminate the mutant phenotype. The usual male strain for 001924, however, is B6EiC3SnF1/J (001875).&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Pg 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at typical nuclear trios, the neighboring SNP gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Online tools&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.omim.org/ OMIM]&amp;lt;br&amp;gt;&lt;br /&gt;
OMIM can be searched using gene names to find human information.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.genome.jp/kegg/disease/ KEGG Disease database]&amp;lt;br&amp;gt;&lt;br /&gt;
Search this database with protein names from OMIM to find associated diseases. The 'Pathway' field of the disease entry brings up helpful pathway diagrams.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://genome.ucsc.edu/cgi-bin/hgGateway UCSC Genome Browser]&amp;lt;br&amp;gt;&lt;br /&gt;
Human reference genome(s). Consider using a single version for the duration of the project.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;References&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975056/ Court F, Tayama C, Romanelli V, Martin-Trujillo A, Iglesias-Platas I, Okamura K, et al. Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline meth-ylation-independent mechanism of establishment. Genome Res. 2014; 24(4):554–69. doi:10.1101/gr.164913.113PMID:24402520; PubMed Central PMCID: PMCPMC3975056.] &amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3963529/ Docherty LE, Rezwan FI, Poole RL, Jagoe H, Lake H, Lockett GA, et al. Genome-wide DNA methylation anal-ysis of patients with imprinting disorders identifies differentially methylated regions associated with novel can-didate imprinted genes. J Med Genet. 2014; 51(4):229–38. doi:10.1136/jmedgenet-2013-102116PMID:24501229; PubMed Central PMCID: PMCPMC3963529.] &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18794</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18794"/>
				<updated>2017-01-31T15:56:51Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Our immediate project: determine what parent-dependent transcription changes exist (in DS and N by themselves), and whether log-fold changes between DS and N are also parent-dependent.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Our five potential genes of interest:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Imprinting, the inheritance of maternal or paternal methylation, will be a huge part of our investigation. Note that paper 2_parent_of_origin reveals that sometimes imprinting doesn't affect transcription at all. This paper also gives great guidelines for searching for imprinting transcription effects. Note that there is a potential for one imprint to regulate transcription in an entire 'imprint-controlled region,' and the authors here used a 4-Mb region (pg 15). While this same paper points out &amp;lt;i&amp;gt;WRB&amp;lt;/i&amp;gt; as an imprinted gene, we won't have epigenome data, only transcriptome data, so that finding isn't relevant.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;What is the critical region of HSA21?&amp;lt;/b&amp;gt; See [www.ds-health.com/trisomy.htm], which states that Robertsonian Translocations between chr21 and chr14 help to narrow down the critical region. In fact, there is a list on that page listing genes with known input...mine references from that page.&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Pg 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at typical nuclear trios, the neighboring SNP gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Online tools&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.omim.org/ OMIM]&amp;lt;br&amp;gt;&lt;br /&gt;
OMIM can be searched using gene names to find human information.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.genome.jp/kegg/disease/ KEGG Disease database]&amp;lt;br&amp;gt;&lt;br /&gt;
Search this database with protein names from OMIM to find associated diseases. The 'Pathway' field of the disease entry brings up helpful pathway diagrams.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://genome.ucsc.edu/cgi-bin/hgGateway UCSC Genome Browser]&amp;lt;br&amp;gt;&lt;br /&gt;
Human reference genome(s). Consider using a single version for the duration of the project.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;References&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975056/ Court F, Tayama C, Romanelli V, Martin-Trujillo A, Iglesias-Platas I, Okamura K, et al. Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline meth-ylation-independent mechanism of establishment. Genome Res. 2014; 24(4):554–69. doi:10.1101/gr.164913.113PMID:24402520; PubMed Central PMCID: PMCPMC3975056.] &amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3963529/ Docherty LE, Rezwan FI, Poole RL, Jagoe H, Lake H, Lockett GA, et al. Genome-wide DNA methylation anal-ysis of patients with imprinting disorders identifies differentially methylated regions associated with novel can-didate imprinted genes. J Med Genet. 2014; 51(4):229–38. doi:10.1136/jmedgenet-2013-102116PMID:24501229; PubMed Central PMCID: PMCPMC3963529.] &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18787</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18787"/>
				<updated>2017-01-26T15:56:21Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Our immediate project: determine what parent-dependent transcription changes exist (in DS and N by themselves), and whether log-fold changes between DS and N are also parent-dependent.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;b&amp;gt;Our five potential genes of interest:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Imprinting, the inheritance of maternal or paternal methylation, will be a huge part of our investigation. Note that paper 2_parent_of_origin reveals that sometimes imprinting doesn't affect transcription at all. This paper also gives great guidelines for searching for imprinting transcription effects. Note that there is a potential for one imprint to regulate transcription in an entire 'imprint-controlled region,' and the authors here used a 4-Mb region (pg 15). While this same paper points out &amp;lt;i&amp;gt;WRB&amp;lt;/i&amp;gt; as an imprinted gene, we won't have epigenome data, only transcriptome data, so that finding isn't relevant.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Pg 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at typical nuclear trios, the neighboring SNP gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Online tools&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.omim.org/ OMIM]&amp;lt;br&amp;gt;&lt;br /&gt;
OMIM can be searched using gene names to find human information.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.genome.jp/kegg/disease/ KEGG Disease database]&amp;lt;br&amp;gt;&lt;br /&gt;
Search this database with protein names from OMIM to find associated diseases. The 'Pathway' field of the disease entry brings up helpful pathway diagrams.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://genome.ucsc.edu/cgi-bin/hgGateway UCSC Genome Browser]&amp;lt;br&amp;gt;&lt;br /&gt;
Human reference genome(s). Consider using a single version for the duration of the project.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;References&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975056/ Court F, Tayama C, Romanelli V, Martin-Trujillo A, Iglesias-Platas I, Okamura K, et al. Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline meth-ylation-independent mechanism of establishment. Genome Res. 2014; 24(4):554–69. doi:10.1101/gr.164913.113PMID:24402520; PubMed Central PMCID: PMCPMC3975056.] &amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3963529/ Docherty LE, Rezwan FI, Poole RL, Jagoe H, Lake H, Lockett GA, et al. Genome-wide DNA methylation anal-ysis of patients with imprinting disorders identifies differentially methylated regions associated with novel can-didate imprinted genes. J Med Genet. 2014; 51(4):229–38. doi:10.1136/jmedgenet-2013-102116PMID:24501229; PubMed Central PMCID: PMCPMC3963529.] &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18785</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18785"/>
				<updated>2017-01-26T15:54:06Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Class, 01/26&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Our five genes of interest:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Imprinting, the inheritance of maternal or paternal methylation, will be a huge part of our investigation. Note that paper 2_parent_of_origin reveals that sometimes imprinting doesn't affect transcription at all. This paper also gives great guidelines for searching for imprinting transcription effects. Note that there is a potential for one imprint to regulate transcription in an entire 'imprint-controlled region,' and the authors here used a 4-Mb region (pg 15). While this same paper points out &amp;lt;i&amp;gt;WRB&amp;lt;/i&amp;gt; as an imprinted gene, we won't have epigenome data, only transcriptome data, so that finding isn't relevant.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Pg 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at typical nuclear trios, the neighboring SNP gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Online tools&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.omim.org/ OMIM]&amp;lt;br&amp;gt;&lt;br /&gt;
OMIM can be searched using gene names to find human information.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.genome.jp/kegg/disease/ KEGG Disease database]&amp;lt;br&amp;gt;&lt;br /&gt;
Search this database with protein names from OMIM to find associated diseases. The 'Pathway' field of the disease entry brings up helpful pathway diagrams.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://genome.ucsc.edu/cgi-bin/hgGateway UCSC Genome Browser]&amp;lt;br&amp;gt;&lt;br /&gt;
Human reference genome(s). Consider using a single version for the duration of the project.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;References&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975056/ Court F, Tayama C, Romanelli V, Martin-Trujillo A, Iglesias-Platas I, Okamura K, et al. Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline meth-ylation-independent mechanism of establishment. Genome Res. 2014; 24(4):554–69. doi:10.1101/gr.164913.113PMID:24402520; PubMed Central PMCID: PMCPMC3975056.] &amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3963529/ Docherty LE, Rezwan FI, Poole RL, Jagoe H, Lake H, Lockett GA, et al. Genome-wide DNA methylation anal-ysis of patients with imprinting disorders identifies differentially methylated regions associated with novel can-didate imprinted genes. J Med Genet. 2014; 51(4):229–38. doi:10.1136/jmedgenet-2013-102116PMID:24501229; PubMed Central PMCID: PMCPMC3963529.] &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18784</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18784"/>
				<updated>2017-01-26T15:51:54Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Our five genes of interest:&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Imprinting, the inheritance of maternal or paternal methylation, will be a huge part of our investigation. Note that paper 2_parent_of_origin reveals that sometimes imprinting doesn't affect transcription at all. This paper also gives great guidelines for searching for imprinting transcription effects. Note that there is a potential for one imprint to regulate transcription in an entire 'imprint-controlled region,' and the authors here used a 4-Mb region (pg 15). While this same paper points out &amp;lt;i&amp;gt;WRB&amp;lt;/i&amp;gt; as an imprinted gene, we won't have epigenome data, only transcriptome data, so that finding isn't relevant.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Pg 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at typical nuclear trios, the neighboring SNP gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;Online tools&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.omim.org/ OMIM]&amp;lt;br&amp;gt;&lt;br /&gt;
OMIM can be searched using gene names to find human information.&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.genome.jp/kegg/disease/ KEGG Disease database]&amp;lt;br&amp;gt;&lt;br /&gt;
Search this database with protein names from OMIM to find associated diseases. The 'Pathway' field of the disease entry brings up helpful pathway diagrams.&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;b&amp;gt;References&amp;lt;/b&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975056/ Court F, Tayama C, Romanelli V, Martin-Trujillo A, Iglesias-Platas I, Okamura K, et al. Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline meth-ylation-independent mechanism of establishment. Genome Res. 2014; 24(4):554–69. doi:10.1101/gr.164913.113PMID:24402520; PubMed Central PMCID: PMCPMC3975056.] &amp;lt;br&amp;gt;&lt;br /&gt;
[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3963529/ Docherty LE, Rezwan FI, Poole RL, Jagoe H, Lake H, Lockett GA, et al. Genome-wide DNA methylation anal-ysis of patients with imprinting disorders identifies differentially methylated regions associated with novel can-didate imprinted genes. J Med Genet. 2014; 51(4):229–38. doi:10.1136/jmedgenet-2013-102116PMID:24501229; PubMed Central PMCID: PMCPMC3963529.] &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18772</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18772"/>
				<updated>2017-01-24T15:55:31Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;u&amp;gt;Our five genes of interest:&amp;lt;/u&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Pg 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at typical nuclear trios, the neighboring SNP gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18758</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18758"/>
				<updated>2017-01-24T04:15:42Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;u&amp;gt;Our five genes of interest:&amp;lt;/u&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
HLCS&amp;lt;br&amp;gt;&lt;br /&gt;
HMGN1&amp;lt;br&amp;gt;&lt;br /&gt;
DYRK1A&amp;lt;br&amp;gt;&lt;br /&gt;
BRWD1&amp;lt;br&amp;gt;&lt;br /&gt;
RUNX1&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
Vocabulary/Background for 'Trisomy 21 alters DNA Methylation in Parent-of-Origin-Dependent and Independent manners'&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Goals&amp;lt;br&amp;gt;&lt;br /&gt;
1. Find a high-certainty method of ascertaining parent-of-origin of HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
2. Explore parent-of-origin effects on gene expression&amp;lt;br&amp;gt;&lt;br /&gt;
3. Evaluate parent-of-origin effects on methylation of RUNX1 (HSA21) and TMEM131 (HSA2), known to be differentially regulated in Trisomy 21.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
INTRO&amp;lt;br&amp;gt;&lt;br /&gt;
Since Down Syndrome mainly caused by maternal nondisjunction during oogenesis, cases of paternal inheritance are rare, difficult to study. Trying to determine what the parent-of-origin effect is.&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Genomic imprinting - inherited gene silencing, mediated by DNa or histone methylation&amp;lt;br&amp;gt;&lt;br /&gt;
Not sure why the authors bring up uniparental disomy (both copies of a chromosome from one parent)...shares some similarity with DS, but more likely to suffer from recessive disorders / total gene silencing than a dosage effect. Is this the androgenetic mole used as a control later?&amp;lt;br&amp;gt;&lt;br /&gt;
Authors argue that imprinting may cause parent-of-origin-dependent effects of nondisjoined HSA21&amp;lt;br&amp;gt;&lt;br /&gt;
CpG - possible methylation site&amp;lt;br&amp;gt;&lt;br /&gt;
STR - short tandem repeats&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
RESULTS&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
First, notice methylation profile of CGIs. CGIs 2, 3, 5 are differentially methylated in male and female gametes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 2 - exp. validation: no methylation for WRB CGI-1 and 3 when looking at HhaI(+) readout.contrast with wRB CGI-2, which was previously reported to be methylated in blood cells.&amp;lt;br&amp;gt;&lt;br /&gt;
Page 10: Looking at healthy disomic subjects, the snp neighboring CGI-2 gives the known parental identity of the chromosome. Authors found that maternal HSA21 was consistently methylated at CGI-2, and paternal HSA21 unmethylated. This matches with the known differential methylation in the gametes (imprinting?).&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 3 - Looking at trisomic probands, the neighboring STR gives parent-of-origin of the chromosome. The developed assay shows conclusively that methylation is 1:1 with parent-of-origin. HhaI digests unmethylated DNA, leaving behind maternal allele. McrBC digests methylated DNA, leaving behind paternal allele. Conclusion: imprinting on maternal chromosomes.&amp;lt;br&amp;gt;&lt;br /&gt;
Fig. 6A-B Unlike at the WRB CGI-2 DMR, RUNX1 and TMEME131 methylation changes in Trisomy 21 probands were NOT PARENT-DEPENDENT.&amp;lt;br&amp;gt;&lt;br /&gt;
Pgs 14-16: no evidence that the WRB DMR imprinting effects changes in gene expression (evidenced by biallelic mRNA reads for all neighboring SNPs that had available data.&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18748</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18748"/>
				<updated>2017-01-20T02:29:24Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
Below is a test photo of horizontal lines&lt;br /&gt;
&lt;br /&gt;
[[File:test_lines.png|300px]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Test_lines.png&amp;diff=18747</id>
		<title>File:Test lines.png</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Test_lines.png&amp;diff=18747"/>
				<updated>2017-01-20T02:28:18Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18746</id>
		<title>Jon Lim</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Jon_Lim&amp;diff=18746"/>
				<updated>2017-01-20T02:27:58Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Jon Lim's scratchpad&lt;br /&gt;
----&lt;br /&gt;
My notes will go here&lt;br /&gt;
&lt;br /&gt;
[[File:test_lines.png|300px]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-agar-figure.png&amp;diff=17606</id>
		<title>File:Jon-caffeine-growth-in-agar-figure.png</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-agar-figure.png&amp;diff=17606"/>
				<updated>2014-08-19T18:50:43Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: On tetracycline plates, the number of colony forming units that appear is dependent on the concentration of caffeine provided. Programmed cells form colonies at 4mM caffeine or less.&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;On tetracycline plates, the number of colony forming units that appear is dependent on the concentration of caffeine provided. Programmed cells form colonies at 4mM caffeine or less.&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17605</id>
		<title>Optimal caffeine concentration on plates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17605"/>
				<updated>2014-08-19T18:47:48Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Overview==&lt;br /&gt;
Before strains with the tetracycline-theophylline fitness module can be grown in broth, we need to know how much caffeine the cells need, to produce an amount of theophylline that grants survival. [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.pptx Previous experimentation] shows that colonies on plates are able to grow in a ring around caffeine-soaked disks, leading to my hypothesis that there is an &amp;lt;b&amp;gt;optimal range of caffeine&amp;lt;/b&amp;gt; in which cells can survive. Too much caffeine or too little caffeine prevents cells from growing. However, we do not know whether cells growing in broth require the same concentration of caffeine as cells growing in plates. This experiment was designed to determine the concentration required by cells growing on plates, specifically pertaining to JM109 strains #12 and #23, [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.xlsx#file which have been demonstrated] to be the most competent clones on agar plates.&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
Prepare 80-mL batches of LB agar with incremental dilutions of caffeine from 0 mM to 10 mM. (This range was guessed based on a model of caffeine diffusion created by Morgan Spencer.)&lt;br /&gt;
The agar-caffeine dilutions should have 20 μg/mL tetracycline and 0.5 mg/mL L-arabinose. The negative control should contain no caffeine. The first positive control should have 4 mM theophylline and the second positive control should have no tetracycline. See the below table for details.&lt;br /&gt;
&lt;br /&gt;
Add anhydrous caffeine and anhydrous theophylline to the respective agar batches before autoclaving. Add tetracycline and L-arabinose from liquid stocks after autoclaving and cooling to below 60°.&lt;br /&gt;
								&lt;br /&gt;
&amp;lt;table class=&amp;quot;tableizer-table&amp;quot;&amp;gt;&lt;br /&gt;
&amp;lt;tr class=&amp;quot;tableizer-firstrow&amp;quot;&amp;gt;&amp;lt;th&amp;gt;#&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tetracycline (&amp;amp;#956;g/mL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tet (uL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theophylline (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theo (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caffeine (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caff (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;L-arabinose (uL)&amp;lt;/th&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;1&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;2&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;1&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.016&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;3&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;2&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.031&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;3&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.047&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.062&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;6&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.078&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;7&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;6&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.093&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;8&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;7&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.109&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;9&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;8&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.124&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;9&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.140&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;11&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.155&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;12&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.058&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;13&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Pour the agar dilutions into 60-mm plates. Flip plates after 3 hours and let dry for two days.&lt;br /&gt;
&lt;br /&gt;
Incubate LB broth cultures of clones #12 and 23 overnight at 37°, with 0.5 mG/mL L-arabinose and either amp or amp+chlor. Clones with a chaperone require chloramphenicol to prevent curing.&lt;br /&gt;
&lt;br /&gt;
Measure A590. Combine the clones and dilute with LB broth so that each is at 0.025 OD.&lt;br /&gt;
For each caffeine dilution, put 5-8 plating beads onto the plate and pipette 20 uL cells on top. Swirl beads carefully without the lid, discard beads, and replace lid. Store plates inverted.&lt;br /&gt;
&lt;br /&gt;
Incubate all plates at 37° overnight. Let grow for 2 days at RT. Inspect daily for growth.&lt;br /&gt;
&lt;br /&gt;
==Data==&lt;br /&gt;
&lt;br /&gt;
[[File:jon-caffeine-growth-in-agar-figure.png|frameless|500px|The number of CFU's is dependent on the concentration of caffeine provided to E. coli transformed with the tetracycline fitness module.]]&lt;br /&gt;
[[Media:Optimal-caffeine-on-plates-design-data-figure.xlsx]]&lt;br /&gt;
&lt;br /&gt;
==See also==&lt;br /&gt;
&lt;br /&gt;
[[Extending theophylline application]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17604</id>
		<title>File:Jon-caffeine-growth-in-broth-figure.png</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17604"/>
				<updated>2014-08-19T18:45:18Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Jolim uploaded a new version of &amp;amp;quot;File:Jon-caffeine-growth-in-broth-figure.png&amp;amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Summer_2014_SynBio_Project_(Davidson_and_MWSU)&amp;diff=17575</id>
		<title>Summer 2014 SynBio Project (Davidson and MWSU)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Summer_2014_SynBio_Project_(Davidson_and_MWSU)&amp;diff=17575"/>
				<updated>2014-07-23T15:25:49Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: /* Final Presentations at End of Summer */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;=== Final Presentations at End of Summer ===&lt;br /&gt;
* [[File:Math wrap-up.pptx]]&lt;br /&gt;
* [[File:Joint_planning_-_Liquid_Broth.pptx]] &lt;br /&gt;
* [[fitness genes]]&lt;br /&gt;
* [[tClone/ammeline]]&lt;br /&gt;
&lt;br /&gt;
=== Presentations during MWSU visit to Davidson ===&lt;br /&gt;
&lt;br /&gt;
Central Dogma presentation [[File:Central_dogma.pptx]]&lt;br /&gt;
&lt;br /&gt;
PCR presentation [[File:PCR.pptx]]&lt;br /&gt;
&lt;br /&gt;
Cloning presentation [[File:Cloning.pptx]]&lt;br /&gt;
&lt;br /&gt;
Riboswitch presentation [[File:Riboswitch_function.pptx]]&lt;br /&gt;
&lt;br /&gt;
Agent based modeling presentation [[File:AgentBased_Modeling.pptx]]&lt;br /&gt;
&lt;br /&gt;
Competition presentation [[File:Competition_Modeling.xlsx]]&lt;br /&gt;
&lt;br /&gt;
Programmed evolution presentation [[File:Programmed_Evolution.pdf]]&lt;br /&gt;
&lt;br /&gt;
Caffeine results [[File:Caffeine_Disk.pptx]]&lt;br /&gt;
&lt;br /&gt;
Ammeline presentation [[File:Ammeline.pptx]]&lt;br /&gt;
&lt;br /&gt;
Repressilator modeling exercises [[File:repressilator_modeling.docx]]&lt;br /&gt;
&lt;br /&gt;
Repressilator modeling Excel file [[File:Repressilator_model.xls]]&lt;br /&gt;
&lt;br /&gt;
Repressilator modeling Netlogo file [[File:Repressilator_mod.nlogo.zip]]&lt;br /&gt;
&lt;br /&gt;
=== Biology Files ===&lt;br /&gt;
&lt;br /&gt;
Chaperone plasmid DNA sequences [[File:Chaperone_plasmid_DNA_sequences.docx]]&lt;br /&gt;
&lt;br /&gt;
Origin PCR Gels 5-26-14[[File:5-26-14 Orig PCR Elecpho Gel Pic.doc]]&lt;br /&gt;
&lt;br /&gt;
Chaperone PCR and Repeat Origin PCR 5-27-14[[File:5-27-14_Chap_PCR_and_Repeat_Ori_PCR.doc]]&lt;br /&gt;
&lt;br /&gt;
Chaperone PCR of original clones 5-27-14[[File:5-27-14_chaperone_pcr_clones_1-24.doc]]&lt;br /&gt;
&lt;br /&gt;
Origin PCR of original clones 5-27-14[[File:5-27-14 Ori PCR 1-24.doc ]]&lt;br /&gt;
&lt;br /&gt;
New Chap PCR clones 1-5[[File:5-28-14_New_Chap_PCR_1-5.doc ]]&lt;br /&gt;
&lt;br /&gt;
Combinations Labeling System  [[File:Labeling.xlsx]]&lt;br /&gt;
&lt;br /&gt;
ThyA Fitness Module [[File:ThyA fitness module.docx]]&lt;br /&gt;
&lt;br /&gt;
Alternative Riboswitches[[File:Alternative Riboswitches.docx]]&lt;br /&gt;
&lt;br /&gt;
Origin PCR Pictures 6-5-14 [[File:6-5-14 Origin PCR.docx]]&lt;br /&gt;
&lt;br /&gt;
Chaperone PCR PA 6-5-14 [[File:6-5-14 Chaperone PCR.docx]]&lt;br /&gt;
&lt;br /&gt;
Broth Growth Experiments  [[File:Broth Growth Experiment Reports Revised.docx]]&lt;br /&gt;
===Sub-pages on various topics===&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''&lt;br /&gt;
[[MATH]]&lt;br /&gt;
'''&lt;br /&gt;
&lt;br /&gt;
[[Catherine Doyle Thesis Materials]]&lt;br /&gt;
&lt;br /&gt;
[[Repeating 20 Clone Experiments]]&lt;br /&gt;
&lt;br /&gt;
[[Extending theophylline application]]&lt;br /&gt;
&lt;br /&gt;
[[Melamine iteration]]&lt;br /&gt;
&lt;br /&gt;
[[Ramping up Programmed Evolution]]&lt;br /&gt;
&lt;br /&gt;
[[Rational Design of Riboswitches: papers to read]]&lt;br /&gt;
&lt;br /&gt;
[[ThyA Fitness Module]]&lt;br /&gt;
&lt;br /&gt;
[[Caffeine Disk Replication Data]]&lt;br /&gt;
&lt;br /&gt;
=== Programmed Evolution Paper ===&lt;br /&gt;
&lt;br /&gt;
[[References]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Joint_planning_-_Liquid_Broth.pptx&amp;diff=17572</id>
		<title>File:Joint planning - Liquid Broth.pptx</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Joint_planning_-_Liquid_Broth.pptx&amp;diff=17572"/>
				<updated>2014-07-23T15:23:11Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Summer_2014_SynBio_Project_(Davidson_and_MWSU)&amp;diff=17571</id>
		<title>Summer 2014 SynBio Project (Davidson and MWSU)</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Summer_2014_SynBio_Project_(Davidson_and_MWSU)&amp;diff=17571"/>
				<updated>2014-07-23T15:22:15Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: /* Added &amp;quot;Liquid Broth&amp;quot; PPTX */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;=== Final Presentations at End of Summer ===&lt;br /&gt;
* [[math summary]]&lt;br /&gt;
* [[File:Liquid Broth.pptx]] &lt;br /&gt;
* [[fitness genes]]&lt;br /&gt;
* [[tClone/ammeline]]&lt;br /&gt;
&lt;br /&gt;
=== Presentations during MWSU visit to Davidson ===&lt;br /&gt;
&lt;br /&gt;
Central Dogma presentation [[File:Central_dogma.pptx]]&lt;br /&gt;
&lt;br /&gt;
PCR presentation [[File:PCR.pptx]]&lt;br /&gt;
&lt;br /&gt;
Cloning presentation [[File:Cloning.pptx]]&lt;br /&gt;
&lt;br /&gt;
Riboswitch presentation [[File:Riboswitch_function.pptx]]&lt;br /&gt;
&lt;br /&gt;
Agent based modeling presentation [[File:AgentBased_Modeling.pptx]]&lt;br /&gt;
&lt;br /&gt;
Competition presentation [[File:Competition_Modeling.xlsx]]&lt;br /&gt;
&lt;br /&gt;
Programmed evolution presentation [[File:Programmed_Evolution.pdf]]&lt;br /&gt;
&lt;br /&gt;
Caffeine results [[File:Caffeine_Disk.pptx]]&lt;br /&gt;
&lt;br /&gt;
Ammeline presentation [[File:Ammeline.pptx]]&lt;br /&gt;
&lt;br /&gt;
Repressilator modeling exercises [[File:repressilator_modeling.docx]]&lt;br /&gt;
&lt;br /&gt;
Repressilator modeling Excel file [[File:Repressilator_model.xls]]&lt;br /&gt;
&lt;br /&gt;
Repressilator modeling Netlogo file [[File:Repressilator_mod.nlogo.zip]]&lt;br /&gt;
&lt;br /&gt;
=== Biology Files ===&lt;br /&gt;
&lt;br /&gt;
Chaperone plasmid DNA sequences [[File:Chaperone_plasmid_DNA_sequences.docx]]&lt;br /&gt;
&lt;br /&gt;
Origin PCR Gels 5-26-14[[File:5-26-14 Orig PCR Elecpho Gel Pic.doc]]&lt;br /&gt;
&lt;br /&gt;
Chaperone PCR and Repeat Origin PCR 5-27-14[[File:5-27-14_Chap_PCR_and_Repeat_Ori_PCR.doc]]&lt;br /&gt;
&lt;br /&gt;
Chaperone PCR of original clones 5-27-14[[File:5-27-14_chaperone_pcr_clones_1-24.doc]]&lt;br /&gt;
&lt;br /&gt;
Origin PCR of original clones 5-27-14[[File:5-27-14 Ori PCR 1-24.doc ]]&lt;br /&gt;
&lt;br /&gt;
New Chap PCR clones 1-5[[File:5-28-14_New_Chap_PCR_1-5.doc ]]&lt;br /&gt;
&lt;br /&gt;
Combinations Labeling System  [[File:Labeling.xlsx]]&lt;br /&gt;
&lt;br /&gt;
ThyA Fitness Module [[File:ThyA fitness module.docx]]&lt;br /&gt;
&lt;br /&gt;
Alternative Riboswitches[[File:Alternative Riboswitches.docx]]&lt;br /&gt;
&lt;br /&gt;
Origin PCR Pictures 6-5-14 [[File:6-5-14 Origin PCR.docx]]&lt;br /&gt;
&lt;br /&gt;
Chaperone PCR PA 6-5-14 [[File:6-5-14 Chaperone PCR.docx]]&lt;br /&gt;
&lt;br /&gt;
Broth Growth Experiments  [[File:Broth Growth Experiment Reports Revised.docx]]&lt;br /&gt;
===Sub-pages on various topics===&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''&lt;br /&gt;
[[MATH]]&lt;br /&gt;
'''&lt;br /&gt;
&lt;br /&gt;
[[Catherine Doyle Thesis Materials]]&lt;br /&gt;
&lt;br /&gt;
[[Repeating 20 Clone Experiments]]&lt;br /&gt;
&lt;br /&gt;
[[Extending theophylline application]]&lt;br /&gt;
&lt;br /&gt;
[[Melamine iteration]]&lt;br /&gt;
&lt;br /&gt;
[[Ramping up Programmed Evolution]]&lt;br /&gt;
&lt;br /&gt;
[[Rational Design of Riboswitches: papers to read]]&lt;br /&gt;
&lt;br /&gt;
[[ThyA Fitness Module]]&lt;br /&gt;
&lt;br /&gt;
[[Caffeine Disk Replication Data]]&lt;br /&gt;
&lt;br /&gt;
=== Programmed Evolution Paper ===&lt;br /&gt;
&lt;br /&gt;
[[References]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_-_Riboswitches&amp;diff=17567</id>
		<title>Davidson - Riboswitches</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_-_Riboswitches&amp;diff=17567"/>
				<updated>2014-07-18T18:14:12Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: /* Corrected mutations (Jon) */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
== '''Research''' ==&lt;br /&gt;
&lt;br /&gt;
There are 6 different ammeline riboswitches that have been created by Neil Dixon, John N. Duncan, Torsten Geerlings, Mark S. Dunstan,  John E. G. McCarthy, David Leys, and Jason Micklefield. Their research is described in the article [http://www.pnas.org/content/107/7/2830.full Reengineering orthogonally selective riboswitches]. The article shows that the two best riboswitches seem to be M6'' and M6C'', however neither of these riboswitches appear to be truly &amp;quot;off&amp;quot;. When there is no ammeline present there is still a production of GFP. This presents a problem because when using a fitness module like antibiotic resistance those cells that are not producing ammeline will still be able to live, not allowing for the evolution that we desire. Another problem comes from the fact that the induction factor (the expression when ammeline is present/the expression when ammeline is absent) is not extremely high. &lt;br /&gt;
[http://www.pnas.org/content/suppl/2010/01/22/0911209107.DCSupplemental/pnas.0911209107_SI.pdf Supplemental Information For Article]&lt;br /&gt;
&lt;br /&gt;
'''Figures From Report'''&lt;br /&gt;
&lt;br /&gt;
[http://www.pnas.org/content/107/7/2830/F1.expansion.html Secondary structure model of the parental add A-riboswitch in the ON-state]&lt;br /&gt;
&lt;br /&gt;
[http://www.pnas.org/content/107/7/2830/F2.expansion.html Data From Testing Different Riboswitches]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''There are two options that we can do to fix these riboswitch systems'''   &lt;br /&gt;
                                         &lt;br /&gt;
1) Create a better riboswitch that is &amp;quot;off&amp;quot; when ammeline is absent, but still allows for an &amp;quot;on&amp;quot; system when ammeline is present &lt;br /&gt;
&lt;br /&gt;
2) Change the fitness module from antibiotic resistance to a thyA module&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Known Riboswitches'''&lt;br /&gt;
&lt;br /&gt;
Riboswitch AddA &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGTTTCTACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6 &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6’ &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6’’ &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCGAATGATATGGTTTCGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C’ &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C&amp;quot;&lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCGAATGATATGGTTTCGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C (A172G Mutation) &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAGAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C (T92C Mutation) &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCCAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C’ (T167C Mutation) &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTCTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Experimentation ==&lt;br /&gt;
'''Materials'''&lt;br /&gt;
* 10 riboswitch clones &lt;br /&gt;
* LB (amp?) plate for spotting &lt;br /&gt;
* LB (amp?) broth - 1 Liter: LB w/ DMSO (control), LB w/ DMSO and ammeline (experiment), LB (growing cells) &lt;br /&gt;
* Sterile, Filtered DMSO &lt;br /&gt;
* 20 test tubes (10 for freezing, 10 for miniprep and spotting)&lt;br /&gt;
* 20 test tubes (10 control w/o ammeline, 10 experiment w/ ammeline)&lt;br /&gt;
&lt;br /&gt;
'''Outline of Methods'''&lt;br /&gt;
&lt;br /&gt;
''Wednesday 5/28/14:''&lt;br /&gt;
&lt;br /&gt;
1) Get riboswitch clones in mail from MWSU &lt;br /&gt;
&lt;br /&gt;
2) Grow 2 (2mL) test tubes of each clone overnight &lt;br /&gt;
&lt;br /&gt;
3) Prepare 5 mL of 5 mM ammeline stock&lt;br /&gt;
*Much more difficult than originally thought..will work on this using dilute NaOH, heating DMSO, or possibly using dilute DEA &lt;br /&gt;
&lt;br /&gt;
''Thursday 5/29/14:''&lt;br /&gt;
&lt;br /&gt;
1) Freeze down cells, put in GCAT-alog &lt;br /&gt;
&lt;br /&gt;
2) Perform miniprep&lt;br /&gt;
&lt;br /&gt;
3) Spot 10 clones on plate, leave to grow until Sunday night &lt;br /&gt;
&lt;br /&gt;
''Sunday 6/1/14:''&lt;br /&gt;
&lt;br /&gt;
1) Come in and grow cells for experimentation tomorrow &lt;br /&gt;
* 2 test tubes for each clone, 1 w/DMSO (control), 1 w/ ammeline dissolved in DMSO (experimental) &lt;br /&gt;
&lt;br /&gt;
''Monday 6/2/14:''&lt;br /&gt;
&lt;br /&gt;
1) Measure Fluorescence using Synergy Machine &lt;br /&gt;
* Find control and experimental&lt;br /&gt;
* Find induction factor (experimental/control) &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''''*The collaborating MSWU research and experimentation can be found on [[MWSU Different Riboswitches]]'''''&lt;br /&gt;
&lt;br /&gt;
== New Ammeline Riboswitches ==&lt;br /&gt;
&lt;br /&gt;
20 New Davidson Ammeline Riboswitch Sequences [[File:New Ammeline Riboswitches.docx]]&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
!colspan=&amp;quot;6&amp;quot;|New Ammeline Riboswitches&lt;br /&gt;
&lt;br /&gt;
|-&lt;br /&gt;
&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | '''Riboswitch'''&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | '''Status'''&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | '''Part Number'''&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | '''Mutations?'''&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R1&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Not registered due to promoter mutation&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |2: T20C, C852T (also has M6 mutation-A432G)&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R2&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |PCR (Cloning)&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R3&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |cPCR &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R4&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |cPCR&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R5&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |cPCR&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R6&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R7&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R8&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R9&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R10&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |[//parts.igem.org/Part:BBa_J100163 J100163]&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6 Mutation: A431G&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R1&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Miniprepped&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R2&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |[http://parts.igem.org/Part:BBa_J100170 J100170]&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |A433G (RFP)&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R3&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |[http://parts.igem.org/Part:BBa_J100171 J100171]&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |A432G (RFP)&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R4&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |[http://parts.igem.org/Part:BBa_J100172 J100172]&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |A432G (RFP)&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R5&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Miniprepped&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R6&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Transformation&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R7&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified-one mutation&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R8&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |PCR (Cloning)&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R9&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |PCR (Cloning)&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R10&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified-registered&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Process:''' &lt;br /&gt;
&lt;br /&gt;
PCR (Cloning) &amp;gt; Clean and Concentrate DNA/Gel Purify DNA &amp;gt; GGA &amp;gt; Transformation &amp;gt; cPCR &amp;gt; Miniprep &amp;gt; Sequence Verify&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''NOTE:''' &amp;quot;M6 Mutation&amp;quot; refers to the mutation in the original M6 riboswitch (A430G) and this mutation will appear in &lt;br /&gt;
&lt;br /&gt;
different locations in the new riboswitches depending on the lengths of the riboswitches.&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_-_Riboswitches&amp;diff=17566</id>
		<title>Davidson - Riboswitches</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_-_Riboswitches&amp;diff=17566"/>
				<updated>2014-07-18T17:42:42Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: /* Riboswitch entries added (Jon) */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
== '''Research''' ==&lt;br /&gt;
&lt;br /&gt;
There are 6 different ammeline riboswitches that have been created by Neil Dixon, John N. Duncan, Torsten Geerlings, Mark S. Dunstan,  John E. G. McCarthy, David Leys, and Jason Micklefield. Their research is described in the article [http://www.pnas.org/content/107/7/2830.full Reengineering orthogonally selective riboswitches]. The article shows that the two best riboswitches seem to be M6'' and M6C'', however neither of these riboswitches appear to be truly &amp;quot;off&amp;quot;. When there is no ammeline present there is still a production of GFP. This presents a problem because when using a fitness module like antibiotic resistance those cells that are not producing ammeline will still be able to live, not allowing for the evolution that we desire. Another problem comes from the fact that the induction factor (the expression when ammeline is present/the expression when ammeline is absent) is not extremely high. &lt;br /&gt;
[http://www.pnas.org/content/suppl/2010/01/22/0911209107.DCSupplemental/pnas.0911209107_SI.pdf Supplemental Information For Article]&lt;br /&gt;
&lt;br /&gt;
'''Figures From Report'''&lt;br /&gt;
&lt;br /&gt;
[http://www.pnas.org/content/107/7/2830/F1.expansion.html Secondary structure model of the parental add A-riboswitch in the ON-state]&lt;br /&gt;
&lt;br /&gt;
[http://www.pnas.org/content/107/7/2830/F2.expansion.html Data From Testing Different Riboswitches]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''There are two options that we can do to fix these riboswitch systems'''   &lt;br /&gt;
                                         &lt;br /&gt;
1) Create a better riboswitch that is &amp;quot;off&amp;quot; when ammeline is absent, but still allows for an &amp;quot;on&amp;quot; system when ammeline is present &lt;br /&gt;
&lt;br /&gt;
2) Change the fitness module from antibiotic resistance to a thyA module&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Known Riboswitches'''&lt;br /&gt;
&lt;br /&gt;
Riboswitch AddA &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGTTTCTACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6 &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6’ &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6’’ &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCGAATGATATGGTTTCGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C’ &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C&amp;quot;&lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCGAATGATATGGTTTCGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C (A172G Mutation) &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAGAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C (T92C Mutation) &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCCAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C’ (T167C Mutation) &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTCTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Experimentation ==&lt;br /&gt;
'''Materials'''&lt;br /&gt;
* 10 riboswitch clones &lt;br /&gt;
* LB (amp?) plate for spotting &lt;br /&gt;
* LB (amp?) broth - 1 Liter: LB w/ DMSO (control), LB w/ DMSO and ammeline (experiment), LB (growing cells) &lt;br /&gt;
* Sterile, Filtered DMSO &lt;br /&gt;
* 20 test tubes (10 for freezing, 10 for miniprep and spotting)&lt;br /&gt;
* 20 test tubes (10 control w/o ammeline, 10 experiment w/ ammeline)&lt;br /&gt;
&lt;br /&gt;
'''Outline of Methods'''&lt;br /&gt;
&lt;br /&gt;
''Wednesday 5/28/14:''&lt;br /&gt;
&lt;br /&gt;
1) Get riboswitch clones in mail from MWSU &lt;br /&gt;
&lt;br /&gt;
2) Grow 2 (2mL) test tubes of each clone overnight &lt;br /&gt;
&lt;br /&gt;
3) Prepare 5 mL of 5 mM ammeline stock&lt;br /&gt;
*Much more difficult than originally thought..will work on this using dilute NaOH, heating DMSO, or possibly using dilute DEA &lt;br /&gt;
&lt;br /&gt;
''Thursday 5/29/14:''&lt;br /&gt;
&lt;br /&gt;
1) Freeze down cells, put in GCAT-alog &lt;br /&gt;
&lt;br /&gt;
2) Perform miniprep&lt;br /&gt;
&lt;br /&gt;
3) Spot 10 clones on plate, leave to grow until Sunday night &lt;br /&gt;
&lt;br /&gt;
''Sunday 6/1/14:''&lt;br /&gt;
&lt;br /&gt;
1) Come in and grow cells for experimentation tomorrow &lt;br /&gt;
* 2 test tubes for each clone, 1 w/DMSO (control), 1 w/ ammeline dissolved in DMSO (experimental) &lt;br /&gt;
&lt;br /&gt;
''Monday 6/2/14:''&lt;br /&gt;
&lt;br /&gt;
1) Measure Fluorescence using Synergy Machine &lt;br /&gt;
* Find control and experimental&lt;br /&gt;
* Find induction factor (experimental/control) &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''''*The collaborating MSWU research and experimentation can be found on [[MWSU Different Riboswitches]]'''''&lt;br /&gt;
&lt;br /&gt;
== New Ammeline Riboswitches ==&lt;br /&gt;
&lt;br /&gt;
20 New Davidson Ammeline Riboswitch Sequences [[File:New Ammeline Riboswitches.docx]]&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
!colspan=&amp;quot;6&amp;quot;|New Ammeline Riboswitches&lt;br /&gt;
&lt;br /&gt;
|-&lt;br /&gt;
&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | '''Riboswitch'''&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | '''Status'''&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | '''Part Number'''&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | '''Mutations?'''&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R1&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Not registered due to promoter mutation&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |2: T20C, C852T (also has M6 mutation-A432G)&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R2&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |PCR (Cloning)&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R3&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |cPCR &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R4&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |cPCR&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R5&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |cPCR&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R6&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R7&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R8&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R9&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R10&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |[//parts.igem.org/Part:BBa_J100163 J100163]&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6 Mutation: A431G&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R1&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Miniprepped&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R2&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |[http://parts.igem.org/Part:BBa_J100170 J100170]&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |A430G (RFP)&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R3&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |[http://parts.igem.org/Part:BBa_J100171 J100171]&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |A430G (RFP)&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R4&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |[http://parts.igem.org/Part:BBa_J100172 J100172]&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |A430G (RFP)&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R5&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Miniprepped&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R6&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Transformation&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R7&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified-one mutation&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R8&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |PCR (Cloning)&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R9&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |PCR (Cloning)&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R10&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified-registered&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Process:''' &lt;br /&gt;
&lt;br /&gt;
PCR (Cloning) &amp;gt; Clean and Concentrate DNA/Gel Purify DNA &amp;gt; GGA &amp;gt; Transformation &amp;gt; cPCR &amp;gt; Miniprep &amp;gt; Sequence Verify&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''NOTE:''' &amp;quot;M6 Mutation&amp;quot; refers to the mutation in the original M6 riboswitch (A430G) and this mutation will appear in &lt;br /&gt;
&lt;br /&gt;
different locations in the new riboswitches depending on the lengths of the riboswitches.&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_-_Riboswitches&amp;diff=17547</id>
		<title>Davidson - Riboswitches</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_-_Riboswitches&amp;diff=17547"/>
				<updated>2014-07-03T21:16:55Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: /* Status updateon Ammeline Riboswitches - Jon */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
== '''Research''' ==&lt;br /&gt;
&lt;br /&gt;
There are 6 different ammeline riboswitches that have been created by Neil Dixon, John N. Duncan, Torsten Geerlings, Mark S. Dunstan,  John E. G. McCarthy, David Leys, and Jason Micklefield. Their research is described in the article [http://www.pnas.org/content/107/7/2830.full Reengineering orthogonally selective riboswitches]. The article shows that the two best riboswitches seem to be M6'' and M6C'', however neither of these riboswitches appear to be truly &amp;quot;off&amp;quot;. When there is no ammeline present there is still a production of GFP. This presents a problem because when using a fitness module like antibiotic resistance those cells that are not producing ammeline will still be able to live, not allowing for the evolution that we desire. Another problem comes from the fact that the induction factor (the expression when ammeline is present/the expression when ammeline is absent) is not extremely high. &lt;br /&gt;
[http://www.pnas.org/content/suppl/2010/01/22/0911209107.DCSupplemental/pnas.0911209107_SI.pdf Supplemental Information For Article]&lt;br /&gt;
&lt;br /&gt;
'''Figures From Report'''&lt;br /&gt;
&lt;br /&gt;
[http://www.pnas.org/content/107/7/2830/F1.expansion.html Secondary structure model of the parental add A-riboswitch in the ON-state]&lt;br /&gt;
&lt;br /&gt;
[http://www.pnas.org/content/107/7/2830/F2.expansion.html Data From Testing Different Riboswitches]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''There are two options that we can do to fix these riboswitch systems'''   &lt;br /&gt;
                                         &lt;br /&gt;
1) Create a better riboswitch that is &amp;quot;off&amp;quot; when ammeline is absent, but still allows for an &amp;quot;on&amp;quot; system when ammeline is present &lt;br /&gt;
&lt;br /&gt;
2) Change the fitness module from antibiotic resistance to a thyA module&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Known Riboswitches'''&lt;br /&gt;
&lt;br /&gt;
Riboswitch AddA &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGTTTCTACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6 &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6’ &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6’’ &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCGAATGATATGGTTTCGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C’ &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C&amp;quot;&lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCGAATGATATGGTTTCGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C (A172G Mutation) &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAGAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C (T92C Mutation) &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCCAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
Riboswitch M6C’ (T167C Mutation) &lt;br /&gt;
&lt;br /&gt;
TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTCTATAAAGAGAAGACTATGAAG&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Experimentation ==&lt;br /&gt;
'''Materials'''&lt;br /&gt;
* 10 riboswitch clones &lt;br /&gt;
* LB (amp?) plate for spotting &lt;br /&gt;
* LB (amp?) broth - 1 Liter: LB w/ DMSO (control), LB w/ DMSO and ammeline (experiment), LB (growing cells) &lt;br /&gt;
* Sterile, Filtered DMSO &lt;br /&gt;
* 20 test tubes (10 for freezing, 10 for miniprep and spotting)&lt;br /&gt;
* 20 test tubes (10 control w/o ammeline, 10 experiment w/ ammeline)&lt;br /&gt;
&lt;br /&gt;
'''Outline of Methods'''&lt;br /&gt;
&lt;br /&gt;
''Wednesday 5/28/14:''&lt;br /&gt;
&lt;br /&gt;
1) Get riboswitch clones in mail from MWSU &lt;br /&gt;
&lt;br /&gt;
2) Grow 2 (2mL) test tubes of each clone overnight &lt;br /&gt;
&lt;br /&gt;
3) Prepare 5 mL of 5 mM ammeline stock&lt;br /&gt;
*Much more difficult than originally thought..will work on this using dilute NaOH, heating DMSO, or possibly using dilute DEA &lt;br /&gt;
&lt;br /&gt;
''Thursday 5/29/14:''&lt;br /&gt;
&lt;br /&gt;
1) Freeze down cells, put in GCAT-alog &lt;br /&gt;
&lt;br /&gt;
2) Perform miniprep&lt;br /&gt;
&lt;br /&gt;
3) Spot 10 clones on plate, leave to grow until Sunday night &lt;br /&gt;
&lt;br /&gt;
''Sunday 6/1/14:''&lt;br /&gt;
&lt;br /&gt;
1) Come in and grow cells for experimentation tomorrow &lt;br /&gt;
* 2 test tubes for each clone, 1 w/DMSO (control), 1 w/ ammeline dissolved in DMSO (experimental) &lt;br /&gt;
&lt;br /&gt;
''Monday 6/2/14:''&lt;br /&gt;
&lt;br /&gt;
1) Measure Fluorescence using Synergy Machine &lt;br /&gt;
* Find control and experimental&lt;br /&gt;
* Find induction factor (experimental/control) &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''''*The collaborating MSWU research and experimentation can be found on [[MWSU Different Riboswitches]]'''''&lt;br /&gt;
&lt;br /&gt;
== New Ammeline Riboswitches ==&lt;br /&gt;
&lt;br /&gt;
20 New Davidson Ammeline Riboswitch Sequences [[File:New Ammeline Riboswitches.docx]]&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
!colspan=&amp;quot;6&amp;quot;|New Ammeline Riboswitches&lt;br /&gt;
&lt;br /&gt;
|-&lt;br /&gt;
&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | '''Riboswitch'''&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | '''Status'''&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R1&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified-one mutation&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R2&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |PCR (Cloning)&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R3&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |cPCR &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R4&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |cPCR&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R5&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |cPCR&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R6&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R7&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R8&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R9&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; | &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6-R10&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified-registered&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R1&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Miniprepped&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R2&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R3&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified &lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R4&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R5&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Miniprepped&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R6&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Transformation&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R7&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified-one mutation&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R8&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |PCR (Cloning)&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R9&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |PCR (Cloning)&lt;br /&gt;
|-&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |M6&amp;quot;-R10&lt;br /&gt;
| style =&amp;quot;text-align:center;&amp;quot; |Sequence verified-registered&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
Process: &lt;br /&gt;
&lt;br /&gt;
PCR (Cloning) &amp;gt; Clean and Concentrate DNA/Gel Purify DNA &amp;gt; GGA &amp;gt; Transformation &amp;gt; cPCR &amp;gt; Miniprep &amp;gt; Sequence Verify &amp;gt; Register&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Eckdahl-replication-protocol&amp;diff=17537</id>
		<title>Eckdahl-replication-protocol</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Eckdahl-replication-protocol&amp;diff=17537"/>
				<updated>2014-07-03T18:37:30Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Procedures==&lt;br /&gt;
&lt;br /&gt;
Grow up E. coli from stock overnight&lt;br /&gt;
&lt;br /&gt;
- One batch in amp, one in amp+chlor&lt;br /&gt;
&lt;br /&gt;
- 4 mM caffeine&lt;br /&gt;
&lt;br /&gt;
Prepare stock of .25 g/mL L-arabinose	&lt;br /&gt;
&lt;br /&gt;
- Add 2 mL of this stock to every L of LB+agar, for a final concentration of .5 mG/mL&lt;br /&gt;
&lt;br /&gt;
Measure A590 (cell density) using Synergy/Cytation, dilute concentration to 0.1 with same LB+antibiotic+caffeine. Note that antibiotic will be amp for the 4 clones w/o chaperone, amp+chlor for 20 clones with chaperone.&lt;br /&gt;
&lt;br /&gt;
Combine 0.5 mL of each clone.&lt;br /&gt;
&lt;br /&gt;
Spread 50 uL with 15-20 beads onto Tet-only LB plates&lt;br /&gt;
&lt;br /&gt;
- Prepare tetracycline-LB according to MWSU bacterial media protocol.&lt;br /&gt;
&lt;br /&gt;
- Prepare caffeine disks (establish a precise method of preparing and placing disks, to minimize variation)&lt;br /&gt;
&lt;br /&gt;
- Commercial disks (need to have a certain thickness to absorb enough solution)&lt;br /&gt;
&lt;br /&gt;
- 35 uL 40 mM caffeine solution per disk&lt;br /&gt;
&lt;br /&gt;
- Put dry disk on sterile petri dish, add caffeine (filter sterilized) and let sit for 1 minute&lt;br /&gt;
&lt;br /&gt;
- Stab with the smallest sterile needle you have and transfer it to the tet plate, take sterile pipet tip and remove it from the needle.&lt;br /&gt;
&lt;br /&gt;
- Let sit for 5 minutes with lid cracked open under sterile hood&lt;br /&gt;
&lt;br /&gt;
- Incubate upside down&lt;br /&gt;
&lt;br /&gt;
- 37degrees C overnight&lt;br /&gt;
&lt;br /&gt;
- Room temperature for 4 days (with daily evaluation and regular photos and UV box photos)&lt;br /&gt;
&lt;br /&gt;
Pick out each colony with sterile pipet tip and deposit in sterile microtiter plate/pcr tubes (LB+amp colony) filled with 10uL LB+amp. Mix well by pipetting up and down, using the same pipet tip for each colony. Number colonies and record whether each colony is big or little.&lt;br /&gt;
&lt;br /&gt;
Pipet 5 uL of each LB+amp+clone to 195 LB+amp+chlor, using the same pipet tip for the same colony.&lt;br /&gt;
&lt;br /&gt;
Add LB+amp to LB+amp clones to produce 200 uL LB+amp+clones, for each colony.&lt;br /&gt;
&lt;br /&gt;
Incubate and measure A590 to determine how many colonies are still growing.&lt;br /&gt;
&lt;br /&gt;
Measure RFP and GFP fluorescence&lt;br /&gt;
&lt;br /&gt;
Spot each colony on a single plate (2 uL per spot)&lt;br /&gt;
&lt;br /&gt;
Determine chaperone # with PCR; run on agarose gel&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;New Chaperone PCR Mixture&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
- 2 uL overnight culture of bacterial clone (picked out of  amp+chlor)&lt;br /&gt;
&lt;br /&gt;
- 0.4 uL primer cocktail with new chaperone primers equally mixed from 100 uM stocks&lt;br /&gt;
&lt;br /&gt;
- 7.6 uL water&lt;br /&gt;
&lt;br /&gt;
- 10 uL 2x GoTaq Green&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;New Chaperone PCR Thermal Profile&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
- Initial denaturation: 10 minutes at 94 degrees&lt;br /&gt;
&lt;br /&gt;
- 20 cycles of 94 degrees, 15 sec; 51 degrees, 15 sec; 74 degrees, 2 minutes&lt;br /&gt;
&lt;br /&gt;
- Final extension: 74 degrees, 5 minutes&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Origin PCR Mixture&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
- 2 uL overnight culture of bacterial clone (picked out of  either amp or amp+chlor, according to the presence of the chaperone), &lt;br /&gt;
&lt;br /&gt;
- 0.5 uL primer cocktail with origin primers equally mixed from 100 uM stocks&lt;br /&gt;
&lt;br /&gt;
- 7.5 uL water&lt;br /&gt;
&lt;br /&gt;
- 10 uL 2x GoTaq Green&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Origin PCR Thermal Profile&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
- Initial denaturation: 94 degrees, 10 minutes&lt;br /&gt;
&lt;br /&gt;
- 20 cycles of touch-down PCR: 94 degrees for 15 sec, 64.5 to 44.5 degrees for 15 sec; 74 degrees for 1 minute&lt;br /&gt;
&lt;br /&gt;
- 20 cycles of PCR: 94 degrees for 15 sec, 44.5 degrees for 15 sec; 74 degrees for 1 minute&lt;br /&gt;
&lt;br /&gt;
- Final extension: 74 degrees for 5 minutes&lt;br /&gt;
&lt;br /&gt;
==Plasmids==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;J119346&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
–	High promoter&lt;br /&gt;
&lt;br /&gt;
–	High C-dog (RBS)&lt;br /&gt;
&lt;br /&gt;
–	RFP&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;J119347&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
–	Low promoter&lt;br /&gt;
&lt;br /&gt;
–	Low C-dog&lt;br /&gt;
&lt;br /&gt;
–	GFP&lt;br /&gt;
&lt;br /&gt;
== Origins ==&lt;br /&gt;
&lt;br /&gt;
	&amp;lt;b&amp;gt;pSB1A2&amp;lt;/b&amp;gt; High copy number&lt;br /&gt;
&lt;br /&gt;
	&amp;lt;b&amp;gt;J119310&amp;lt;/b&amp;gt; Low copy number&lt;br /&gt;
&lt;br /&gt;
==See also==&lt;br /&gt;
&lt;br /&gt;
[[Repeating_20_Clone_Experiments|Repeating 20-clone experiments]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Eckdahl-replication-protocol&amp;diff=17536</id>
		<title>Eckdahl-replication-protocol</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Eckdahl-replication-protocol&amp;diff=17536"/>
				<updated>2014-07-03T18:36:23Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Added &amp;quot;See also&amp;quot; section&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Procedures==&lt;br /&gt;
&lt;br /&gt;
Grow up E. coli from stock overnight&lt;br /&gt;
&lt;br /&gt;
- One batch in amp, one in amp+chlor&lt;br /&gt;
&lt;br /&gt;
- 4 mM caffeine&lt;br /&gt;
&lt;br /&gt;
Prepare stock of .25 g/mL L-arabinose	&lt;br /&gt;
&lt;br /&gt;
- Add 2 mL of this stock to every L of LB+agar, for a final concentration of .5 mG/mL&lt;br /&gt;
&lt;br /&gt;
Measure A590 (cell density) using Synergy/Cytation, dilute concentration to 0.1 with same LB+antibiotic+caffeine. Note that antibiotic will be amp for the 4 clones w/o chaperone, amp+chlor for 20 clones with chaperone.&lt;br /&gt;
&lt;br /&gt;
Combine 0.5 mL of each clone.&lt;br /&gt;
&lt;br /&gt;
Spread 50 uL with 15-20 beads onto Tet-only LB plates&lt;br /&gt;
&lt;br /&gt;
- Prepare tetracycline-LB according to MWSU bacterial media protocol.&lt;br /&gt;
&lt;br /&gt;
- Prepare caffeine disks (establish a precise method of preparing and placing disks, to minimize variation)&lt;br /&gt;
&lt;br /&gt;
- Commercial disks (need to have a certain thickness to absorb enough solution)&lt;br /&gt;
&lt;br /&gt;
- 35 uL 40 mM caffeine solution per disk&lt;br /&gt;
&lt;br /&gt;
- Put dry disk on sterile petri dish, add caffeine (filter sterilized) and let sit for 1 minute&lt;br /&gt;
&lt;br /&gt;
- Stab with the smallest sterile needle you have and transfer it to the tet plate, take sterile pipet tip and remove it from the needle.&lt;br /&gt;
&lt;br /&gt;
- Let sit for 5 minutes with lid cracked open under sterile hood&lt;br /&gt;
&lt;br /&gt;
- Incubate upside down&lt;br /&gt;
&lt;br /&gt;
- 37degrees C overnight&lt;br /&gt;
&lt;br /&gt;
- Room temperature for 4 days (with daily evaluation and regular photos and UV box photos)&lt;br /&gt;
&lt;br /&gt;
Pick out each colony with sterile pipet tip and deposit in sterile microtiter plate/pcr tubes (LB+amp colony) filled with 10uL LB+amp. Mix well by pipetting up and down, using the same pipet tip for each colony. Number colonies and record whether each colony is big or little.&lt;br /&gt;
&lt;br /&gt;
Pipet 5 uL of each LB+amp+clone to 195 LB+amp+chlor, using the same pipet tip for the same colony.&lt;br /&gt;
&lt;br /&gt;
Add LB+amp to LB+amp clones to produce 200 uL LB+amp+clones, for each colony.&lt;br /&gt;
&lt;br /&gt;
Incubate and measure A590 to determine how many colonies are still growing.&lt;br /&gt;
&lt;br /&gt;
Measure RFP and GFP fluorescence&lt;br /&gt;
&lt;br /&gt;
Spot each colony on a single plate (2 uL per spot)&lt;br /&gt;
&lt;br /&gt;
Determine chaperone # with PCR; run on agarose gel&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;New Chaperone PCR Mixture&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
- 2 uL overnight culture of bacterial clone (picked out of  amp+chlor)&lt;br /&gt;
&lt;br /&gt;
- 0.4 uL primer cocktail with new chaperone primers equally mixed from 100 uM stocks&lt;br /&gt;
&lt;br /&gt;
- 7.6 uL water&lt;br /&gt;
&lt;br /&gt;
- 10 uL 2x GoTaq Green&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;New Chaperone PCR Thermal Profile&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
- Initial denaturation: 10 minutes at 94 degrees&lt;br /&gt;
&lt;br /&gt;
- 20 cycles of 94 degrees, 15 sec; 51 degrees, 15 sec; 74 degrees, 2 minutes&lt;br /&gt;
&lt;br /&gt;
- Final extension: 74 degrees, 5 minutes&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Origin PCR Mixture&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
- 2 uL overnight culture of bacterial clone (picked out of  either amp or amp+chlor, according to the presence of the chaperone), &lt;br /&gt;
&lt;br /&gt;
- 0.5 uL primer cocktail with origin primers equally mixed from 100 uM stocks&lt;br /&gt;
&lt;br /&gt;
- 7.5 uL water&lt;br /&gt;
&lt;br /&gt;
- 10 uL 2x GoTaq Green&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Origin PCR Thermal Profile&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
- Initial denaturation: 94 degrees, 10 minutes&lt;br /&gt;
&lt;br /&gt;
- 20 cycles of touch-down PCR: 94 degrees for 15 sec, 64.5 to 44.5 degrees for 15 sec; 74 degrees for 1 minute&lt;br /&gt;
&lt;br /&gt;
- 20 cycles of PCR: 94 degrees for 15 sec, 44.5 degrees for 15 sec; 74 degrees for 1 minute&lt;br /&gt;
&lt;br /&gt;
- Final extension: 74 degrees for 5 minutes&lt;br /&gt;
&lt;br /&gt;
==See also==&lt;br /&gt;
&lt;br /&gt;
[[Repeating_20_Clone_Experiments|Repeating 20-clone experiments]]&lt;br /&gt;
&lt;br /&gt;
==Plasmids==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;J119346&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
–	High promoter&lt;br /&gt;
&lt;br /&gt;
–	High C-dog (RBS)&lt;br /&gt;
&lt;br /&gt;
–	RFP&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;J119347&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
–	Low promoter&lt;br /&gt;
&lt;br /&gt;
–	Low C-dog&lt;br /&gt;
&lt;br /&gt;
–	GFP&lt;br /&gt;
&lt;br /&gt;
== Origins ==&lt;br /&gt;
&lt;br /&gt;
	&amp;lt;b&amp;gt;pSB1A2&amp;lt;/b&amp;gt; High copy number&lt;br /&gt;
&lt;br /&gt;
	&amp;lt;b&amp;gt;J119310&amp;lt;/b&amp;gt; Low copy number&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17535</id>
		<title>Optimal caffeine concentration on plates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17535"/>
				<updated>2014-07-03T18:33:51Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Added &amp;quot;See also&amp;quot; section&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Overview==&lt;br /&gt;
Before strains with the tetracycline-theophylline fitness module can be grown in broth, we need to know how much caffeine the cells need, to produce an amount of theophylline that grants survival. [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.pptx Previous experimentation] shows that colonies on plates are able to grow in a ring around caffeine-soaked disks, leading to my hypothesis that there is an &amp;lt;b&amp;gt;optimal range of caffeine&amp;lt;/b&amp;gt; in which cells can survive. Too much caffeine or too little caffeine prevents cells from growing. However, we do not know whether cells growing in broth require the same concentration of caffeine as cells growing in plates. This experiment was designed to determine the concentration required by cells growing on plates, specifically pertaining to JM109 strains #12 and #23, [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.xlsx#file which have been demonstrated] to be the most competent clones on agar plates.&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
Prepare 80-mL batches of LB agar with incremental dilutions of caffeine from 0 mM to 10 mM. (This range was guessed based on a model of caffeine diffusion created by Morgan Spencer.)&lt;br /&gt;
The agar-caffeine dilutions should have 20 μg/mL tetracycline and 0.5 mg/mL L-arabinose. The negative control should contain no caffeine. The first positive control should have 4 mM theophylline and the second positive control should have no tetracycline. See the below table for details.&lt;br /&gt;
&lt;br /&gt;
Add anhydrous caffeine and anhydrous theophylline to the respective agar batches before autoclaving. Add tetracycline and L-arabinose from liquid stocks after autoclaving and cooling to below 60°.&lt;br /&gt;
								&lt;br /&gt;
&amp;lt;table class=&amp;quot;tableizer-table&amp;quot;&amp;gt;&lt;br /&gt;
&amp;lt;tr class=&amp;quot;tableizer-firstrow&amp;quot;&amp;gt;&amp;lt;th&amp;gt;#&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tetracycline (&amp;amp;#956;g/mL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tet (uL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theophylline (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theo (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caffeine (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caff (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;L-arabinose (uL)&amp;lt;/th&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;1&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;2&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;1&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.016&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;3&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;2&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.031&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;3&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.047&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.062&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;6&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.078&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;7&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;6&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.093&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;8&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;7&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.109&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;9&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;8&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.124&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;9&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.140&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;11&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.155&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;12&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.058&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;13&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Pour the agar dilutions into 60-mm plates. Flip plates after 3 hours and let dry for two days.&lt;br /&gt;
&lt;br /&gt;
Incubate LB broth cultures of clones #12 and 23 overnight at 37°, with 0.5 mG/mL L-arabinose and either amp or amp+chlor. Clones with a chaperone require chloramphenicol to prevent curing.&lt;br /&gt;
&lt;br /&gt;
Measure A590. Combine the clones and dilute with LB broth so that each is at 0.025 OD.&lt;br /&gt;
For each caffeine dilution, put 5-8 plating beads onto the plate and pipette 20 uL cells on top. Swirl beads carefully without the lid, discard beads, and replace lid. Store plates inverted.&lt;br /&gt;
&lt;br /&gt;
Incubate all plates at 37° overnight. Let grow for 2 days at RT. Inspect daily for growth.&lt;br /&gt;
&lt;br /&gt;
==Data==&lt;br /&gt;
&lt;br /&gt;
[[File:jon-caffeine-growth-in-broth-figure.png|frameless|500px|The number of CFU's is dependent on the concentration of caffeine provided to E. coli transformed with the tetracycline fitness module.]]&lt;br /&gt;
[[Media:Optimal-caffeine-on-plates-design-data-figure.xlsx]]&lt;br /&gt;
&lt;br /&gt;
==See also==&lt;br /&gt;
&lt;br /&gt;
[[Extending theophylline application]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Optimal-caffeine-on-plates-design-data-figure.xlsx&amp;diff=17532</id>
		<title>File:Optimal-caffeine-on-plates-design-data-figure.xlsx</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Optimal-caffeine-on-plates-design-data-figure.xlsx&amp;diff=17532"/>
				<updated>2014-07-03T18:17:13Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Jolim uploaded a new version of &amp;amp;quot;File:Optimal-caffeine-on-plates-design-data-figure.xlsx&amp;amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Optimal-caffeine-on-plates-design-data-figure.xlsx&amp;diff=17516</id>
		<title>File:Optimal-caffeine-on-plates-design-data-figure.xlsx</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Optimal-caffeine-on-plates-design-data-figure.xlsx&amp;diff=17516"/>
				<updated>2014-07-01T14:02:28Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Jolim uploaded a new version of &amp;amp;quot;File:Optimal-caffeine-on-plates-design-data-figure.xlsx&amp;amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17515</id>
		<title>Optimal caffeine concentration on plates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17515"/>
				<updated>2014-07-01T13:29:14Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Overview==&lt;br /&gt;
Before strains with the tetracycline-theophylline fitness module can be grown in broth, we need to know how much caffeine the cells need, to produce an amount of theophylline that grants survival. [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.pptx Previous experimentation] shows that colonies on plates are able to grow in a ring around caffeine-soaked disks, leading to my hypothesis that there is an &amp;lt;b&amp;gt;optimal range of caffeine&amp;lt;/b&amp;gt; in which cells can survive. Too much caffeine or too little caffeine prevents cells from growing. However, we do not know whether cells growing in broth require the same concentration of caffeine as cells growing in plates. This experiment was designed to determine the concentration required by cells growing on plates, specifically pertaining to JM109 strains #12 and #23, [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.xlsx#file which have been demonstrated] to be the most competent clones on agar plates.&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
Prepare 80-mL batches of LB agar with incremental dilutions of caffeine from 0 mM to 10 mM. (This range was guessed based on a model of caffeine diffusion created by Morgan Spencer.)&lt;br /&gt;
The agar-caffeine dilutions should have 20 μg/mL tetracycline and 0.5 mg/mL L-arabinose. The negative control should contain no caffeine. The first positive control should have 4 mM theophylline and the second positive control should have no tetracycline. See the below table for details.&lt;br /&gt;
&lt;br /&gt;
Add anhydrous caffeine and anhydrous theophylline to the respective agar batches before autoclaving. Add tetracycline and L-arabinose from liquid stocks after autoclaving and cooling to below 60°.&lt;br /&gt;
								&lt;br /&gt;
&amp;lt;table class=&amp;quot;tableizer-table&amp;quot;&amp;gt;&lt;br /&gt;
&amp;lt;tr class=&amp;quot;tableizer-firstrow&amp;quot;&amp;gt;&amp;lt;th&amp;gt;#&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tetracycline (&amp;amp;#956;g/mL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tet (uL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theophylline (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theo (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caffeine (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caff (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;L-arabinose (uL)&amp;lt;/th&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;1&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;2&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;1&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.016&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;3&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;2&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.031&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;3&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.047&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.062&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;6&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.078&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;7&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;6&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.093&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;8&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;7&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.109&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;9&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;8&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.124&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;9&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.140&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;11&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.155&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;12&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.058&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;13&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Pour the agar dilutions into 60-mm plates. Flip plates after 3 hours and let dry for two days.&lt;br /&gt;
&lt;br /&gt;
Incubate LB broth cultures of clones #12 and 23 overnight at 37°, with 0.5 mG/mL L-arabinose and either amp or amp+chlor. Clones with a chaperone require chloramphenicol to prevent curing.&lt;br /&gt;
&lt;br /&gt;
Measure A590. Combine the clones and dilute with LB broth so that each is at 0.025 OD.&lt;br /&gt;
For each caffeine dilution, put 5-8 plating beads onto the plate and pipette 20 uL cells on top. Swirl beads carefully without the lid, discard beads, and replace lid. Store plates inverted.&lt;br /&gt;
&lt;br /&gt;
Incubate all plates at 37° overnight. Let grow for 2 days at RT. Inspect daily for growth.&lt;br /&gt;
&lt;br /&gt;
==Data==&lt;br /&gt;
&lt;br /&gt;
[[File:jon-caffeine-growth-in-broth-figure.png|thumb|500px|left|The number of CFU's is dependent on the concentration of caffeine provided to E. coli transformed with the tetracycline fitness module.]]&lt;br /&gt;
[[Media:Optimal-caffeine-on-plates-design-data-figure.xlsx]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17514</id>
		<title>Optimal caffeine concentration on plates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17514"/>
				<updated>2014-07-01T13:28:32Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Overview==&lt;br /&gt;
Before strains with the tetracycline-theophylline fitness module can be grown in broth, we need to know how much caffeine the cells need, to produce an amount of theophylline that grants survival. [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.pptx Previous experimentation] shows that colonies on plates are able to grow in a ring around caffeine-soaked disks, leading to my hypothesis that there is an &amp;lt;b&amp;gt;optimal range of caffeine&amp;lt;/b&amp;gt; in which cells can survive. Too much caffeine or too little caffeine prevents cells from growing. However, we do not know whether cells growing in broth require the same concentration of caffeine as cells growing in plates. This experiment was designed to determine the concentration required by cells growing on plates, specifically pertaining to JM109 strains #12 and #23, [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.xlsx#file which have been demonstrated] to be the most competent clones on agar plates.&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
Prepare 80-mL batches of LB agar with incremental dilutions of caffeine from 0 mM to 10 mM. (This range was guessed based on a model of caffeine diffusion created by Morgan Spencer.)&lt;br /&gt;
The agar-caffeine dilutions should have 20 μg/mL tetracycline and 0.5 mg/mL L-arabinose. The negative control should contain no caffeine. The first positive control should have 4 mM theophylline and the second positive control should have no tetracycline. See the below table for details.&lt;br /&gt;
Add anhydrous caffeine and anhydrous theophylline to the respective agar batches before autoclaving. Add tetracycline and L-arabinose from liquid stocks after autoclaving and cooling to below 60°.&lt;br /&gt;
								&lt;br /&gt;
&amp;lt;table class=&amp;quot;tableizer-table&amp;quot;&amp;gt;&lt;br /&gt;
&amp;lt;tr class=&amp;quot;tableizer-firstrow&amp;quot;&amp;gt;&amp;lt;th&amp;gt;#&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tetracycline (&amp;amp;#956;g/mL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tet (uL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theophylline (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theo (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caffeine (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caff (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;L-arabinose (uL)&amp;lt;/th&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;1&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;2&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;1&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.016&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;3&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;2&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.031&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;3&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.047&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.062&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;6&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.078&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;7&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;6&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.093&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;8&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;7&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.109&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;9&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;8&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.124&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;9&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.140&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;11&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.155&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;12&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.058&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;13&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Pour the agar dilutions into 60-mm plates. Flip plates after 3 hours and let dry for two days.&lt;br /&gt;
&lt;br /&gt;
Incubate LB broth cultures of clones #12 and 23 overnight at 37°, with 0.5 mG/mL L-arabinose and either amp or amp+chlor. Clones with a chaperone require chloramphenicol to prevent curing.&lt;br /&gt;
&lt;br /&gt;
Measure A590. Combine the clones and dilute with LB broth so that each is at 0.025 OD.&lt;br /&gt;
For each caffeine dilution, put 5-8 plating beads onto the plate and pipette 20 uL cells on top. Swirl beads carefully without the lid, discard beads, and replace lid. Store plates inverted.&lt;br /&gt;
&lt;br /&gt;
Incubate all plates at 37° overnight. Let grow for 2 days at RT. Inspect daily for growth.&lt;br /&gt;
&lt;br /&gt;
==Data==&lt;br /&gt;
&lt;br /&gt;
[[File:jon-caffeine-growth-in-broth-figure.png|thumb|500px|left|The number of CFU's is dependent on the concentration of caffeine provided to E. coli transformed with the tetracycline fitness module.]]&lt;br /&gt;
[[Media:Optimal-caffeine-on-plates-design-data-figure.xlsx]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17513</id>
		<title>Optimal caffeine concentration on plates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17513"/>
				<updated>2014-07-01T13:26:33Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Protocol updated, data and figure added&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Overview==&lt;br /&gt;
Before strains with the tetracycline-theophylline fitness module can be grown in broth, we need to know how much caffeine the cells need, to produce an amount of theophylline that grants survival. [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.pptx Previous experimentation] shows that colonies on plates are able to grow in a ring around caffeine-soaked disks, leading to my hypothesis that there is an &amp;lt;b&amp;gt;optimal range of caffeine&amp;lt;/b&amp;gt; in which cells can survive. Too much caffeine or too little caffeine prevents cells from growing. However, we do not know whether cells growing in broth require the same concentration of caffeine as cells growing in plates. This experiment was designed to determine the concentration required by cells growing on plates, specifically pertaining to JM109 strains #12 and #23, [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.xlsx#file which have been demonstrated] to be the most competent clones on agar plates.&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
Prepare 80-mL batches of LB agar with incremental dilutions of caffeine from 0 mM to 10 mM. (This range was guessed based on a model of caffeine diffusion created by Morgan Spencer.)&lt;br /&gt;
The agar-caffeine dilutions should have 20 μg/mL tetracycline and 0.5 mg/mL L-arabinose. The negative control should contain no caffeine. The first positive control should have 4 mM theophylline and the second positive control should have no tetracycline. See the below table for details.&lt;br /&gt;
Add anhydrous caffeine and anhydrous theophylline to the respective agar batches before autoclaving. Add tetracycline and L-arabinose from liquid stocks after autoclaving and cooling to below 60°.&lt;br /&gt;
								&lt;br /&gt;
&amp;lt;table class=&amp;quot;tableizer-table&amp;quot;&amp;gt;&lt;br /&gt;
&amp;lt;tr class=&amp;quot;tableizer-firstrow&amp;quot;&amp;gt;&amp;lt;th&amp;gt;#&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tetracycline (&amp;amp;#956;g/mL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tet (uL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theophylline (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theo (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caffeine (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caff (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;L-arabinose (uL)&amp;lt;/th&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;1&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;2&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;1&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.016&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;3&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;2&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.031&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;3&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.047&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.062&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;6&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.078&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;7&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;6&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.093&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;8&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;7&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.109&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;9&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;8&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.124&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;9&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.140&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;11&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.155&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;12&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.058&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;13&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;320&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.058&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.155&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;160&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Pour the agar dilutions into 60-mm plates. Flip plates after 3 hours and let dry for two days.&lt;br /&gt;
&lt;br /&gt;
Incubate LB broth cultures of clones #12 and 23 overnight at 37°, with 0.5 mG/mL L-arabinose and either amp or amp+chlor. Clones with a chaperone require chloramphenicol to prevent curing.&lt;br /&gt;
&lt;br /&gt;
Measure A590. Combine the clones and dilute with LB broth so that each is at 0.025 OD.&lt;br /&gt;
For each caffeine dilution, put 5-8 plating beads onto the plate and pipette 20 uL cells on top. Swirl beads carefully without the lid, discard beads, and replace lid. Store plates inverted.&lt;br /&gt;
&lt;br /&gt;
Incubate all plates at 37° overnight. Let grow for 2 days at RT. Inspect daily for growth.&lt;br /&gt;
&lt;br /&gt;
==Data==&lt;br /&gt;
&lt;br /&gt;
[[File:jon-caffeine-growth-in-broth-figure.png|thumb|500px|left|The number of CFU's is dependent on the concentration of caffeine provided to E. coli transformed with the tetracycline fitness module.]]&lt;br /&gt;
[[Media:Optimal-caffeine-on-plates-design-data-figure.xlsx]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Optimal-caffeine-on-plates-design-data-figure.xlsx&amp;diff=17512</id>
		<title>File:Optimal-caffeine-on-plates-design-data-figure.xlsx</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Optimal-caffeine-on-plates-design-data-figure.xlsx&amp;diff=17512"/>
				<updated>2014-07-01T13:25:56Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17511</id>
		<title>File:Jon-caffeine-growth-in-broth-figure.png</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17511"/>
				<updated>2014-07-01T13:15:02Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Jolim uploaded a new version of &amp;amp;quot;File:Jon-caffeine-growth-in-broth-figure.png&amp;amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17510</id>
		<title>File:Jon-caffeine-growth-in-broth-figure.png</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17510"/>
				<updated>2014-07-01T13:10:35Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Jolim uploaded a new version of &amp;amp;quot;File:Jon-caffeine-growth-in-broth-figure.png&amp;amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17509</id>
		<title>File:Jon-caffeine-growth-in-broth-figure.png</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17509"/>
				<updated>2014-07-01T13:07:47Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Jolim uploaded a new version of &amp;amp;quot;File:Jon-caffeine-growth-in-broth-figure.png&amp;amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17507</id>
		<title>File:Jon-caffeine-growth-in-broth-figure.png</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17507"/>
				<updated>2014-07-01T13:03:21Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Jolim moved page File:Jon-caffeine-growth-in-broth-figure.jpg to File:Jon-caffeine-growth-in-broth-figure.png&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.jpg&amp;diff=17508</id>
		<title>File:Jon-caffeine-growth-in-broth-figure.jpg</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.jpg&amp;diff=17508"/>
				<updated>2014-07-01T13:03:21Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Jolim moved page File:Jon-caffeine-growth-in-broth-figure.jpg to File:Jon-caffeine-growth-in-broth-figure.png&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;#REDIRECT [[File:Jon-caffeine-growth-in-broth-figure.png]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17506</id>
		<title>File:Jon-caffeine-growth-in-broth-figure.png</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Jon-caffeine-growth-in-broth-figure.png&amp;diff=17506"/>
				<updated>2014-07-01T12:58:41Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17488</id>
		<title>Optimal caffeine concentration on plates</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Optimal_caffeine_concentration_on_plates&amp;diff=17488"/>
				<updated>2014-06-19T20:16:58Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Created page&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Overview==&lt;br /&gt;
Before strains with the tetracycline-theophylline fitness module can be grown in broth, we need to know how much caffeine the cells need, to produce an amount of theophylline that grants survival. [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.pptx Previous experimentation] shows that colonies on plates are able to grow in a ring around caffeine-soaked disks, leading to my hypothesis that there is an &amp;lt;b&amp;gt;optimal range of caffeine&amp;lt;/b&amp;gt; in which cells can survive. Too much caffeine or too little caffeine prevents cells from growing. However, we do not know whether cells growing in broth require the same concentration of caffeine as cells growing in plates. This experiment was designed to determine the concentration required by cells growing on plates, specifically pertaining to JM109 strains #12 and #23, [http://gcat.davidson.edu/mediawiki-1.19.1/index.php/File:MWSU.xlsx#file which have been demonstrated] to be the most competent clones on agar plates.&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
Prepare 20-mL batches of LB agar with incremental dilutions of caffeine from 20 mM to 40 mM. (This range was guessed based on observation of the distance of colonies from the disk in MWSU photos.)&lt;br /&gt;
The agar-caffeine dilutions should have 5 μg/mL tetracycline and 0.5 mg/mL L-arabinose. The negative control should contain no caffeine. The first positive control should have 4 mM theophylline and the second positive control should have no tetracycline. See the below table for details.&lt;br /&gt;
Add anhydrous caffeine and anhydrous theophylline to the agar before autoclaving. Add tetracycline and L-arabinose from liquid stocks after autoclaving and cooling to below 60°.&lt;br /&gt;
								&lt;br /&gt;
&amp;lt;table class=&amp;quot;tableizer-table&amp;quot;&amp;gt;&lt;br /&gt;
&amp;lt;tr class=&amp;quot;tableizer-firstrow&amp;quot;&amp;gt;&amp;lt;th&amp;gt;#&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tetracycline (&amp;amp;#956;g/mL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Tet (uL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theophylline (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Theo (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caffeine (mM)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Caff (g)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;L-arabinose (uL)&amp;lt;/th&amp;gt;&amp;lt;th&amp;gt;Comment&amp;lt;/th&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;1&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;Negative control&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;2&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.078&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;3&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;21&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.082&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;22&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.085&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;23&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.089&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;6&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;24&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.093&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;7&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;25&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.097&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;8&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;26&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.101&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;9&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;27&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.105&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;10&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;28&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.109&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;11&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;29&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.113&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;12&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;30&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.117&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;13&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;31&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.120&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;14&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;32&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.124&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;15&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;33&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.128&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;16&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;34&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.132&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;17&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;35&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.136&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;18&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;36&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.140&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;19&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;37&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.144&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;38&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.148&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;21&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;39&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.151&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;22&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.155&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;&amp;amp;nbsp;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;23&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.014&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.000&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;Positive control&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
 &amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;24&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;5&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;20&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;4&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.014&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;0.155&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;40&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;Positive control&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Pour each agar dilution into two 35-mm plates, labeled A and B. Flip all plates after 3 hours and let dry for two days.&lt;br /&gt;
&lt;br /&gt;
Incubate LB broth cultures of each clone overnight at 37°, with 0.5 mG/mL L-arabinose and either amp or amp+chlor. Clones with a chaperone require chloramphenicol to prevent curing.&lt;br /&gt;
&lt;br /&gt;
Measure A590 and dilute concentration to 0.05 OD with LB+antibiotic.&lt;br /&gt;
&lt;br /&gt;
For the “A” series, place 2-μL spot of each clone onto the plates.&lt;br /&gt;
&lt;br /&gt;
For the “B” series, spread 10 uL of each clone with 3-5 beads onto the plates. Swirl beads carefully without the lid, discard beads, and replace lid. Store plates inverted.&lt;br /&gt;
&lt;br /&gt;
Incubate all plates at 37° overnight. Let grow for 4 days at RT. Inspect daily for growth. Count colonies per plate or colonies per area to determine the plate with the optimal caffeine concentration.&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Extending_theophylline_application&amp;diff=17487</id>
		<title>Extending theophylline application</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Extending_theophylline_application&amp;diff=17487"/>
				<updated>2014-06-19T19:41:02Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: Added a link to Jon Lim's protocol for finding the optimal caffeine concentration on plates&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''How can the caffeine disk results be extended? What experiments can be done?'''&lt;br /&gt;
&lt;br /&gt;
Redo original experiment to verify results&lt;br /&gt;
&lt;br /&gt;
'''Natural selection experiment:'''&lt;br /&gt;
Plate all clones on one plate and then plate clones in groups of 5 on 4 plates to see if there are other natural factors affecting growth that we haven’t considered.&lt;br /&gt;
&lt;br /&gt;
'''Finding the best clone:'''&lt;br /&gt;
Plate clones in groups of 5 on 4 plates in the presence of caffeine (varying levels for varying experiments). Take the best clone from each plate and plate them on one plate to see the best (all taking into account any additional natural variables that need to be monitored or accounted for).&lt;br /&gt;
&lt;br /&gt;
'''Broth experiment:'''&lt;br /&gt;
If one clone really is the best, then test it in broth to make the experiment/results more versatile. If it is the best, it should dominate the broth very quickly.&lt;br /&gt;
&lt;br /&gt;
[[Optimal caffeine concentration on plates]] (Jon Lim)&lt;br /&gt;
&lt;br /&gt;
'''Questions:'''&lt;br /&gt;
&lt;br /&gt;
What if the best fitness module is in a naturally failing e coli (due to factors we have not considered or measured)?&lt;br /&gt;
&lt;br /&gt;
Should our future experiments focus on optimization (if we already have a good system) or on diversification (broth, other common lab situations that would be easier for someone to use than plates, etc). Do we care which is best or do we want an easy process that is sufficiently good?&lt;br /&gt;
&lt;br /&gt;
Is more prep time worth a better result (financially)?&lt;br /&gt;
&lt;br /&gt;
Is there a way to figure out which will be more dominant even when it isn’t dominant yet? Is there some sort of trend or flag that we can identify that would indicate a population that will eventually be dominant?&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Determine growth in the Ecoli strain&lt;br /&gt;
&lt;br /&gt;
-Wild type in broth at 37 degrees Celsius&lt;br /&gt;
-Grow them 12-14 hours&lt;br /&gt;
&lt;br /&gt;
 The superstar combination #14&lt;br /&gt;
	2 tests in each campus&lt;br /&gt;
&lt;br /&gt;
1st test tube- broth, tet, chlor and amp&lt;br /&gt;
2nd test tube- broth, tet, chlor, amp and&lt;br /&gt;
 &lt;br /&gt;
	-Broth, tet&lt;br /&gt;
	-Growth with theophylline, tet resistance&lt;br /&gt;
	-no growth, demetylase problem &lt;br /&gt;
&lt;br /&gt;
 Question is growth&lt;br /&gt;
Two test-tube with all 24 clones&lt;br /&gt;
&lt;br /&gt;
 	1st tube- tet and amp&lt;br /&gt;
	2nd tube tet, chlor and amp&lt;br /&gt;
&lt;br /&gt;
6 tubes of all combinations&lt;br /&gt;
chlor not run on the last chaperone group&lt;br /&gt;
&lt;br /&gt;
Theophylline control&lt;br /&gt;
&lt;br /&gt;
1Liter LB+4mM &lt;br /&gt;
1mL(50ug/mL Amp) &lt;br /&gt;
4mL(5mg/mL Tet)&lt;br /&gt;
1mL(35ug/mL Chloro)&lt;br /&gt;
&lt;br /&gt;
Cells- 120 mL cells each time&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Repeating_Eckdahl%27s_20-clone_selection&amp;diff=17360</id>
		<title>Repeating Eckdahl's 20-clone selection</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Repeating_Eckdahl%27s_20-clone_selection&amp;diff=17360"/>
				<updated>2014-05-31T20:01:26Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We need to replicate Dr. Eckdahl’s 20-clone experiment twice on both campuses and mathematically analyze the data. Continue adding arabinose to induce the chaperones.&lt;br /&gt;
&lt;br /&gt;
We need to grow the surviving clones on individual plates: no antibiotic, amp, amp+chlor. This will enable us to determine whether both plasmids (CDM+amp, chaperone+chlor) are still present and being transcribed.&lt;br /&gt;
&lt;br /&gt;
Depending on the survivorship of the clones in the previous step, set up plates to run head-to-head competition between two surviving clones, and determine which strain is most competent. This will confirm the results of the 20-clone experiment, in a more controlled environment than a plate with all 20 clones.&lt;br /&gt;
&lt;br /&gt;
Protocol created on 05/21/14: [[Eckdahl-replication-protocol]]&lt;br /&gt;
&lt;br /&gt;
[https://www.dropbox.com/sh/2jqkqfz755ng0vc/AAA26M9kEeYii0pFtFlCQ17na Photos from Davidson's first replication (four plates)] (Updated May 31, 2014)&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Repeating_Eckdahl%27s_20-clone_selection&amp;diff=17359</id>
		<title>Repeating Eckdahl's 20-clone selection</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Repeating_Eckdahl%27s_20-clone_selection&amp;diff=17359"/>
				<updated>2014-05-31T17:22:32Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We need to replicate Dr. Eckdahl’s 20-clone experiment twice on both campuses and mathematically analyze the data. Continue adding arabinose to induce the chaperones.&lt;br /&gt;
&lt;br /&gt;
We need to grow the surviving clones on individual plates: no antibiotic, amp, amp+chlor. This will enable us to determine whether both plasmids (CDM+amp, chaperone+chlor) are still present and being transcribed.&lt;br /&gt;
&lt;br /&gt;
Depending on the survivorship of the clones in the previous step, set up plates to run head-to-head competition between two surviving clones, and determine which strain is most competent. This will confirm the results of the 20-clone experiment, in a more controlled environment than a plate with all 20 clones.&lt;br /&gt;
&lt;br /&gt;
Protocol created on 05/21/14: [[Eckdahl-replication-protocol]]&lt;br /&gt;
&lt;br /&gt;
[https://www.dropbox.com/sh/2jqkqfz755ng0vc/AAA26M9kEeYii0pFtFlCQ17na Photos from Davidson's first replication (four plates)] (Updated May 30, 2014)&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Repeating_Eckdahl%27s_20-clone_selection&amp;diff=17355</id>
		<title>Repeating Eckdahl's 20-clone selection</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Repeating_Eckdahl%27s_20-clone_selection&amp;diff=17355"/>
				<updated>2014-05-29T19:28:49Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We need to replicate Dr. Eckdahl’s 20-clone experiment twice on both campuses and mathematically analyze the data. Continue adding arabinose to induce the chaperones.&lt;br /&gt;
&lt;br /&gt;
We need to grow the surviving clones on individual plates: no antibiotic, amp, amp+chlor. This will enable us to determine whether both plasmids (CDM+amp, chaperone+chlor) are still present and being transcribed.&lt;br /&gt;
&lt;br /&gt;
Depending on the survivorship of the clones in the previous step, set up plates to run head-to-head competition between two surviving clones, and determine which strain is most competent. This will confirm the results of the 20-clone experiment, in a more controlled environment than a plate with all 20 clones.&lt;br /&gt;
&lt;br /&gt;
Protocol created on 05/21/14: [[Eckdahl-replication-protocol]]&lt;br /&gt;
&lt;br /&gt;
[https://www.dropbox.com/sh/2jqkqfz755ng0vc/AAA26M9kEeYii0pFtFlCQ17na Photos from Davidson's first replication (four plates)]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Team_1%27s_Brainstorm_for_Future_Programmed_Evolution_Research&amp;diff=17304</id>
		<title>Team 1's Brainstorm for Future Programmed Evolution Research</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Team_1%27s_Brainstorm_for_Future_Programmed_Evolution_Research&amp;diff=17304"/>
				<updated>2014-05-26T20:28:24Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: /* Our picks */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Barcode of 7 bp (7^4 combinations)&lt;br /&gt;
&lt;br /&gt;
-	Use GGA . . . still have to work out restriction enzyme, other details&lt;br /&gt;
&lt;br /&gt;
Changing internal (genetic) elements…riboswitch, other RBS and origins and chaperones&lt;br /&gt;
&lt;br /&gt;
-	…Using new ones&lt;br /&gt;
&lt;br /&gt;
-	…introducing mutations to improve them&lt;br /&gt;
&lt;br /&gt;
Multistep/more complex pathways?&lt;br /&gt;
&lt;br /&gt;
-	Any other metabolic improvements to caffeine -&amp;gt; theophylline pathway&lt;br /&gt;
&lt;br /&gt;
-	Stopping the pathway converting ammeline (guanine deamylase), seeing whether that pathway is absolutely necessary to cell survival. (In the melamine -&amp;gt; ammeline -&amp;gt; … pathway)&lt;br /&gt;
&lt;br /&gt;
-	What else besides theophylline? (MWSU “laundry list”)&lt;br /&gt;
&lt;br /&gt;
New fitness modules&lt;br /&gt;
&lt;br /&gt;
-	Testing /improving /adapting the ThyA fitness module&lt;br /&gt;
&lt;br /&gt;
-	Building new fitness modules&lt;br /&gt;
&lt;br /&gt;
==New riboswitches==&lt;br /&gt;
&lt;br /&gt;
Trying new riboswitch that interacts with coenzyme B12&lt;br /&gt;
&lt;br /&gt;
Building a riboswitch&lt;br /&gt;
&lt;br /&gt;
-	…Using/improving Catherine Doyle’s riboswitch builder, which generates potential riboswitch sequences based on a given aptamer sequence&lt;br /&gt;
&lt;br /&gt;
Riboswitch / RBS combo that is a single modular structure (C-Dog?)&lt;br /&gt;
&lt;br /&gt;
Finding a riboswitch that works with ammeline&lt;br /&gt;
&lt;br /&gt;
==Our picks==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;strike&amp;gt;Testing the ThyA fitness module developed at Davidson, or finding other ways to implement it.&amp;lt;/strike&amp;gt; (Covered by second team.)&lt;br /&gt;
&lt;br /&gt;
Investigating riboswitch-RBS interactions - The problem is that the function of promoters and RBS's are context-dependent, based on each other and on the gene of interest. C-dog is more reliable, but might be improved. The goal of investigating the riboswitch-RBS interactions would be to develop a hybrid riboswitch/C-dog combo, making the riboswitch more reliable. &lt;br /&gt;
&lt;br /&gt;
Testing a new metabolic pathway - choose the pathway based on which riboswitches are already known&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Ramping_up_Programmed_Evolution&amp;diff=17303</id>
		<title>Ramping up Programmed Evolution</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Ramping_up_Programmed_Evolution&amp;diff=17303"/>
				<updated>2014-05-26T20:21:58Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;1)  Riboswitch&lt;br /&gt;
* Dual ligand&lt;br /&gt;
* Turning on and off riboswitch &lt;br /&gt;
2)  Increased variations in the module including the chaperones &lt;br /&gt;
* Increase in variation within current categories. (Copy number, promoter strength)&lt;br /&gt;
* New category: mutation of individual base pairs&lt;br /&gt;
* Controlling interaction of riboswitch and aptamer &lt;br /&gt;
3)  Ecoli-yeast &lt;br /&gt;
* Temperature difference &lt;br /&gt;
* Simple vs. complex pathway of translation &lt;br /&gt;
4)  The number of steps in the metabolic pathway &lt;br /&gt;
* The formation of byproducts &lt;br /&gt;
* More than one compound of interest, possibly by decomposition.&lt;br /&gt;
* The number of steps to reach differences in significant results.&lt;br /&gt;
5)  Introducing mutations like in the promoter region, the ribosome binding site, elements found in nature like nickel, cadmium &lt;br /&gt;
6)  Utilize other bacterial species i.e. B.subtilius&lt;br /&gt;
&lt;br /&gt;
[[Team 1's Brainstorm for Future Programmed Evolution Research]]&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Team_1%27s_Brainstorm_for_Future_Programmed_Evolution_Research&amp;diff=17288</id>
		<title>Team 1's Brainstorm for Future Programmed Evolution Research</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Team_1%27s_Brainstorm_for_Future_Programmed_Evolution_Research&amp;diff=17288"/>
				<updated>2014-05-22T15:31:56Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Barcode of 7 bp (7^4 combinations)&lt;br /&gt;
&lt;br /&gt;
-	Use GGA . . . still have to work out restriction enzyme, other details&lt;br /&gt;
&lt;br /&gt;
Changing internal (genetic) elements…riboswitch, other RBS and origins and chaperones&lt;br /&gt;
&lt;br /&gt;
-	…Using new ones&lt;br /&gt;
&lt;br /&gt;
-	…introducing mutations to improve them&lt;br /&gt;
&lt;br /&gt;
Multistep/more complex pathways?&lt;br /&gt;
&lt;br /&gt;
-	Any other metabolic improvements to caffeine -&amp;gt; theophylline pathway&lt;br /&gt;
&lt;br /&gt;
-	Stopping the pathway converting ammeline (guanine deamylase), seeing whether that pathway is absolutely necessary to cell survival. (In the melamine -&amp;gt; ammeline -&amp;gt; … pathway)&lt;br /&gt;
&lt;br /&gt;
-	What else besides theophylline? (MWSU “laundry list”)&lt;br /&gt;
&lt;br /&gt;
New fitness modules&lt;br /&gt;
&lt;br /&gt;
-	Testing /improving /adapting the ThyA fitness module&lt;br /&gt;
&lt;br /&gt;
-	Building new fitness modules&lt;br /&gt;
&lt;br /&gt;
==New riboswitches==&lt;br /&gt;
&lt;br /&gt;
Trying new riboswitch that interacts with coenzyme B12&lt;br /&gt;
&lt;br /&gt;
Building a riboswitch&lt;br /&gt;
&lt;br /&gt;
-	…Using/improving Catherine Doyle’s riboswitch builder, which generates potential riboswitch sequences based on a given aptamer sequence&lt;br /&gt;
&lt;br /&gt;
Riboswitch / RBS combo that is a single modular structure (C-Dog?)&lt;br /&gt;
&lt;br /&gt;
Finding a riboswitch that works with ammeline&lt;br /&gt;
&lt;br /&gt;
==Our picks==&lt;br /&gt;
&lt;br /&gt;
Testing the ThyA fitness module developed at Davidson, or finding other ways to implement it.&lt;br /&gt;
&lt;br /&gt;
Investigating riboswitch-RBS interactions - The problem is that the function of promoters and RBS's are context-dependent, based on each other and on the gene of interest. C-dog is more reliable, but might be improved. The goal of investigating the riboswitch-RBS interactions would be to develop a hybrid riboswitch/C-dog combo, making the riboswitch more reliable. &lt;br /&gt;
&lt;br /&gt;
Testing a new metabolic pathway - choose the pathway based on which riboswitches are already known&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Team_1%27s_Brainstorm_for_Future_Programmed_Evolution_Research&amp;diff=17286</id>
		<title>Team 1's Brainstorm for Future Programmed Evolution Research</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Team_1%27s_Brainstorm_for_Future_Programmed_Evolution_Research&amp;diff=17286"/>
				<updated>2014-05-22T15:12:07Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: /* Our picks */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Barcode of 7 bp (7^4 combinations)&lt;br /&gt;
&lt;br /&gt;
-	Use GGA . . . still have to work out restriction enzyme, other details&lt;br /&gt;
&lt;br /&gt;
Changing internal (genetic) elements…riboswitch, other RBS and origins and chaperones&lt;br /&gt;
&lt;br /&gt;
-	…Using new ones&lt;br /&gt;
&lt;br /&gt;
-	…introducing mutations to improve them&lt;br /&gt;
&lt;br /&gt;
Multistep/more complex pathways?&lt;br /&gt;
&lt;br /&gt;
-	Any other metabolic improvements to caffeine -&amp;gt; theophylline pathway&lt;br /&gt;
&lt;br /&gt;
-	Stopping the pathway converting ameline (guanine deamylase), seeing whether that pathway is absolutely necessary to cell survival. (In the melamine -&amp;gt; ameline -&amp;gt; … pathway)&lt;br /&gt;
&lt;br /&gt;
-	What else besides theophylline? (MWSU “laundry list”)&lt;br /&gt;
&lt;br /&gt;
New fitness modules&lt;br /&gt;
&lt;br /&gt;
-	Testing /improving /adapting the ThyA fitness module&lt;br /&gt;
&lt;br /&gt;
-	Building new fitness modules&lt;br /&gt;
&lt;br /&gt;
==New riboswitches==&lt;br /&gt;
&lt;br /&gt;
Trying new riboswitch that interacts with coenzyme B12&lt;br /&gt;
&lt;br /&gt;
Building a riboswitch&lt;br /&gt;
&lt;br /&gt;
-	…Using/improving Catherine Doyle’s riboswitch builder, which generates potential riboswitch sequences based on a given aptamer sequence&lt;br /&gt;
&lt;br /&gt;
Riboswitch / RBS combo that is a single modular structure (C-Dog?)&lt;br /&gt;
&lt;br /&gt;
Finding a riboswitch that works with ameline&lt;br /&gt;
&lt;br /&gt;
==Our picks==&lt;br /&gt;
&lt;br /&gt;
Testing the ThyA fitness module developed at Davidson, or finding other ways to implement it.&lt;br /&gt;
&lt;br /&gt;
Investigating riboswitch-RBS interactions - The problem is that the function of promoters and RBS's are context-dependent, based on each other and on the gene of interest. C-dog is more reliable, but might be improved. The goal of investigating the riboswitch-RBS interactions would be to develop a hybrid riboswitch/C-dog combo, making the riboswitch more reliable. &lt;br /&gt;
&lt;br /&gt;
Testing a new metabolic pathway - choose the pathway based on which riboswitches are already known&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Team_1%27s_Brainstorm_for_Future_Programmed_Evolution_Research&amp;diff=17277</id>
		<title>Team 1's Brainstorm for Future Programmed Evolution Research</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Team_1%27s_Brainstorm_for_Future_Programmed_Evolution_Research&amp;diff=17277"/>
				<updated>2014-05-22T14:41:50Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: /* Our picks */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Barcode of 7 bp (7^4 combinations)&lt;br /&gt;
&lt;br /&gt;
-	Use GGA . . . still have to work out restriction enzyme, other details&lt;br /&gt;
&lt;br /&gt;
Changing internal (genetic) elements…riboswitch, other RBS and origins and chaperones&lt;br /&gt;
&lt;br /&gt;
-	…Using new ones&lt;br /&gt;
&lt;br /&gt;
-	…introducing mutations to improve them&lt;br /&gt;
&lt;br /&gt;
Multistep/more complex pathways?&lt;br /&gt;
&lt;br /&gt;
-	Any other metabolic improvements to caffeine -&amp;gt; theophylline pathway&lt;br /&gt;
&lt;br /&gt;
-	Stopping the pathway converting ameline (guanine deamylase), seeing whether that pathway is absolutely necessary to cell survival. (In the melamine -&amp;gt; ameline -&amp;gt; … pathway)&lt;br /&gt;
&lt;br /&gt;
-	What else besides theophylline? (MWSU “laundry list”)&lt;br /&gt;
&lt;br /&gt;
New fitness modules&lt;br /&gt;
&lt;br /&gt;
-	Testing /improving /adapting the ThyA fitness module&lt;br /&gt;
&lt;br /&gt;
-	Building new fitness modules&lt;br /&gt;
&lt;br /&gt;
==New riboswitches==&lt;br /&gt;
&lt;br /&gt;
Trying new riboswitch that interacts with coenzyme B12&lt;br /&gt;
&lt;br /&gt;
Building a riboswitch&lt;br /&gt;
&lt;br /&gt;
-	…Using/improving Catherine Doyle’s riboswitch builder, which generates potential riboswitch sequences based on a given aptamer sequence&lt;br /&gt;
&lt;br /&gt;
Riboswitch / RBS combo that is a single modular structure (C-Dog?)&lt;br /&gt;
&lt;br /&gt;
Finding a riboswitch that works with ameline&lt;br /&gt;
&lt;br /&gt;
==Our picks==&lt;br /&gt;
&lt;br /&gt;
Cutting off the ammeline pathway mediated by guanine deaminase&lt;br /&gt;
&lt;br /&gt;
Developing new fitness modules / ThyA fitness module&lt;br /&gt;
&lt;br /&gt;
Investigating riboswitch-RBS interactions / finding a hybrid riboswitch / C-dog combo&lt;br /&gt;
&lt;br /&gt;
Testing a new metabolic pathway (including finding a riboswitch for that new pathway)&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Team_1%27s_Brainstorm_for_Future_Programmed_Evolution_Research&amp;diff=17273</id>
		<title>Team 1's Brainstorm for Future Programmed Evolution Research</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Team_1%27s_Brainstorm_for_Future_Programmed_Evolution_Research&amp;diff=17273"/>
				<updated>2014-05-22T14:38:33Z</updated>
		
		<summary type="html">&lt;p&gt;Jolim: /* Our picks */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Barcode of 7 bp (7^4 combinations)&lt;br /&gt;
&lt;br /&gt;
-	Use GGA . . . still have to work out restriction enzyme, other details&lt;br /&gt;
&lt;br /&gt;
Changing internal (genetic) elements…riboswitch, other RBS and origins and chaperones&lt;br /&gt;
&lt;br /&gt;
-	…Using new ones&lt;br /&gt;
&lt;br /&gt;
-	…introducing mutations to improve them&lt;br /&gt;
&lt;br /&gt;
Multistep/more complex pathways?&lt;br /&gt;
&lt;br /&gt;
-	Any other metabolic improvements to caffeine -&amp;gt; theophylline pathway&lt;br /&gt;
&lt;br /&gt;
-	Stopping the pathway converting ameline (guanine deamylase), seeing whether that pathway is absolutely necessary to cell survival. (In the melamine -&amp;gt; ameline -&amp;gt; … pathway)&lt;br /&gt;
&lt;br /&gt;
-	What else besides theophylline? (MWSU “laundry list”)&lt;br /&gt;
&lt;br /&gt;
New fitness modules&lt;br /&gt;
&lt;br /&gt;
-	Testing /improving /adapting the ThyA fitness module&lt;br /&gt;
&lt;br /&gt;
-	Building new fitness modules&lt;br /&gt;
&lt;br /&gt;
==New riboswitches==&lt;br /&gt;
&lt;br /&gt;
Trying new riboswitch that interacts with coenzyme B12&lt;br /&gt;
&lt;br /&gt;
Building a riboswitch&lt;br /&gt;
&lt;br /&gt;
-	…Using/improving Catherine Doyle’s riboswitch builder, which generates potential riboswitch sequences based on a given aptamer sequence&lt;br /&gt;
&lt;br /&gt;
Riboswitch / RBS combo that is a single modular structure (C-Dog?)&lt;br /&gt;
&lt;br /&gt;
Finding a riboswitch that works with ameline&lt;br /&gt;
&lt;br /&gt;
==Our picks==&lt;br /&gt;
&lt;br /&gt;
Cutting off the ammeline pathway mediated by guanine deaminase&lt;br /&gt;
&lt;br /&gt;
Developing new fitness modules / ThyA fitness module&lt;br /&gt;
&lt;br /&gt;
Investigating riboswitch-RBS interactions / finding a hybrid riboswitch / RBS combo&lt;br /&gt;
&lt;br /&gt;
Testing a new metabolic pathway (including finding a riboswitch for that new pathway)&lt;/div&gt;</summary>
		<author><name>Jolim</name></author>	</entry>

	</feed>