<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Wvernon</id>
		<title>GcatWiki - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="http://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Wvernon"/>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Special:Contributions/Wvernon"/>
		<updated>2026-07-01T13:40:58Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.28.2</generator>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=How_do_you_build_the_tRNA_construct%3F&amp;diff=8260</id>
		<title>How do you build the tRNA construct?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=How_do_you_build_the_tRNA_construct%3F&amp;diff=8260"/>
				<updated>2009-06-05T20:51:32Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[http://gcat.davidson.edu/GcatWiki/images/0/01/TRNA_oligos%21.doc New Oligo Plan]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Below is a diagram for the oligos that will make a supD suppressor tRNA.  The four constant oligos called FS_tRNA… will be used repeatedly to make all the different suppressor tRNA genes.  What will change is the two variable oligos in the middle (in this case Pro1_tRNA… which is one of MWSU’s supp. tRNAs).  Also, the top strand will have the BioBrick prefix and suffix and sticky ends for EcoRI and PstI on the 5’ and 3’ ends.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Image:SupD_Diagram_pic2.GIF  |650px|]]&lt;br /&gt;
&lt;br /&gt;
Below are the DNA sequences for the four constant oligos.  &lt;br /&gt;
&lt;br /&gt;
FS_tRNA_5’top&lt;br /&gt;
&lt;br /&gt;
5’ AATTCGCGGCCGCTTCTAGAGGGATCCAATTCGGAGAGATGCCG 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_3’top&lt;br /&gt;
&lt;br /&gt;
5’ GCCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC&lt;br /&gt;
CACTGCATATCCTTAGCGAAAGCTAAGGATTTTTTTTAAGCTTACTAGTAGCGGCCGCTGCA 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_5’bottom&lt;br /&gt;
&lt;br /&gt;
5’CGGCCGCTACTAGTAAGCTTAAAAAAAATCCTTAGCTTTCGCTAAGGA&lt;br /&gt;
TATGCAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGG 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_3’bottom&lt;br /&gt;
&lt;br /&gt;
5’ACCGGTCCGTTCAGCCGCTCCGGCATCTCTCCGAATTGGATCCCTCTA&lt;br /&gt;
GAAGCGGCCGC 3’ &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Below is an example for the two variable oligos in the middle.  This particular sequence is for the Pro1 suppressor.  The red letters on the top strand are the anticodon loop. The red letters on the bottom strand are the complementary bases to this anticodon loop.  The red bases are the only ones that will be different depending on the supp. being used.&lt;br /&gt;
&lt;br /&gt;
Pro1_tRNA_Top&lt;br /&gt;
&lt;br /&gt;
5’ GAGCGGCTGAACGGACCGGTCTATTGGACA 3’&lt;br /&gt;
&lt;br /&gt;
Pro1_tRNA_Bottom&lt;br /&gt;
&lt;br /&gt;
5’ TAGAGTTGCCCCTACTCCGGTGTCCAATAG 3’&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:TRNA_oligos!.doc&amp;diff=8259</id>
		<title>File:TRNA oligos!.doc</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:TRNA_oligos!.doc&amp;diff=8259"/>
				<updated>2009-06-05T20:50:47Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=IGEM_2009_Project&amp;diff=8242</id>
		<title>IGEM 2009 Project</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=IGEM_2009_Project&amp;diff=8242"/>
				<updated>2009-06-04T20:58:45Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Biology Based:&lt;br /&gt;
#[[Which reporters are we going to use?]]&lt;br /&gt;
#[[What naming system are we going to use for the suppressor tRNAs?]]&lt;br /&gt;
#[[How do you build the tRNA construct?]]&lt;br /&gt;
#[[How are we going to build the 5-mer BioBricks?]]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/2/2c/Stop_Codons_in_LCs.doc Using Stop Codons to Truncate Translation]&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/8/81/D5merSequences.doc Davidson ATG+5mer BioBrick Sequences]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/4/47/FML_CODING_SEQUENCE_2.doc Frameshift Mutation Leader PCR primers]&lt;br /&gt;
&lt;br /&gt;
Math Based:&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:FML_CODING_SEQUENCE_2.doc&amp;diff=8241</id>
		<title>File:FML CODING SEQUENCE 2.doc</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:FML_CODING_SEQUENCE_2.doc&amp;diff=8241"/>
				<updated>2009-06-04T20:56:45Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=How_do_you_build_the_tRNA_construct%3F&amp;diff=8240</id>
		<title>How do you build the tRNA construct?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=How_do_you_build_the_tRNA_construct%3F&amp;diff=8240"/>
				<updated>2009-06-04T19:32:52Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Below is a diagram for the oligos that will make a supD suppressor tRNA.  The four constant oligos called FS_tRNA… will be used repeatedly to make all the different suppressor tRNA genes.  What will change is the two variable oligos in the middle (in this case Pro1_tRNA… which is one of MWSU’s supp. tRNAs).  Also, the top strand will have the BioBrick prefix and suffix and sticky ends for EcoRI and PstI on the 5’ and 3’ ends.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Image:SupD_Diagram_pic2.GIF  |650px|]]&lt;br /&gt;
&lt;br /&gt;
Below are the DNA sequences for the four constant oligos.  &lt;br /&gt;
&lt;br /&gt;
FS_tRNA_5’top&lt;br /&gt;
&lt;br /&gt;
5’ AATTCGCGGCCGCTTCTAGAGGGATCCAATTCGGAGAGATGCCG 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_3’top&lt;br /&gt;
&lt;br /&gt;
5’ GCCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC&lt;br /&gt;
CACTGCATATCCTTAGCGAAAGCTAAGGATTTTTTTTAAGCTTACTAGTAGCGGCCGCTGCA 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_5’bottom&lt;br /&gt;
&lt;br /&gt;
5’CGGCCGCTACTAGTAAGCTTAAAAAAAATCCTTAGCTTTCGCTAAGGA&lt;br /&gt;
TATGCAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGG 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_3’bottom&lt;br /&gt;
&lt;br /&gt;
5’ACCGGTCCGTTCAGCCGCTCCGGCATCTCTCCGAATTGGATCCCTCTA&lt;br /&gt;
GAAGCGGCCGC 3’ &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Below is an example for the two variable oligos in the middle.  This particular sequence is for the Pro1 suppressor.  The red letters on the top strand are the anticodon loop. The red letters on the bottom strand are the complementary bases to this anticodon loop.  The red bases are the only ones that will be different depending on the supp. being used.&lt;br /&gt;
&lt;br /&gt;
Pro1_tRNA_Top&lt;br /&gt;
&lt;br /&gt;
5’ GAGCGGCTGAACGGACCGGTCTATTGGACA 3’&lt;br /&gt;
&lt;br /&gt;
Pro1_tRNA_Bottom&lt;br /&gt;
&lt;br /&gt;
5’ TAGAGTTGCCCCTACTCCGGTGTCCAATAG 3’&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:SupD_Diagram_pic2.GIF&amp;diff=8239</id>
		<title>File:SupD Diagram pic2.GIF</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:SupD_Diagram_pic2.GIF&amp;diff=8239"/>
				<updated>2009-06-04T19:32:37Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=How_do_you_build_the_tRNA_construct%3F&amp;diff=8238</id>
		<title>How do you build the tRNA construct?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=How_do_you_build_the_tRNA_construct%3F&amp;diff=8238"/>
				<updated>2009-06-04T19:23:57Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Below is a diagram for the oligos that will make a supD suppressor tRNA.  The four constant oligos called FS_tRNA… will be used repeatedly to make all the different suppressor tRNA genes.  What will change is the two variable oligos in the middle (in this case Pro1_tRNA… which is one of MWSU’s supp. tRNAs).  Also, the top strand will have the BioBrick prefix and suffix and sticky ends for EcoRI and PstI on the 5’ and 3’ ends.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Image:SupD_Diagram_pic.GIF  |650px|]]&lt;br /&gt;
&lt;br /&gt;
Below are the DNA sequences for the four constant oligos.  &lt;br /&gt;
&lt;br /&gt;
FS_tRNA_5’top&lt;br /&gt;
&lt;br /&gt;
5’ AATTCGCGGCCGCTTCTAGAGGGATCCAATTCGGAGAGATGCCG 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_3’top&lt;br /&gt;
&lt;br /&gt;
5’ GCCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC&lt;br /&gt;
CACTGCATATCCTTAGCGAAAGCTAAGGATTTTTTTTAAGCTTACTAGTAGCGGCCGCTGCA 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_5’bottom&lt;br /&gt;
&lt;br /&gt;
5’CGGCCGCTACTAGTAAGCTTAAAAAAAATCCTTAGCTTTCGCTAAGGA&lt;br /&gt;
TATGCAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGG 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_3’bottom&lt;br /&gt;
&lt;br /&gt;
5’ACCGGTCCGTTCAGCCGCTCCGGCATCTCTCCGAATTGGATCCCTCTA&lt;br /&gt;
GAAGCGGCCGC 3’ &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Below is an example for the two variable oligos in the middle.  This particular sequence is for the Pro1 suppressor.  The red letters on the top strand are the anticodon loop. The red letters on the bottom strand are the complementary bases to this anticodon loop.  The red bases are the only ones that will be different depending on the supp. being used.&lt;br /&gt;
&lt;br /&gt;
Pro1_tRNA_Top&lt;br /&gt;
&lt;br /&gt;
5’ GAGCGGCTGAACGGACCGGTCTATTGGACA 3’&lt;br /&gt;
&lt;br /&gt;
Pro1_tRNA_Bottom&lt;br /&gt;
&lt;br /&gt;
5’ TAGAGTTGCCCCTACTCCGGTGTCCAATAG 3’&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=How_do_you_build_the_tRNA_construct%3F&amp;diff=8237</id>
		<title>How do you build the tRNA construct?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=How_do_you_build_the_tRNA_construct%3F&amp;diff=8237"/>
				<updated>2009-06-04T17:47:40Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Below is a diagram for the oligos that will make a supD suppressor tRNA.  The four constant oligos called FS_tRNA… will be used repeatedly to make all the different suppressor tRNA genes.  What will change is the two variable oligos in the middle (in this case Pro1_tRNA… which is one of MWSU’s supp. tRNAs).  Also, the top strand will have the BioBrick prefix and suffix and sticky ends for EcoRI and PstI on the 5’ and 3’ ends.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Image:SupD_Diagram_pic.GIF  |650px|]]&lt;br /&gt;
&lt;br /&gt;
Below are the DNA sequences for the four constant oligos.  &lt;br /&gt;
&lt;br /&gt;
FS_tRNA_5’top&lt;br /&gt;
&lt;br /&gt;
5’ AATTCGCGGCCGCTTCTAGAGGGATCCAATTCGGAGAGATGCCG 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_3’top&lt;br /&gt;
&lt;br /&gt;
5’ CCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC&lt;br /&gt;
CACTGCATATCCTTAGCGAAAGCTAAGGATTTTTTTTAAGCTTACTAGTAGCGGCCGCTGCA 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_5’bottom&lt;br /&gt;
&lt;br /&gt;
5’CGGCCGCTACTAGTAAGCTTAAAAAAAATCCTTAGCTTTCGCTAAGGA&lt;br /&gt;
TATGCAGTGGCGGAGAGAGGGGGATTTGAACCCCCGG 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_3’bottom&lt;br /&gt;
&lt;br /&gt;
5’ACCGGTCCGTTCAGCCGCTCCGGCATCTCTCCGAATTGGATCCCTCTA&lt;br /&gt;
GAAGCGGCCGC 3’ &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Below is an example for the two variable oligos in the middle.  This particular sequence is for the Pro1 suppressor.  The red letters on the top strand are the anticodon loop. The red letters on the bottom strand are the complementary bases to this anticodon loop.  The red bases are the only ones that will be different depending on the supp. being used.&lt;br /&gt;
&lt;br /&gt;
Pro1_tRNA_Top&lt;br /&gt;
&lt;br /&gt;
5’ GAGCGGCTGAACGGACCGGTCTATTGGACA 3’&lt;br /&gt;
&lt;br /&gt;
Pro1_tRNA_Bottom&lt;br /&gt;
&lt;br /&gt;
5’ TAGAGTTGCCCCTACTCCGGTGTCCAATAG 3’&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=How_do_you_build_the_tRNA_construct%3F&amp;diff=8236</id>
		<title>How do you build the tRNA construct?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=How_do_you_build_the_tRNA_construct%3F&amp;diff=8236"/>
				<updated>2009-06-04T16:45:10Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Below is a diagram for the oligos that will make a supD suppressor tRNA.  The four constant oligos called FS_tRNA… will be used repeatedly to make all the different suppressor tRNA genes.  What will change is the two variable oligos in the middle (in this case Pro1_tRNA… which is one of MWSU’s supp. tRNAs).  Also, the top strand will have the BioBrick prefix and suffix and sticky ends for EcoRI and PstI on the 5’ and 3’ ends.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Image:SupD_Diagram_pic.GIF  |650px|]]&lt;br /&gt;
&lt;br /&gt;
Below are the DNA sequences for the four constant oligos.  &lt;br /&gt;
&lt;br /&gt;
FS_tRNA_5’top&lt;br /&gt;
&lt;br /&gt;
5’ AATTCGCGGCCGCTTCTAGAGGGATCCAATTCGGAGAGATGCCG 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_3’top&lt;br /&gt;
&lt;br /&gt;
5’ CCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC&lt;br /&gt;
CACTGCATATCCTTAGCGAAAGCTAAGGATTTTTTTTAAGCTTACTAGTAGCGGCCGCTGCA 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_5’bottom&lt;br /&gt;
&lt;br /&gt;
5’CGGCCGCTACTAGTAAGCTTAAAAAAAATCCTTAGCTTTCGCTAAGGA&lt;br /&gt;
TATGCAGTGGCGGAGAGAGGGGGATTTGAACCCCCGG 3’&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
FS_tRNA_3’bottom&lt;br /&gt;
&lt;br /&gt;
5’ACCGGTCCGTTCAGCCGCTCCGGCATCTCTCCGAATTGGATCCCTCTA&lt;br /&gt;
GAAGCGGCCGC 3’ &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Below is an example for the two variable oligos in the middle.  This particular sequence is for the Pro1 suppressor.  The red letters on the top strand are the anticodon loop. The red letters on the bottom strand are the complementary bases to this anticodon loop.  The red bases are the only ones that will be different depending on the supp. being used.&lt;br /&gt;
&lt;br /&gt;
Pro1_tRNA_Top&lt;br /&gt;
&lt;br /&gt;
5’ GAGCGGCTGAACGGACCGGTCTATTGGACA 3’&lt;br /&gt;
&lt;br /&gt;
Pro2_tRNA_Bottom&lt;br /&gt;
&lt;br /&gt;
5’ TAGAGTTGCCCCTACTCCGGTGTCCAATAG 3’&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:SupD_Diagram_pic.GIF&amp;diff=8235</id>
		<title>File:SupD Diagram pic.GIF</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:SupD_Diagram_pic.GIF&amp;diff=8235"/>
				<updated>2009-06-04T16:41:40Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=8147</id>
		<title>Can we solve a 3-SAT problem with supressor logic?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=8147"/>
				<updated>2009-06-02T13:28:30Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: /* How could suppressor logic be used to solve the Sakamoto 3-SAT problem? */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== What is the 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
''Advantages/Disadvantages to using the 3 SAT problem''&lt;br /&gt;
&lt;br /&gt;
Advantages:&lt;br /&gt;
&lt;br /&gt;
1) Seems to have an equal balance of mathematics and biology.&lt;br /&gt;
&lt;br /&gt;
2) Eventually, there is promise to make the problem difficult enough whereas a computer would have a hard time solving it.&lt;br /&gt;
&lt;br /&gt;
3) Introducing a new concept (supressor supressor logic)&lt;br /&gt;
&lt;br /&gt;
Disadvantages:&lt;br /&gt;
&lt;br /&gt;
1) Using the same concept/idea that has been used by previous Missouri Western/Davidson iGEM teams. (XOR gate)&lt;br /&gt;
&lt;br /&gt;
2) Finding enough for everyone to work on for the entire summer.&lt;br /&gt;
&lt;br /&gt;
3) Finding a promoter that is turned on without the use of a small particle.&lt;br /&gt;
&lt;br /&gt;
== How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem? == &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Sakamoto_DNA_computer_3SAT.pdf Sakamoto et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:hairpin2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
Sakamoto used hairpin formations in single stranded DNA (ssDNA) as a molecular computer. Hairpin structures are formed when complimentary bases on the same strand attach to each other forming a loop. As shown in Picture B above, C and -C are compliments of each other, and bind together. Picture A is what a normal ssDNA should look like. Sakamoto used this self assembly of secondary structures on a satisfiability (SAT) problem. The problem had six inputs and ten clauses. An example of a clause would be (a or b or -c), and could include any combinations of inputs from a to f including -a to -f. If the problem is satisfied, the ssDNA stays in it's normal form. If the problem is not satisfied, the ssDNA forms a hairpin. Later in the paper it explains that the hairpin forming molecules can be removed from the others with certain techniques. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The 10 clause 3-SAT problem solved in the paper is:&lt;br /&gt;
&lt;br /&gt;
(a or b or –c)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or d) &amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or e)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or d or –f)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
note: this problem uses inputs of a, b, c, d, e, -a, -c, -d, -f (f, -b, -e are not used)&lt;br /&gt;
&lt;br /&gt;
== What is suppressor logic? ==&lt;br /&gt;
&lt;br /&gt;
Will's Version of the PPT for SSL 3SAT&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/Will%27s_SSL_3SAT.ppt Will's Version of the PPT for SSL 3SAT]&lt;br /&gt;
&lt;br /&gt;
Powerpoint on 3SAT SSL (Bryce and Clif) I don't know how to post the powerpoint on here.&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/d/d1/3SAT_ppt-1-.ppt Bryce and Clif's Version]&lt;br /&gt;
&lt;br /&gt;
'''Suppressor Logic uses suppressor tRNAs as inputs to avoid frameshift mutations in the production of an output amino acid sequence'''&lt;br /&gt;
&lt;br /&gt;
A frameshift is a genetic mutation caused by the addition or deletion of nucelotides to a given sequence which codes for a protein.  Since codons are read in a series of three, the addition or deletion of nucleotides will disrupt the reading frame.  This disruption will most likely cause the production of a nonfunctional protein.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor4.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
A frameshift occurs and, in this case, a guanine is added to the sequence.  If nothing is done, enzyme A will not be made, meaning the clause will not be satisfied.&lt;br /&gt;
&lt;br /&gt;
The suppressor tRNA allows the 4 letter sequence to be read as a single codon, therefore, keeping the protein on track.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
If more than one frameshift mutation is introduced into a coding sequence, then logical operators can be encoded. Suppressor a binds to CCCG, supressor b binds to CUGC, and suppressor c binds to ACCG below:&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
# AUG CCCG CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG CUGC CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG  gg CUGC AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG gg CUGC gg ACCG AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Construct&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Gene&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Logical operation&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Phenotype || a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Phenotype || a AND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Phenotype || a OR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Phenotype || a OR b OR c&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Repressor|| NOT a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Repressor|| a NAND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Repressor|| a NOR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Repressor|| NOT (a OR b OR c)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Logical clauses can be connected by AND operators if the proteins produced are part of a biochemical pathway.'''  In this case, a AND b AND c: &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== How could suppressor logic be used to solve the Sakamoto 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/2/2c/Stop_Codons_in_LCs.doc Using Stop Codons to Truncate Translation]&lt;br /&gt;
&lt;br /&gt;
'''Definitions'''&lt;br /&gt;
&lt;br /&gt;
Inputs = framshift suppressor tRNAs &lt;br /&gt;
&lt;br /&gt;
Input value = supp a is 1, supp g is 0; supp b is 1, supp h is 0, etc. up to tth 6th pair of f and l&lt;br /&gt;
&lt;br /&gt;
Logical clause (LC) = three inputs connected by OR, eg. (a OR b OR e)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
LC using 4-base frameshift mutations:  cag CCCG aa GGGC tt GTTG cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
LC using 5-base frameshift mutations:  cag CCCGC a GGGCG t GTTGC cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This makes an XOR logic gate as only one suppressor can be used at one time to maintain the reading frame.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Logical expression (LE) = string of LCs connected by AND &amp;lt;br&amp;gt;&lt;br /&gt;
The design below encodes LC1 AND LC2 AND LC3 &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:logical expression2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Subroutine'''&lt;br /&gt;
&lt;br /&gt;
1. Individual bacteral cells use Hin/hix system to randomly choose of of the 64 possible combinations of 6 inputs.  Suppressors a and g represent 1 and 0 for the first input; suppressors b and h are 1 and 0 for the second input; etc. up to the sixth input with suppressors f and l (lower case L).  The triangles are hix sites for Hin recombination.  Whichever of the two suppressor tRNAs in an input pair is facing forward determines whether the value of that input is 1 or 0.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor inputs.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
2. Each bacterial cell carries out the following subroutine on each LC: IF LC=TRUE THEN &amp;quot;check the next LC&amp;quot; ELSEIF LC=FALSE &amp;quot;go get a new set of inputs with step 1&amp;quot;  In order to do this, each of the activators below must turn on a repressor that turns off Hin production.  Then if one of the activators is not made, Hin will be made, and new inputs will be established.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:LE circuit.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
3. If/when a bacterial cell finds a set of inputs that satisfies the entire LE (ie. a solution to the 3-SAT problem), it will glow green.&lt;br /&gt;
&lt;br /&gt;
== Things we need to learn about ==&lt;br /&gt;
&lt;br /&gt;
'''Note: We would need 12 different frameshift suppressor tRNAs to encode the Sakamoto 3-SAT problem'''&lt;br /&gt;
&lt;br /&gt;
'''Discovery of frameshift tRNAs.  How many are known?'''  &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/5/59/MaglierySchultz2001JMB.pdf Magliery, Anderson, Schultz]&lt;br /&gt;
&lt;br /&gt;
Library approach used to discover efficient suppressors of four-base codons AGGA, UAGA, CCCU, and CUAG using mutated versions of serine tRNA.&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf  Anderson, Maglieri, Schultz]&lt;br /&gt;
&lt;br /&gt;
Signals for translational bypassing (slipping and hopping): mRNA secondary structure, &amp;quot;hungry&amp;quot; (underused) codons, upstream Shine-Dalgarno-like (RBS) sequences &amp;lt;br&amp;gt;&lt;br /&gt;
Library approach extended in order to discover frameshift suppressor tRNAs with anticodons of size two to six bases.  Two-base and six-base suppressors were not found, but the following five-base suppressors were found: &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/e/e0/PNAS-2006-Rodriguez-8650-5.pdf Rodriguez, Lester, Dougherty]&lt;br /&gt;
&lt;br /&gt;
[http://www.sciencedirect.com/science?_ob=ArticleURL&amp;amp;_udi=B6T36-4HM7N2R-G&amp;amp;_user=2665120&amp;amp;_rdoc=1&amp;amp;_fmt=&amp;amp;_orig=search&amp;amp;_sort=d&amp;amp;view=c&amp;amp;_acct=C000058476&amp;amp;_version=1&amp;amp;_urlVersion=0&amp;amp;_userid=2665120&amp;amp;md5=d2dda7b99095c256fd459f2f6c82b493 3 Suppressor tRNAs in a single protein, in vitro]&lt;br /&gt;
&lt;br /&gt;
[http://jb.asm.org/cgi/content/abstract/158/3/849 Three suppressor tRNAs in vivo (E. coli)]&lt;br /&gt;
&lt;br /&gt;
Incorporating unnatural amino acids using frameshift suppression.  They used three in one eukaryotic cell.&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:Table2_Anderson2002.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/a/ac/Dunham_2009_tRNA_structure.pdf Dunham et al.]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/c/c3/Hohsaka_2009_in_vitro_tln.pdf Hohsaka et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Processing of tRNA precursors in E. coli''' &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://www.nature.com/embor/journal/v2/n1/full/embor501.html Mörl and Marchfelder] describe processing &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:the_final_cut.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''How many different frameshift suppressor tRNAs can be in one cell without causing toxicity?'''&lt;br /&gt;
&lt;br /&gt;
Can we have twelve of them?  If not, what is the maximum?  Is there an impact of codon usage on this?&lt;br /&gt;
&lt;br /&gt;
Can we have both 4- and 5-base suppressor tRNAs in one cell?&lt;br /&gt;
&lt;br /&gt;
Are there particular combinations of suppressors that are more tolerated than others?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''How many frameshift mutations can be suppressed in a single gene?'''&lt;br /&gt;
&lt;br /&gt;
How close together can the frameshift mutations of a given LC be?&lt;br /&gt;
&lt;br /&gt;
Can we mix 4- and 5-base frameshift mutations in a given LC?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Stop_Codons_in_LCs.doc&amp;diff=8146</id>
		<title>File:Stop Codons in LCs.doc</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Stop_Codons_in_LCs.doc&amp;diff=8146"/>
				<updated>2009-06-02T13:23:47Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Plasmid_Creation&amp;diff=8099</id>
		<title>Plasmid Creation</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Plasmid_Creation&amp;diff=8099"/>
				<updated>2009-05-27T18:05:11Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[http://nar.oxfordjournals.org/cgi/content/full/37/2/e16#F5 In vivo self assembled vector]&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=8094</id>
		<title>Can we solve a 3-SAT problem with supressor logic?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=8094"/>
				<updated>2009-05-27T14:36:37Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: /* Things we need to learn about */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== What is the 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
''Advantages/Disadvantages to using the 3 SAT problem''&lt;br /&gt;
&lt;br /&gt;
Advantages:&lt;br /&gt;
&lt;br /&gt;
1) Seems to have an equal balance of mathematics and biology.&lt;br /&gt;
&lt;br /&gt;
2) Eventually, there is promise to make the problem difficult enough whereas a computer would have a hard time solving it.&lt;br /&gt;
&lt;br /&gt;
3) Introducing a new concept (supressor supressor logic)&lt;br /&gt;
&lt;br /&gt;
Disadvantages:&lt;br /&gt;
&lt;br /&gt;
1) Using the same concept/idea that has been used by previous Missouri Western/Davidson iGEM teams. (XOR gate)&lt;br /&gt;
&lt;br /&gt;
2) Finding enough for everyone to work on for the entire summer.&lt;br /&gt;
&lt;br /&gt;
3) Finding a promoter that is turned on without the use of a small particle.&lt;br /&gt;
&lt;br /&gt;
== How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem? == &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Sakamoto_DNA_computer_3SAT.pdf Sakamoto et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:hairpin2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
Sakamoto used hairpin formations in single stranded DNA (ssDNA) as a molecular computer. Hairpin structures are formed when complimentary bases on the same strand attach to each other forming a loop. As shown in Picture B above, C and -C are compliments of each other, and bind together. Picture A is what a normal ssDNA should look like. Sakamoto used this self assembly of secondary structures on a satisfiability (SAT) problem. The problem had six inputs and ten clauses. An example of a clause would be (a or b or -c), and could include any combinations of inputs from a to f including -a to -f. If the problem is satisfied, the ssDNA stays in it's normal form. If the problem is not satisfied, the ssDNA forms a hairpin. Later in the paper it explains that the hairpin forming molecules can be removed from the others with certain techniques. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The 10 clause 3-SAT problem solved in the paper is:&lt;br /&gt;
&lt;br /&gt;
(a or b or –c)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or d) &amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or e)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or d or –f)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
note: this problem uses inputs of a, b, c, d, e, -a, -c, -d, -f (f, -b, -e are not used)&lt;br /&gt;
&lt;br /&gt;
== What is suppressor logic? ==&lt;br /&gt;
&lt;br /&gt;
Will's Version of the PPT for SSL 3SAT&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/Will%27s_SSL_3SAT.ppt Will's Version of the PPT for SSL 3SAT]&lt;br /&gt;
&lt;br /&gt;
Powerpoint on 3SAT SSL (Bryce and Clif) I don't know how to post the powerpoint on here.&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/d/d1/3SAT_ppt-1-.ppt Bryce and Clif's Version]&lt;br /&gt;
&lt;br /&gt;
'''Suppressor Logic uses suppressor tRNAs as inputs to avoid frameshift mutations in the production of an output amino acid sequence'''&lt;br /&gt;
&lt;br /&gt;
A frameshift is a genetic mutation caused by the addition or deletion of nucelotides to a given sequence which codes for a protein.  Since codons are read in a series of three, the addition or deletion of nucleotides will disrupt the reading frame.  This disruption will most likely cause the production of a nonfunctional protein.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor4.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
A frameshift occurs and, in this case, a guanine is added to the sequence.  If nothing is done, enzyme A will not be made, meaning the clause will not be satisfied.&lt;br /&gt;
&lt;br /&gt;
The suppressor tRNA allows the 4 letter sequence to be read as a single codon, therefore, keeping the protein on track.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
If more than one frameshift mutation is introduced into a coding sequence, then logical operators can be encoded. Suppressor a binds to CCCG, supressor b binds to CUGC, and suppressor c binds to ACCG below:&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
# AUG CCCG CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG CUGC CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG  gg CUGC AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG gg CUGC gg ACCG AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Construct&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Gene&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Logical operation&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Phenotype || a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Phenotype || a AND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Phenotype || a OR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Phenotype || a OR b OR c&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Repressor|| NOT a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Repressor|| a NAND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Repressor|| a NOR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Repressor|| NOT (a OR b OR c)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Logical clauses can be connected by AND operators if the proteins produced are part of a biochemical pathway.'''  In this case, a AND b AND c: &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== How could suppressor logic be used to solve the Sakamoto 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
'''Definitions'''&lt;br /&gt;
&lt;br /&gt;
Inputs = framshift suppressor tRNAs &lt;br /&gt;
&lt;br /&gt;
Input value = supp a is 1, supp g is 0; supp b is 1, supp h is 0, etc. up to tth 6th pair of f and l&lt;br /&gt;
&lt;br /&gt;
Logical clause (LC) = three inputs connected by OR, eg. (a OR b OR e)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
LC using 4-base frameshift mutations:  cag CCCG aa GGGC tt GTTG cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
LC using 5-base frameshift mutations:  cag CCCGC a GGGCG t GTTGC cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This makes an XOR logic gate as only one suppressor can be used at one time to maintain the reading frame.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Logical expression (LE) = string of LCs connected by AND &amp;lt;br&amp;gt;&lt;br /&gt;
The design below encodes LC1 AND LC2 AND LC3 &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:logical expression2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Subroutine'''&lt;br /&gt;
&lt;br /&gt;
1. Individual bacteral cells use Hin/hix system to randomly choose of of the 64 possible combinations of 6 inputs.  Suppressors a and g represent 1 and 0 for the first input; suppressors b and h are 1 and 0 for the second input; etc. up to the sixth input with suppressors f and l (lower case L).  The triangles are hix sites for Hin recombination.  Whichever of the two suppressor tRNAs in an input pair is facing forward determines whether the value of that input is 1 or 0.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor inputs.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
2. Each bacterial cell carries out the following subroutine on each LC: IF LC=TRUE THEN &amp;quot;check the next LC&amp;quot; ELSEIF LC=FALSE &amp;quot;go get a new set of inputs with step 1&amp;quot;  In order to do this, each of the activators below must turn on a repressor that turns off Hin production.  Then if one of the activators is not made, Hin will be made, and new inputs will be established.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:LE circuit.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
3. If/when a bacterial cell finds a set of inputs that satisfies the entire LE (ie. a solution to the 3-SAT problem), it will glow green.&lt;br /&gt;
&lt;br /&gt;
== Things we need to learn about ==&lt;br /&gt;
&lt;br /&gt;
'''Note: We would need 12 different frameshift suppressor tRNAs to encode the Sakamoto 3-SAT problem'''&lt;br /&gt;
&lt;br /&gt;
'''Discovery of frameshift tRNAs.  How many are known?'''  &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/5/59/MaglierySchultz2001JMB.pdf Magliery, Anderson, Schultz]&lt;br /&gt;
&lt;br /&gt;
Library approach used to discover efficient suppressors of four-base codons AGGA, UAGA, CCCU, and CUAG using mutated versions of serine tRNA.&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf  Anderson, Maglieri, Schultz]&lt;br /&gt;
&lt;br /&gt;
Signals for translational bypassing (slipping and hopping): mRNA secondary structure, &amp;quot;hungry&amp;quot; (underused) codons, upstream Shine-Dalgarno-like (RBS) sequences &amp;lt;br&amp;gt;&lt;br /&gt;
Library approach extended in order to discover frameshift suppressor tRNAs with anticodons of size two to six bases.  Two-base and six-base suppressors were not found, but the following five-base suppressors were found: &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/e/e0/PNAS-2006-Rodriguez-8650-5.pdf Rodriguez, Lester, Dougherty]&lt;br /&gt;
&lt;br /&gt;
Incorporating unnatural amino acids using frameshift suppression.  They used three in one eukaryotic cell.&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:Table2_Anderson2002.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/a/ac/Dunham_2009_tRNA_structure.pdf Dunham et al.]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/c/c3/Hohsaka_2009_in_vitro_tln.pdf Hohsaka et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Processing of tRNA precursors in E. coli''' &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://www.nature.com/embor/journal/v2/n1/full/embor501.html Mörl and Marchfelder] describe processing &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:the_final_cut.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''How many different frameshift suppressor tRNAs can be in one cell without causing toxicity?'''&lt;br /&gt;
&lt;br /&gt;
Can we have twelve of them?  If not, what is the maximum?  Is there an impact of codon usage on this?&lt;br /&gt;
&lt;br /&gt;
Can we have both 4- and 5-base suppressor tRNAs in one cell?&lt;br /&gt;
&lt;br /&gt;
Are there particular combinations of suppressors that are more tolerated than others?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''How many frameshift mutations can be suppressed in a single gene?'''&lt;br /&gt;
&lt;br /&gt;
How close together can the frameshift mutations of a given LC be?&lt;br /&gt;
&lt;br /&gt;
Can we mix 4- and 5-base frameshift mutations in a given LC?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:PNAS-2006-Rodriguez-8650-5.pdf&amp;diff=8093</id>
		<title>File:PNAS-2006-Rodriguez-8650-5.pdf</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:PNAS-2006-Rodriguez-8650-5.pdf&amp;diff=8093"/>
				<updated>2009-05-27T14:32:08Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=8019</id>
		<title>Can we solve a 3-SAT problem with supressor logic?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=8019"/>
				<updated>2009-05-22T01:51:34Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: /* What is suppressor logic? */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== What is the 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
''Advantages/Disadvantages to using the 3 SAT problem''&lt;br /&gt;
&lt;br /&gt;
Advantages:&lt;br /&gt;
&lt;br /&gt;
1) Seems to have an equal balance of mathematics and biology.&lt;br /&gt;
&lt;br /&gt;
2) Eventually, there is promise to make the problem difficult enough whereas a computer would have a hard time solving it.&lt;br /&gt;
&lt;br /&gt;
3) Introducing a new concept (supressor supressor logic)&lt;br /&gt;
&lt;br /&gt;
Disadvantages:&lt;br /&gt;
&lt;br /&gt;
1) Using the same concept/idea that has been used by previous Missouri Western/Davidson iGEM teams. (XOR gate)&lt;br /&gt;
&lt;br /&gt;
2) Finding enough for everyone to work on for the entire summer.&lt;br /&gt;
&lt;br /&gt;
3) Finding a promoter that is turned on without the use of a small particle.&lt;br /&gt;
&lt;br /&gt;
== How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem? == &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Sakamoto_DNA_computer_3SAT.pdf Sakamoto et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:hairpin2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
Sakamoto used hairpin formations in single stranded DNA (ssDNA) as a molecular computer. Hairpin structures are formed when complimentary bases on the same strand attach to each other forming a loop. As shown in Picture B above, C and -C are compliments of each other, and bind together. Picture A is what a normal ssDNA should look like. Sakamoto used this self assembly of secondary structures on a satisfiability (SAT) problem. The problem had six inputs and ten clauses. An example of a clause would be (a or b or -c), and could include any combinations of inputs from a to f including -a to -f. If the problem is satisfied, the ssDNA stays in it's normal form. If the problem is not satisfied, the ssDNA forms a hairpin. Later in the paper it explains that the hairpin forming molecules can be removed from the others with certain techniques. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The 10 clause 3-SAT problem solved in the paper is:&lt;br /&gt;
&lt;br /&gt;
(a or b or –c)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or d) &amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or e)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or d or –f)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
note: this problem uses inputs of a, b, c, d, e, -a, -c, -d, -f (f, -b, -e are not used)&lt;br /&gt;
&lt;br /&gt;
== What is suppressor logic? ==&lt;br /&gt;
&lt;br /&gt;
Will's Version of the PPT for SSL 3SAT&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/Will%27s_SSL_3SAT.ppt Will's Version of the PPT for SSL 3SAT]&lt;br /&gt;
&lt;br /&gt;
Powerpoint on 3SAT SSL (Bryce and Clif) I don't know how to post the powerpoint on here.&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/d/d1/3SAT_ppt-1-.ppt Bryce and Clif's Version]&lt;br /&gt;
&lt;br /&gt;
'''Suppressor Logic uses suppressor tRNAs as inputs to avoid frameshift mutations in the production of an output amino acid sequence'''&lt;br /&gt;
&lt;br /&gt;
A frameshift is a genetic mutation caused by the addition or deletion of nucelotides to a given sequence which codes for a protein.  Since codons are read in a series of three, the addition or deletion of nucleotides will disrupt the reading frame.  This disruption will most likely cause the production of a nonfunctional protein.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor4.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
A frameshift occurs and, in this case, a guanine is added to the sequence.  If nothing is done, enzyme A will not be made, meaning the clause will not be satisfied.&lt;br /&gt;
&lt;br /&gt;
The suppressor tRNA allows the 4 letter sequence to be read as a single codon, therefore, keeping the protein on track.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
If more than one frameshift mutation is introduced into a coding sequence, then logical operators can be encoded. Suppressor a binds to CCCG, supressor b binds to CUGC, and suppressor c binds to ACCG below:&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
# AUG CCCG CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG CUGC CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG  gg CUGC AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG gg CUGC gg ACCG AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Construct&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Gene&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Logical operation&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Phenotype || a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Phenotype || a AND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Phenotype || a OR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Phenotype || a OR b OR c&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Repressor|| NOT a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Repressor|| a NAND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Repressor|| a NOR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Repressor|| NOT (a OR b OR c)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Logical clauses can be connected by AND operators if the proteins produced are part of a biochemical pathway.'''  In this case, a AND b AND c: &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== How could suppressor logic be used to solve the Sakamoto 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
'''Definitions'''&lt;br /&gt;
&lt;br /&gt;
Inputs = framshift suppressor tRNAs &lt;br /&gt;
&lt;br /&gt;
Input value = supp a is 1, supp g is 0; supp b is 1, supp h is 0, etc. up to tth 6th pair of f and l&lt;br /&gt;
&lt;br /&gt;
Logical clause (LC) = three inputs connected by OR, eg. (a OR b OR e)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
LC using 4-base frameshift mutations:  cag CCCG aa GGGC tt GTTG cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
LC using 5-base frameshift mutations:  cag CCCGC a GGGCG t GTTGC cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This makes an XOR logic gate as only one suppressor can be used at one time to maintain the reading frame.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Logical expression (LE) = string of LCs connected by AND &amp;lt;br&amp;gt;&lt;br /&gt;
The design below encodes LC1 AND LC2 AND LC3 &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:logical expression2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Subroutine'''&lt;br /&gt;
&lt;br /&gt;
1. Individual bacteral cells use Hin/hix system to randomly choose of of the 64 possible combinations of 6 inputs.  Suppressors a and g represent 1 and 0 for the first input; suppressors b and h are 1 and 0 for the second input; etc. up to the sixth input with suppressors f and l (lower case L).  The triangles are hix sites for Hin recombination.  Whichever of the two suppressor tRNAs in an input pair is facing forward determines whether the value of that input is 1 or 0.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor inputs.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
2. Each bacterial cell carries out the following subroutine on each LC: IF LC=TRUE THEN &amp;quot;check the next LC&amp;quot; ELSEIF LC=FALSE &amp;quot;go get a new set of inputs with step 1&amp;quot;  In order to do this, each of the activators below must turn on a repressor that turns off Hin production.  Then if one of the activators is not made, Hin will be made, and new inputs will be established.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:LE circuit.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
3. If/when a bacterial cell finds a set of inputs that satisfies the entire LE (ie. a solution to the 3-SAT problem), it will glow green.&lt;br /&gt;
&lt;br /&gt;
== Things we need to learn about ==&lt;br /&gt;
&lt;br /&gt;
'''Note: We would need 12 different frameshift suppressor tRNAs to encode the Sakamoto 3-SAT problem'''&lt;br /&gt;
&lt;br /&gt;
'''Discovery of frameshift tRNAs.  How many are known?'''  &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/5/59/MaglierySchultz2001JMB.pdf Magliery, Anderson, Schultz]&lt;br /&gt;
&lt;br /&gt;
Library approach used to discover efficient suppressors of four-base codons AGGA, UAGA, CCCU, and CUAG using mutated versions of serine tRNA.&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf  Anderson, Maglieri, Schultz]&lt;br /&gt;
&lt;br /&gt;
Signals for translational bypassing (slipping and hopping): mRNA secondary structure, &amp;quot;hungry&amp;quot; (underused) codons, upstream Shine-Dalgarno-like (RBS) sequences &amp;lt;br&amp;gt;&lt;br /&gt;
Library approach extended in order to discover frameshift suppressor tRNAs with anticodons of size two to six bases.  Two-base and six-base suppressors were not found, but the following five-base suppressors were found: &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:Table2_Anderson2002.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/a/ac/Dunham_2009_tRNA_structure.pdf Dunham et al.]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/c/c3/Hohsaka_2009_in_vitro_tln.pdf Hohsaka et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Processing of tRNA precursors in E. coli''' &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://www.nature.com/embor/journal/v2/n1/full/embor501.html Mörl and Marchfelder] describe processing &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:the_final_cut.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''How many different frameshift suppressor tRNAs can be in one cell without causing toxicity?'''&lt;br /&gt;
&lt;br /&gt;
Can we have twelve of them?  If not, what is the maximum?  Is there an impact of codon usage on this?&lt;br /&gt;
&lt;br /&gt;
Can we have both 4- and 5-base suppressor tRNAs in one cell?&lt;br /&gt;
&lt;br /&gt;
Are there particular combinations of suppressors that are more tolerated than others?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''How many frameshift mutations can be suppressed in a single gene?'''&lt;br /&gt;
&lt;br /&gt;
How close together can the frameshift mutations of a given LC be?&lt;br /&gt;
&lt;br /&gt;
Can we mix 4- and 5-base frameshift mutations in a given LC?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7962</id>
		<title>Can we solve a 3-SAT problem with supressor logic?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7962"/>
				<updated>2009-05-20T17:04:44Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: /* What is suppressor logic? */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== What is the 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
''Advantages/Disadvantages to using the 3 SAT problem''&lt;br /&gt;
&lt;br /&gt;
Advantages:&lt;br /&gt;
&lt;br /&gt;
1) Seems to have an equal balance of mathematics and biology.&lt;br /&gt;
&lt;br /&gt;
2) Eventually, there is promise to make the problem difficult enough whereas a computer would have a hard time solving it.&lt;br /&gt;
&lt;br /&gt;
3) Introducing a new concept (supressor supressor logic)&lt;br /&gt;
&lt;br /&gt;
Disadvantages:&lt;br /&gt;
&lt;br /&gt;
1) Using the same concept/idea that has been used by previous Missouri Western/Davidson iGEM teams. (XOR gate)&lt;br /&gt;
&lt;br /&gt;
2) Finding enough for everyone to work on for the entire summer.&lt;br /&gt;
&lt;br /&gt;
3) Finding a promoter that is turned on without the use of a small particle.&lt;br /&gt;
&lt;br /&gt;
== How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem? == &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Sakamoto_DNA_computer_3SAT.pdf Sakamoto et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:hairpin2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
Sakamoto used hairpin formations in single stranded DNA (ssDNA) as a molecular computer. Hairpin structures are formed when complimentary bases on the same strand attach to each other forming a loop. As shown in Picture B above, C and -C are compliments of each other, and bind together. Picture A is what a normal ssDNA should look like. Sakamoto used this self assembly of secondary structures on a satisfiability (SAT) problem. The problem had six inputs and ten clauses. An example of a clause would be (a or b or -c), and could include any combinations of inputs from a to f including -a to -f. If the problem is satisfied, the ssDNA stays in it's normal form. If the problem is not satisfied, the ssDNA forms a hairpin. Later in the paper it explains that the hairpin forming molecules can be removed from the others with certain techniques. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The 10 clause 3-SAT problem solved in the paper is:&lt;br /&gt;
&lt;br /&gt;
(a or b or –c)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or d) &amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or e)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or d or –f)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
note: this problem uses inputs of a, b, c, d, e, -a, -c, -d, -f (f, -b, -e are not used)&lt;br /&gt;
&lt;br /&gt;
== What is suppressor logic? ==&lt;br /&gt;
&lt;br /&gt;
Will's Version of the PPT for SSL 3SAT&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/Will%27s_SSL_3SAT.ppt Will's Version of the PPT for SSL 3SAT]&lt;br /&gt;
&lt;br /&gt;
'''Suppressor Logic uses suppressor tRNAs as inputs to avoid frameshift mutations in the production of an output amino acid sequence'''&lt;br /&gt;
&lt;br /&gt;
A frameshift is a genetic mutation caused by the addition or deletion of nucelotides to a given sequence which codes for a protein.  Since codons are read in a series of three, the addition or deletion of nucleotides will disrupt the reading frame.  This disruption will most likely cause the production of a nonfunctional protein.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor4.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
A frameshift occurs and, in this case, a guanine is added to the sequence.  If nothing is done, enzyme A will not be made, meaning the clause will not be satisfied.&lt;br /&gt;
&lt;br /&gt;
The suppressor tRNA allows the 4 letter sequence to be read as a single codon, therefore, keeping the protein on track.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
If more than one frameshift mutation is introduced into a coding sequence, then logical operators can be encoded. Suppressor a binds to CCCG, supressor b binds to CUGC, and suppressor c binds to ACCG below:&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
# AUG CCCG CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG CUGC CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG  gg CUGC AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG gg CUGC gg ACCG AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Construct&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Gene&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Logical operation&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Phenotype || a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Phenotype || a AND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Phenotype || a OR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Phenotype || a OR b OR c&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Repressor|| NOT a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Repressor|| a NAND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Repressor|| a NOR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Repressor|| NOT (a OR b OR c)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Logical clauses can be connected by AND operators if the proteins produced are part of a biochemical pathway.'''  In this case, a AND b AND c: &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== How could suppressor logic be used to solve the Sakamoto 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
'''Definitions'''&lt;br /&gt;
&lt;br /&gt;
Inputs = framshift suppressor tRNAs &lt;br /&gt;
&lt;br /&gt;
Input value = supp a is 1, supp g is 0; supp b is 1, supp h is 0, etc. up to tth 6th pair of f and l&lt;br /&gt;
&lt;br /&gt;
Logical clause (LC) = three inputs connected by OR, eg. (a OR b OR e)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
LC using 4-base frameshift mutations:  cag CCCG aa GGGC tt GTTG cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
LC using 5-base frameshift mutations:  cag CCCGC a GGGCG t GTTGC cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This makes an XOR logic gate as only one suppressor can be used at one time to maintain the reading frame.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Logical expression (LE) = string of LCs connected by AND &amp;lt;br&amp;gt;&lt;br /&gt;
The design below encodes LC1 AND LC2 AND LC3 &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:logical expression2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Subroutine'''&lt;br /&gt;
&lt;br /&gt;
1. Individual bacteral cells use Hin/hix system to randomly choose of of the 64 possible combinations of 6 inputs.  Suppressors a and g represent 1 and 0 for the first input; suppressors b and h are 1 and 0 for the second input; etc. up to the sixth input with suppressors f and l (lower case L).  The triangles are hix sites for Hin recombination.  Whichever of the two suppressor tRNAs in an input pair is facing forward determines whether the value of that input is 1 or 0.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor inputs.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
2. Each bacterial cell carries out the following subroutine on each LC: IF LC=TRUE THEN &amp;quot;check the next LC&amp;quot; ELSEIF LC=FALSE &amp;quot;go get a new set of inputs with step 1&amp;quot;  In order to do this, each of the activators below must turn on a repressor that turns off Hin production.  Then if one of the activators is not made, Hin will be made, and new inputs will be established.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:LE circuit.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
3. If/when a bacterial cell finds a set of inputs that satisfies the entire LE (ie. a solution to the 3-SAT problem), it will glow green.&lt;br /&gt;
&lt;br /&gt;
== Things we need to learn about ==&lt;br /&gt;
&lt;br /&gt;
'''Note: We would need 12 different frameshift suppressor tRNAs to encode the Sakamoto 3-SAT problem'''&lt;br /&gt;
&lt;br /&gt;
'''Discovery of frameshift tRNAs.  How many are known?'''  &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/5/59/MaglierySchultz2001JMB.pdf Magliery, Anderson, Schultz]&lt;br /&gt;
&lt;br /&gt;
Library approach used to discover efficient suppressors of four-base codons AGGA, UAGA, CCCU, and CUAG using mutated versions of serine tRNA.&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf  Anderson, Maglieri, Schultz]&lt;br /&gt;
&lt;br /&gt;
Signals for translational bypassing (slipping and hopping): mRNA secondary structure, &amp;quot;hungry&amp;quot; (underused) codons, upstream Shine-Dalgarno-like (RBS) sequences &amp;lt;br&amp;gt;&lt;br /&gt;
Library approach extended in order to discover frameshift suppressor tRNAs with anticodons of size two to six bases.  Two-base and six-base suppressors were not found, but the following five-base suppressors were found: &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:Table2_Anderson2002.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/a/ac/Dunham_2009_tRNA_structure.pdf Dunham et al.]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/c/c3/Hohsaka_2009_in_vitro_tln.pdf Hohsaka et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Processing of tRNA precursors in E. coli''' &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://www.nature.com/embor/journal/v2/n1/full/embor501.html Mörl and Marchfelder] describe processing &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:the_final_cut.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''How many different frameshift suppressor tRNAs can be in one cell without causing toxicity?'''&lt;br /&gt;
&lt;br /&gt;
Can we have twelve of them?  If not, what is the maximum?  Is there an impact of codon usage on this?&lt;br /&gt;
&lt;br /&gt;
Can we have both 4- and 5-base suppressor tRNAs in one cell?&lt;br /&gt;
&lt;br /&gt;
Are there particular combinations of suppressors that are more tolerated than others?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''How many frameshift mutations can be suppressed in a single gene?'''&lt;br /&gt;
&lt;br /&gt;
How close together can the frameshift mutations of a given LC be?&lt;br /&gt;
&lt;br /&gt;
Can we mix 4- and 5-base frameshift mutations in a given LC?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7961</id>
		<title>Can we solve a 3-SAT problem with supressor logic?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7961"/>
				<updated>2009-05-20T17:04:02Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: /* What is suppressor logic? */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== What is the 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
''Advantages/Disadvantages to using the 3 SAT problem''&lt;br /&gt;
&lt;br /&gt;
Advantages:&lt;br /&gt;
&lt;br /&gt;
1) Seems to have an equal balance of mathematics and biology.&lt;br /&gt;
&lt;br /&gt;
2) Eventually, there is promise to make the problem difficult enough whereas a computer would have a hard time solving it.&lt;br /&gt;
&lt;br /&gt;
3) Introducing a new concept (supressor supressor logic)&lt;br /&gt;
&lt;br /&gt;
Disadvantages:&lt;br /&gt;
&lt;br /&gt;
1) Using the same concept/idea that has been used by previous Missouri Western/Davidson iGEM teams. (XOR gate)&lt;br /&gt;
&lt;br /&gt;
2) Finding enough for everyone to work on for the entire summer.&lt;br /&gt;
&lt;br /&gt;
3) Finding a promoter that is turned on without the use of a small particle.&lt;br /&gt;
&lt;br /&gt;
== How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem? == &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Sakamoto_DNA_computer_3SAT.pdf Sakamoto et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:hairpin2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
Sakamoto used hairpin formations in single stranded DNA (ssDNA) as a molecular computer. Hairpin structures are formed when complimentary bases on the same strand attach to each other forming a loop. As shown in Picture B above, C and -C are compliments of each other, and bind together. Picture A is what a normal ssDNA should look like. Sakamoto used this self assembly of secondary structures on a satisfiability (SAT) problem. The problem had six inputs and ten clauses. An example of a clause would be (a or b or -c), and could include any combinations of inputs from a to f including -a to -f. If the problem is satisfied, the ssDNA stays in it's normal form. If the problem is not satisfied, the ssDNA forms a hairpin. Later in the paper it explains that the hairpin forming molecules can be removed from the others with certain techniques. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The 10 clause 3-SAT problem solved in the paper is:&lt;br /&gt;
&lt;br /&gt;
(a or b or –c)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or d) &amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or e)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or d or –f)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
note: this problem uses inputs of a, b, c, d, e, -a, -c, -d, -f (f, -b, -e are not used)&lt;br /&gt;
&lt;br /&gt;
== What is suppressor logic? ==&lt;br /&gt;
&lt;br /&gt;
Will's Version of the PPT for SSL 3SAT&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/index.php/Image:Will%27s_SSL_3SAT.ppt Will's Version of the PPT for SSL 3SAT]&lt;br /&gt;
&lt;br /&gt;
'''Suppressor Logic uses suppressor tRNAs as inputs to avoid frameshift mutations in the production of an output amino acid sequence'''&lt;br /&gt;
&lt;br /&gt;
A frameshift is a genetic mutation caused by the addition or deletion of nucelotides to a given sequence which codes for a protein.  Since codons are read in a series of three, the addition or deletion of nucleotides will disrupt the reading frame.  This disruption will most likely cause the production of a nonfunctional protein.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor4.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
A frameshift occurs and, in this case, a guanine is added to the sequence.  If nothing is done, enzyme A will not be made, meaning the clause will not be satisfied.&lt;br /&gt;
&lt;br /&gt;
The suppressor tRNA allows the 4 letter sequence to be read as a single codon, therefore, keeping the protein on track.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
If more than one frameshift mutation is introduced into a coding sequence, then logical operators can be encoded. Suppressor a binds to CCCG, supressor b binds to CUGC, and suppressor c binds to ACCG below:&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
# AUG CCCG CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG CUGC CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG  gg CUGC AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG gg CUGC gg ACCG AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Construct&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Gene&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Logical operation&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Phenotype || a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Phenotype || a AND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Phenotype || a OR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Phenotype || a OR b OR c&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Repressor|| NOT a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Repressor|| a NAND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Repressor|| a NOR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Repressor|| NOT (a OR b OR c)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Logical clauses can be connected by AND operators if the proteins produced are part of a biochemical pathway.'''  In this case, a AND b AND c: &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== How could suppressor logic be used to solve the Sakamoto 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
'''Definitions'''&lt;br /&gt;
&lt;br /&gt;
Inputs = framshift suppressor tRNAs &lt;br /&gt;
&lt;br /&gt;
Input value = supp a is 1, supp g is 0; supp b is 1, supp h is 0, etc. up to tth 6th pair of f and l&lt;br /&gt;
&lt;br /&gt;
Logical clause (LC) = three inputs connected by OR, eg. (a OR b OR e)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
LC using 4-base frameshift mutations:  cag CCCG aa GGGC tt GTTG cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
LC using 5-base frameshift mutations:  cag CCCGC a GGGCG t GTTGC cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This makes an XOR logic gate as only one suppressor can be used at one time to maintain the reading frame.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Logical expression (LE) = string of LCs connected by AND &amp;lt;br&amp;gt;&lt;br /&gt;
The design below encodes LC1 AND LC2 AND LC3 &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:logical expression2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Subroutine'''&lt;br /&gt;
&lt;br /&gt;
1. Individual bacteral cells use Hin/hix system to randomly choose of of the 64 possible combinations of 6 inputs.  Suppressors a and g represent 1 and 0 for the first input; suppressors b and h are 1 and 0 for the second input; etc. up to the sixth input with suppressors f and l (lower case L).  The triangles are hix sites for Hin recombination.  Whichever of the two suppressor tRNAs in an input pair is facing forward determines whether the value of that input is 1 or 0.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor inputs.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
2. Each bacterial cell carries out the following subroutine on each LC: IF LC=TRUE THEN &amp;quot;check the next LC&amp;quot; ELSEIF LC=FALSE &amp;quot;go get a new set of inputs with step 1&amp;quot;  In order to do this, each of the activators below must turn on a repressor that turns off Hin production.  Then if one of the activators is not made, Hin will be made, and new inputs will be established.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:LE circuit.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
3. If/when a bacterial cell finds a set of inputs that satisfies the entire LE (ie. a solution to the 3-SAT problem), it will glow green.&lt;br /&gt;
&lt;br /&gt;
== Things we need to learn about ==&lt;br /&gt;
&lt;br /&gt;
'''Note: We would need 12 different frameshift suppressor tRNAs to encode the Sakamoto 3-SAT problem'''&lt;br /&gt;
&lt;br /&gt;
'''Discovery of frameshift tRNAs.  How many are known?'''  &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/5/59/MaglierySchultz2001JMB.pdf Magliery, Anderson, Schultz]&lt;br /&gt;
&lt;br /&gt;
Library approach used to discover efficient suppressors of four-base codons AGGA, UAGA, CCCU, and CUAG using mutated versions of serine tRNA.&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf  Anderson, Maglieri, Schultz]&lt;br /&gt;
&lt;br /&gt;
Signals for translational bypassing (slipping and hopping): mRNA secondary structure, &amp;quot;hungry&amp;quot; (underused) codons, upstream Shine-Dalgarno-like (RBS) sequences &amp;lt;br&amp;gt;&lt;br /&gt;
Library approach extended in order to discover frameshift suppressor tRNAs with anticodons of size two to six bases.  Two-base and six-base suppressors were not found, but the following five-base suppressors were found: &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:Table2_Anderson2002.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/a/ac/Dunham_2009_tRNA_structure.pdf Dunham et al.]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/c/c3/Hohsaka_2009_in_vitro_tln.pdf Hohsaka et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Processing of tRNA precursors in E. coli''' &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://www.nature.com/embor/journal/v2/n1/full/embor501.html Mörl and Marchfelder] describe processing &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:the_final_cut.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''How many different frameshift suppressor tRNAs can be in one cell without causing toxicity?'''&lt;br /&gt;
&lt;br /&gt;
Can we have twelve of them?  If not, what is the maximum?  Is there an impact of codon usage on this?&lt;br /&gt;
&lt;br /&gt;
Can we have both 4- and 5-base suppressor tRNAs in one cell?&lt;br /&gt;
&lt;br /&gt;
Are there particular combinations of suppressors that are more tolerated than others?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''How many frameshift mutations can be suppressed in a single gene?'''&lt;br /&gt;
&lt;br /&gt;
How close together can the frameshift mutations of a given LC be?&lt;br /&gt;
&lt;br /&gt;
Can we mix 4- and 5-base frameshift mutations in a given LC?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7960</id>
		<title>Can we solve a 3-SAT problem with supressor logic?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7960"/>
				<updated>2009-05-20T17:02:51Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: /* What is suppressor logic? */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== What is the 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
''Advantages/Disadvantages to using the 3 SAT problem''&lt;br /&gt;
&lt;br /&gt;
Advantages:&lt;br /&gt;
&lt;br /&gt;
1) Seems to have an equal balance of mathematics and biology.&lt;br /&gt;
&lt;br /&gt;
2) Eventually, there is promise to make the problem difficult enough whereas a computer would have a hard time solving it.&lt;br /&gt;
&lt;br /&gt;
3) Introducing a new concept (supressor supressor logic)&lt;br /&gt;
&lt;br /&gt;
Disadvantages:&lt;br /&gt;
&lt;br /&gt;
1) Using the same concept/idea that has been used by previous Missouri Western/Davidson iGEM teams. (XOR gate)&lt;br /&gt;
&lt;br /&gt;
2) Finding enough for everyone to work on for the entire summer.&lt;br /&gt;
&lt;br /&gt;
3) Finding a promoter that is turned on without the use of a small particle.&lt;br /&gt;
&lt;br /&gt;
== How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem? == &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Sakamoto_DNA_computer_3SAT.pdf Sakamoto et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:hairpin2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
Sakamoto used hairpin formations in single stranded DNA (ssDNA) as a molecular computer. Hairpin structures are formed when complimentary bases on the same strand attach to each other forming a loop. As shown in Picture B above, C and -C are compliments of each other, and bind together. Picture A is what a normal ssDNA should look like. Sakamoto used this self assembly of secondary structures on a satisfiability (SAT) problem. The problem had six inputs and ten clauses. An example of a clause would be (a or b or -c), and could include any combinations of inputs from a to f including -a to -f. If the problem is satisfied, the ssDNA stays in it's normal form. If the problem is not satisfied, the ssDNA forms a hairpin. Later in the paper it explains that the hairpin forming molecules can be removed from the others with certain techniques. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The 10 clause 3-SAT problem solved in the paper is:&lt;br /&gt;
&lt;br /&gt;
(a or b or –c)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or d) &amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or e)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or d or –f)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
note: this problem uses inputs of a, b, c, d, e, -a, -c, -d, -f (f, -b, -e are not used)&lt;br /&gt;
&lt;br /&gt;
== What is suppressor logic? ==&lt;br /&gt;
&lt;br /&gt;
Will's Version of the PPT for SSL 3SAT&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Will's_SSL_3SAT.ppt Will's Version of the PPT for SSL 3SAT]&lt;br /&gt;
&lt;br /&gt;
'''Suppressor Logic uses suppressor tRNAs as inputs to avoid frameshift mutations in the production of an output amino acid sequence'''&lt;br /&gt;
&lt;br /&gt;
A frameshift is a genetic mutation caused by the addition or deletion of nucelotides to a given sequence which codes for a protein.  Since codons are read in a series of three, the addition or deletion of nucleotides will disrupt the reading frame.  This disruption will most likely cause the production of a nonfunctional protein.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor4.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
A frameshift occurs and, in this case, a guanine is added to the sequence.  If nothing is done, enzyme A will not be made, meaning the clause will not be satisfied.&lt;br /&gt;
&lt;br /&gt;
The suppressor tRNA allows the 4 letter sequence to be read as a single codon, therefore, keeping the protein on track.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
If more than one frameshift mutation is introduced into a coding sequence, then logical operators can be encoded. Suppressor a binds to CCCG, supressor b binds to CUGC, and suppressor c binds to ACCG below:&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
# AUG CCCG CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG CUGC CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG  gg CUGC AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG gg CUGC gg ACCG AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Construct&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Gene&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Logical operation&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Phenotype || a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Phenotype || a AND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Phenotype || a OR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Phenotype || a OR b OR c&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Repressor|| NOT a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Repressor|| a NAND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Repressor|| a NOR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Repressor|| NOT (a OR b OR c)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Logical clauses can be connected by AND operators if the proteins produced are part of a biochemical pathway.'''  In this case, a AND b AND c: &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== How could suppressor logic be used to solve the Sakamoto 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
'''Definitions'''&lt;br /&gt;
&lt;br /&gt;
Inputs = framshift suppressor tRNAs &lt;br /&gt;
&lt;br /&gt;
Input value = supp a is 1, supp g is 0; supp b is 1, supp h is 0, etc. up to tth 6th pair of f and l&lt;br /&gt;
&lt;br /&gt;
Logical clause (LC) = three inputs connected by OR, eg. (a OR b OR e)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
LC using 4-base frameshift mutations:  cag CCCG aa GGGC tt GTTG cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
LC using 5-base frameshift mutations:  cag CCCGC a GGGCG t GTTGC cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This makes an XOR logic gate as only one suppressor can be used at one time to maintain the reading frame.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Logical expression (LE) = string of LCs connected by AND &amp;lt;br&amp;gt;&lt;br /&gt;
The design below encodes LC1 AND LC2 AND LC3 &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:logical expression2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Subroutine'''&lt;br /&gt;
&lt;br /&gt;
1. Individual bacteral cells use Hin/hix system to randomly choose of of the 64 possible combinations of 6 inputs.  Suppressors a and g represent 1 and 0 for the first input; suppressors b and h are 1 and 0 for the second input; etc. up to the sixth input with suppressors f and l (lower case L).  The triangles are hix sites for Hin recombination.  Whichever of the two suppressor tRNAs in an input pair is facing forward determines whether the value of that input is 1 or 0.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor inputs.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
2. Each bacterial cell carries out the following subroutine on each LC: IF LC=TRUE THEN &amp;quot;check the next LC&amp;quot; ELSEIF LC=FALSE &amp;quot;go get a new set of inputs with step 1&amp;quot;  In order to do this, each of the activators below must turn on a repressor that turns off Hin production.  Then if one of the activators is not made, Hin will be made, and new inputs will be established.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:LE circuit.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
3. If/when a bacterial cell finds a set of inputs that satisfies the entire LE (ie. a solution to the 3-SAT problem), it will glow green.&lt;br /&gt;
&lt;br /&gt;
== Things we need to learn about ==&lt;br /&gt;
&lt;br /&gt;
'''Note: We would need 12 different frameshift suppressor tRNAs to encode the Sakamoto 3-SAT problem'''&lt;br /&gt;
&lt;br /&gt;
'''Discovery of frameshift tRNAs.  How many are known?'''  &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/5/59/MaglierySchultz2001JMB.pdf Magliery, Anderson, Schultz]&lt;br /&gt;
&lt;br /&gt;
Library approach used to discover efficient suppressors of four-base codons AGGA, UAGA, CCCU, and CUAG using mutated versions of serine tRNA.&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf  Anderson, Maglieri, Schultz]&lt;br /&gt;
&lt;br /&gt;
Signals for translational bypassing (slipping and hopping): mRNA secondary structure, &amp;quot;hungry&amp;quot; (underused) codons, upstream Shine-Dalgarno-like (RBS) sequences &amp;lt;br&amp;gt;&lt;br /&gt;
Library approach extended in order to discover frameshift suppressor tRNAs with anticodons of size two to six bases.  Two-base and six-base suppressors were not found, but the following five-base suppressors were found: &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:Table2_Anderson2002.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/a/ac/Dunham_2009_tRNA_structure.pdf Dunham et al.]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/c/c3/Hohsaka_2009_in_vitro_tln.pdf Hohsaka et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Processing of tRNA precursors in E. coli''' &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://www.nature.com/embor/journal/v2/n1/full/embor501.html Mörl and Marchfelder] describe processing &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:the_final_cut.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''How many different frameshift suppressor tRNAs can be in one cell without causing toxicity?'''&lt;br /&gt;
&lt;br /&gt;
Can we have twelve of them?  If not, what is the maximum?  Is there an impact of codon usage on this?&lt;br /&gt;
&lt;br /&gt;
Can we have both 4- and 5-base suppressor tRNAs in one cell?&lt;br /&gt;
&lt;br /&gt;
Are there particular combinations of suppressors that are more tolerated than others?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''How many frameshift mutations can be suppressed in a single gene?'''&lt;br /&gt;
&lt;br /&gt;
How close together can the frameshift mutations of a given LC be?&lt;br /&gt;
&lt;br /&gt;
Can we mix 4- and 5-base frameshift mutations in a given LC?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7959</id>
		<title>Can we solve a 3-SAT problem with supressor logic?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7959"/>
				<updated>2009-05-20T17:01:18Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: /* What is suppressor logic? */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== What is the 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
''Advantages/Disadvantages to using the 3 SAT problem''&lt;br /&gt;
&lt;br /&gt;
Advantages:&lt;br /&gt;
&lt;br /&gt;
1) Seems to have an equal balance of mathematics and biology.&lt;br /&gt;
&lt;br /&gt;
2) Eventually, there is promise to make the problem difficult enough whereas a computer would have a hard time solving it.&lt;br /&gt;
&lt;br /&gt;
3) Introducing a new concept (supressor supressor logic)&lt;br /&gt;
&lt;br /&gt;
Disadvantages:&lt;br /&gt;
&lt;br /&gt;
1) Using the same concept/idea that has been used by previous Missouri Western/Davidson iGEM teams. (XOR gate)&lt;br /&gt;
&lt;br /&gt;
2) Finding enough for everyone to work on for the entire summer.&lt;br /&gt;
&lt;br /&gt;
3) Finding a promoter that is turned on without the use of a small particle.&lt;br /&gt;
&lt;br /&gt;
== How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem? == &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Sakamoto_DNA_computer_3SAT.pdf Sakamoto et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:hairpin2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
Sakamoto used hairpin formations in single stranded DNA (ssDNA) as a molecular computer. Hairpin structures are formed when complimentary bases on the same strand attach to each other forming a loop. As shown in Picture B above, C and -C are compliments of each other, and bind together. Picture A is what a normal ssDNA should look like. Sakamoto used this self assembly of secondary structures on a satisfiability (SAT) problem. The problem had six inputs and ten clauses. An example of a clause would be (a or b or -c), and could include any combinations of inputs from a to f including -a to -f. If the problem is satisfied, the ssDNA stays in it's normal form. If the problem is not satisfied, the ssDNA forms a hairpin. Later in the paper it explains that the hairpin forming molecules can be removed from the others with certain techniques. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The 10 clause 3-SAT problem solved in the paper is:&lt;br /&gt;
&lt;br /&gt;
(a or b or –c)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or d) &amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or e)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or d or –f)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
note: this problem uses inputs of a, b, c, d, e, -a, -c, -d, -f (f, -b, -e are not used)&lt;br /&gt;
&lt;br /&gt;
== What is suppressor logic? ==&lt;br /&gt;
&lt;br /&gt;
Will's Version of the PPT for SSL 3SAT&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Wills_SSL_3SAT.ppt Will's Version of the PPT for SSL 3SAT]&lt;br /&gt;
&lt;br /&gt;
'''Suppressor Logic uses suppressor tRNAs as inputs to avoid frameshift mutations in the production of an output amino acid sequence'''&lt;br /&gt;
&lt;br /&gt;
A frameshift is a genetic mutation caused by the addition or deletion of nucelotides to a given sequence which codes for a protein.  Since codons are read in a series of three, the addition or deletion of nucleotides will disrupt the reading frame.  This disruption will most likely cause the production of a nonfunctional protein.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor4.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
A frameshift occurs and, in this case, a guanine is added to the sequence.  If nothing is done, enzyme A will not be made, meaning the clause will not be satisfied.&lt;br /&gt;
&lt;br /&gt;
The suppressor tRNA allows the 4 letter sequence to be read as a single codon, therefore, keeping the protein on track.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
If more than one frameshift mutation is introduced into a coding sequence, then logical operators can be encoded. Suppressor a binds to CCCG, supressor b binds to CUGC, and suppressor c binds to ACCG below:&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
# AUG CCCG CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG CUGC CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG  gg CUGC AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG gg CUGC gg ACCG AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Construct&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Gene&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Logical operation&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Phenotype || a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Phenotype || a AND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Phenotype || a OR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Phenotype || a OR b OR c&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Repressor|| NOT a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Repressor|| a NAND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Repressor|| a NOR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Repressor|| NOT (a OR b OR c)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Logical clauses can be connected by AND operators if the proteins produced are part of a biochemical pathway.'''  In this case, a AND b AND c: &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== How could suppressor logic be used to solve the Sakamoto 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
'''Definitions'''&lt;br /&gt;
&lt;br /&gt;
Inputs = framshift suppressor tRNAs &lt;br /&gt;
&lt;br /&gt;
Input value = supp a is 1, supp g is 0; supp b is 1, supp h is 0, etc. up to tth 6th pair of f and l&lt;br /&gt;
&lt;br /&gt;
Logical clause (LC) = three inputs connected by OR, eg. (a OR b OR e)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
LC using 4-base frameshift mutations:  cag CCCG aa GGGC tt GTTG cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
LC using 5-base frameshift mutations:  cag CCCGC a GGGCG t GTTGC cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This makes an XOR logic gate as only one suppressor can be used at one time to maintain the reading frame.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Logical expression (LE) = string of LCs connected by AND &amp;lt;br&amp;gt;&lt;br /&gt;
The design below encodes LC1 AND LC2 AND LC3 &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:logical expression2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Subroutine'''&lt;br /&gt;
&lt;br /&gt;
1. Individual bacteral cells use Hin/hix system to randomly choose of of the 64 possible combinations of 6 inputs.  Suppressors a and g represent 1 and 0 for the first input; suppressors b and h are 1 and 0 for the second input; etc. up to the sixth input with suppressors f and l (lower case L).  The triangles are hix sites for Hin recombination.  Whichever of the two suppressor tRNAs in an input pair is facing forward determines whether the value of that input is 1 or 0.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor inputs.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
2. Each bacterial cell carries out the following subroutine on each LC: IF LC=TRUE THEN &amp;quot;check the next LC&amp;quot; ELSEIF LC=FALSE &amp;quot;go get a new set of inputs with step 1&amp;quot;  In order to do this, each of the activators below must turn on a repressor that turns off Hin production.  Then if one of the activators is not made, Hin will be made, and new inputs will be established.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:LE circuit.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
3. If/when a bacterial cell finds a set of inputs that satisfies the entire LE (ie. a solution to the 3-SAT problem), it will glow green.&lt;br /&gt;
&lt;br /&gt;
== Things we need to learn about ==&lt;br /&gt;
&lt;br /&gt;
'''Note: We would need 12 different frameshift suppressor tRNAs to encode the Sakamoto 3-SAT problem'''&lt;br /&gt;
&lt;br /&gt;
'''Discovery of frameshift tRNAs.  How many are known?'''  &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/5/59/MaglierySchultz2001JMB.pdf Magliery, Anderson, Schultz]&lt;br /&gt;
&lt;br /&gt;
Library approach used to discover efficient suppressors of four-base codons AGGA, UAGA, CCCU, and CUAG using mutated versions of serine tRNA.&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf  Anderson, Maglieri, Schultz]&lt;br /&gt;
&lt;br /&gt;
Signals for translational bypassing (slipping and hopping): mRNA secondary structure, &amp;quot;hungry&amp;quot; (underused) codons, upstream Shine-Dalgarno-like (RBS) sequences &amp;lt;br&amp;gt;&lt;br /&gt;
Library approach extended in order to discover frameshift suppressor tRNAs with anticodons of size two to six bases.  Two-base and six-base suppressors were not found, but the following five-base suppressors were found: &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:Table2_Anderson2002.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/a/ac/Dunham_2009_tRNA_structure.pdf Dunham et al.]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/c/c3/Hohsaka_2009_in_vitro_tln.pdf Hohsaka et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Processing of tRNA precursors in E. coli''' &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://www.nature.com/embor/journal/v2/n1/full/embor501.html Mörl and Marchfelder] describe processing &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:the_final_cut.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''How many different frameshift suppressor tRNAs can be in one cell without causing toxicity?'''&lt;br /&gt;
&lt;br /&gt;
Can we have twelve of them?  If not, what is the maximum?  Is there an impact of codon usage on this?&lt;br /&gt;
&lt;br /&gt;
Can we have both 4- and 5-base suppressor tRNAs in one cell?&lt;br /&gt;
&lt;br /&gt;
Are there particular combinations of suppressors that are more tolerated than others?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''How many frameshift mutations can be suppressed in a single gene?'''&lt;br /&gt;
&lt;br /&gt;
How close together can the frameshift mutations of a given LC be?&lt;br /&gt;
&lt;br /&gt;
Can we mix 4- and 5-base frameshift mutations in a given LC?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7958</id>
		<title>Can we solve a 3-SAT problem with supressor logic?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7958"/>
				<updated>2009-05-20T17:00:43Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: /* What is suppressor logic? */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== What is the 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
''Advantages/Disadvantages to using the 3 SAT problem''&lt;br /&gt;
&lt;br /&gt;
Advantages:&lt;br /&gt;
&lt;br /&gt;
1) Seems to have an equal balance of mathematics and biology.&lt;br /&gt;
&lt;br /&gt;
2) Eventually, there is promise to make the problem difficult enough whereas a computer would have a hard time solving it.&lt;br /&gt;
&lt;br /&gt;
3) Introducing a new concept (supressor supressor logic)&lt;br /&gt;
&lt;br /&gt;
Disadvantages:&lt;br /&gt;
&lt;br /&gt;
1) Using the same concept/idea that has been used by previous Missouri Western/Davidson iGEM teams. (XOR gate)&lt;br /&gt;
&lt;br /&gt;
2) Finding enough for everyone to work on for the entire summer.&lt;br /&gt;
&lt;br /&gt;
3) Finding a promoter that is turned on without the use of a small particle.&lt;br /&gt;
&lt;br /&gt;
== How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem? == &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Sakamoto_DNA_computer_3SAT.pdf Sakamoto et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:hairpin2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
Sakamoto used hairpin formations in single stranded DNA (ssDNA) as a molecular computer. Hairpin structures are formed when complimentary bases on the same strand attach to each other forming a loop. As shown in Picture B above, C and -C are compliments of each other, and bind together. Picture A is what a normal ssDNA should look like. Sakamoto used this self assembly of secondary structures on a satisfiability (SAT) problem. The problem had six inputs and ten clauses. An example of a clause would be (a or b or -c), and could include any combinations of inputs from a to f including -a to -f. If the problem is satisfied, the ssDNA stays in it's normal form. If the problem is not satisfied, the ssDNA forms a hairpin. Later in the paper it explains that the hairpin forming molecules can be removed from the others with certain techniques. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The 10 clause 3-SAT problem solved in the paper is:&lt;br /&gt;
&lt;br /&gt;
(a or b or –c)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or d) &amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or e)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or d or –f)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
note: this problem uses inputs of a, b, c, d, e, -a, -c, -d, -f (f, -b, -e are not used)&lt;br /&gt;
&lt;br /&gt;
== What is suppressor logic? ==&lt;br /&gt;
&lt;br /&gt;
Will's Version of the PPT for SSL 3SAT&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Wills_SSL_3SAT.ppt Sakamoto et al.]&lt;br /&gt;
&lt;br /&gt;
'''Suppressor Logic uses suppressor tRNAs as inputs to avoid frameshift mutations in the production of an output amino acid sequence'''&lt;br /&gt;
&lt;br /&gt;
A frameshift is a genetic mutation caused by the addition or deletion of nucelotides to a given sequence which codes for a protein.  Since codons are read in a series of three, the addition or deletion of nucleotides will disrupt the reading frame.  This disruption will most likely cause the production of a nonfunctional protein.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor4.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
A frameshift occurs and, in this case, a guanine is added to the sequence.  If nothing is done, enzyme A will not be made, meaning the clause will not be satisfied.&lt;br /&gt;
&lt;br /&gt;
The suppressor tRNA allows the 4 letter sequence to be read as a single codon, therefore, keeping the protein on track.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
If more than one frameshift mutation is introduced into a coding sequence, then logical operators can be encoded. Suppressor a binds to CCCG, supressor b binds to CUGC, and suppressor c binds to ACCG below:&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
# AUG CCCG CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG CUGC CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG  gg CUGC AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG gg CUGC gg ACCG AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Construct&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Gene&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Logical operation&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Phenotype || a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Phenotype || a AND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Phenotype || a OR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Phenotype || a OR b OR c&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Repressor|| NOT a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Repressor|| a NAND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Repressor|| a NOR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Repressor|| NOT (a OR b OR c)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Logical clauses can be connected by AND operators if the proteins produced are part of a biochemical pathway.'''  In this case, a AND b AND c: &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== How could suppressor logic be used to solve the Sakamoto 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
'''Definitions'''&lt;br /&gt;
&lt;br /&gt;
Inputs = framshift suppressor tRNAs &lt;br /&gt;
&lt;br /&gt;
Input value = supp a is 1, supp g is 0; supp b is 1, supp h is 0, etc. up to tth 6th pair of f and l&lt;br /&gt;
&lt;br /&gt;
Logical clause (LC) = three inputs connected by OR, eg. (a OR b OR e)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
LC using 4-base frameshift mutations:  cag CCCG aa GGGC tt GTTG cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
LC using 5-base frameshift mutations:  cag CCCGC a GGGCG t GTTGC cag (may also have any multiple of 3 bases between the mutations) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This makes an XOR logic gate as only one suppressor can be used at one time to maintain the reading frame.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Logical expression (LE) = string of LCs connected by AND &amp;lt;br&amp;gt;&lt;br /&gt;
The design below encodes LC1 AND LC2 AND LC3 &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:logical expression2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Subroutine'''&lt;br /&gt;
&lt;br /&gt;
1. Individual bacteral cells use Hin/hix system to randomly choose of of the 64 possible combinations of 6 inputs.  Suppressors a and g represent 1 and 0 for the first input; suppressors b and h are 1 and 0 for the second input; etc. up to the sixth input with suppressors f and l (lower case L).  The triangles are hix sites for Hin recombination.  Whichever of the two suppressor tRNAs in an input pair is facing forward determines whether the value of that input is 1 or 0.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor inputs.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
2. Each bacterial cell carries out the following subroutine on each LC: IF LC=TRUE THEN &amp;quot;check the next LC&amp;quot; ELSEIF LC=FALSE &amp;quot;go get a new set of inputs with step 1&amp;quot;  In order to do this, each of the activators below must turn on a repressor that turns off Hin production.  Then if one of the activators is not made, Hin will be made, and new inputs will be established.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:LE circuit.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
3. If/when a bacterial cell finds a set of inputs that satisfies the entire LE (ie. a solution to the 3-SAT problem), it will glow green.&lt;br /&gt;
&lt;br /&gt;
== Things we need to learn about ==&lt;br /&gt;
&lt;br /&gt;
'''Note: We would need 12 different frameshift suppressor tRNAs to encode the Sakamoto 3-SAT problem'''&lt;br /&gt;
&lt;br /&gt;
'''Discovery of frameshift tRNAs.  How many are known?'''  &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/5/59/MaglierySchultz2001JMB.pdf Magliery, Anderson, Schultz]&lt;br /&gt;
&lt;br /&gt;
Library approach used to discover efficient suppressors of four-base codons AGGA, UAGA, CCCU, and CUAG using mutated versions of serine tRNA.&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf  Anderson, Maglieri, Schultz]&lt;br /&gt;
&lt;br /&gt;
Signals for translational bypassing (slipping and hopping): mRNA secondary structure, &amp;quot;hungry&amp;quot; (underused) codons, upstream Shine-Dalgarno-like (RBS) sequences &amp;lt;br&amp;gt;&lt;br /&gt;
Library approach extended in order to discover frameshift suppressor tRNAs with anticodons of size two to six bases.  Two-base and six-base suppressors were not found, but the following five-base suppressors were found: &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:Table2_Anderson2002.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/a/ac/Dunham_2009_tRNA_structure.pdf Dunham et al.]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/c/c3/Hohsaka_2009_in_vitro_tln.pdf Hohsaka et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Processing of tRNA precursors in E. coli''' &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://www.nature.com/embor/journal/v2/n1/full/embor501.html Mörl and Marchfelder] describe processing &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:the_final_cut.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''How many different frameshift suppressor tRNAs can be in one cell without causing toxicity?'''&lt;br /&gt;
&lt;br /&gt;
Can we have twelve of them?  If not, what is the maximum?  Is there an impact of codon usage on this?&lt;br /&gt;
&lt;br /&gt;
Can we have both 4- and 5-base suppressor tRNAs in one cell?&lt;br /&gt;
&lt;br /&gt;
Are there particular combinations of suppressors that are more tolerated than others?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''How many frameshift mutations can be suppressed in a single gene?'''&lt;br /&gt;
&lt;br /&gt;
How close together can the frameshift mutations of a given LC be?&lt;br /&gt;
&lt;br /&gt;
Can we mix 4- and 5-base frameshift mutations in a given LC?&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Will%27s_SSL_3SAT.ppt&amp;diff=7957</id>
		<title>File:Will's SSL 3SAT.ppt</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Will%27s_SSL_3SAT.ppt&amp;diff=7957"/>
				<updated>2009-05-20T16:58:14Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7731</id>
		<title>Can we solve a 3-SAT problem with supressor logic?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7731"/>
				<updated>2009-04-08T22:47:49Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: /* How could suppressor logic be used to solve the Sakamoto 3-SAT problem? */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== What is the 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
== How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem? == &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Sakamoto_DNA_computer_3SAT.pdf Sakamoto et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:hairpin2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
Sakamoto used hairpin formations in single stranded DNA (ssDNA) as a molecular computer. Hairpin structures are formed when complimentary bases on the same strand attach to each other forming a loop. As shown in Picture B above, C and -C are compliments of each other, and bind together. Picture A is what a normal ssDNA should look like. Sakamoto used this self assembly of secondary structures on a satisfiability (SAT) problem. The problem had six inputs and ten clauses. An example of a clause would be (a or b or -c), and could include any combinations of inputs from a to f including -a to -f. If the problem is satisfied, the ssDNA stays in it's normal form. If the problem is not satisfied, the ssDNA forms a hairpin. Later in the paper it explains that the hairpin forming molecules can be removed from the others with certain techniques. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The 10 clause 3-SAT problem solved in the paper is:&lt;br /&gt;
&lt;br /&gt;
(a or b or –c)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or d) &amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or e)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or d or –f)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== What is suppressor logic? ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Suppressor Suppressor logic uses suppressor tRNAs to avoid frameshift mutations in an amino acid sequence.'''&lt;br /&gt;
&lt;br /&gt;
A frameshift is a genetic mutation caused by the addition or deletion of nucelotides to a given sequence which codes for a protein.  Since codons are read in a series of three, the addition or deletion of nucleotides will disrupt the reading frame.  This disruption will most likely cause the production of a nonfunctional protein.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor4.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
A frameshift occurs and, in this case, a guanine is added to the sequence.  If nothing is done, enzyme A will not be made, meaning the clause will not be satisfied.&lt;br /&gt;
&lt;br /&gt;
The suppressor tRNA allows the 4 letter sequence to be read as a single codon, therefore, keeping the protein on track.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
If more than one frameshift mutation is introduced into a coding sequence, then logical operators can be encoded. Suppressor a binds to CCCG, supressor b binds to CUGC, and suppressor c binds to ACCG below:&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
# AUG CCCG CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG CUGC CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG  gg CUGC AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG gg CUGC gg ACCG AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Construct&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Gene&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Logical operation&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Phenotype || a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Phenotype || a AND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Phenotype || a OR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Phenotype || a OR b OR c&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Repressor|| NOT a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Repressor|| a NAND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Repressor|| a NOR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Repressor|| NOT (a OR b OR c)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Logical clauses can be connected by AND operators if the proteins produced are part of a biochemical pathway.'''  In this case, a AND b AND c: &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== How could suppressor logic be used to solve the Sakamoto 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
'''Definitions'''&lt;br /&gt;
&lt;br /&gt;
Inputs = framshift suppressor tRNAs &lt;br /&gt;
&lt;br /&gt;
Input value = supp a is 1, supp g is 0; supp b is 1, supp h is 0, etc. up to tth 6th pair of f and l&lt;br /&gt;
&lt;br /&gt;
Logical clause (LC) = three inputs connected by OR, eg. (a OR b OR e)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Translation into DNA sequence cag CCCG aa GGGC tt GTTG cag&lt;br /&gt;
&lt;br /&gt;
This makes an XOR logic gate as only one suppressor can be used at one time to maintain the reading frame.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Logical expression (LE) = string of LCs connected by AND&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:logical expression.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Subroutine'''&lt;br /&gt;
&lt;br /&gt;
1. Individual bacteral cells use Hin/hix system to randomly choose of of the 64 possible combinations of 6 inputs.&lt;br /&gt;
&lt;br /&gt;
2. Each bacterial cell carries out the following subroutine on each LC: IF LC=TRUE THEN &amp;quot;check the next LC&amp;quot; ELSEIF LC=FALSE &amp;quot;go get a new set of inputs with step 1&amp;quot;&lt;br /&gt;
&lt;br /&gt;
3. If/when a bacterial cell finds a set of inputs that satisfies the entire LE (ie. a solution to the 3-SAT problem), it will glow green.&lt;br /&gt;
&lt;br /&gt;
== Things we need to learn about ==&lt;br /&gt;
&lt;br /&gt;
'''Processing of tRNA precursors in E. coli''' &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://www.nature.com/embor/journal/v2/n1/full/embor501.html Mörl and Marchfelder] describe processing &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:the_final_cut.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Discovery of frameshift tRNAs.  How many are known?'''  &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Is there any evidence concerning the use of several (six?) frameshift tRNAs in one cell?''' &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=File:Logical_expression.GIF&amp;diff=7730</id>
		<title>File:Logical expression.GIF</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=File:Logical_expression.GIF&amp;diff=7730"/>
				<updated>2009-04-08T22:46:22Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	<entry>
		<id>http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7729</id>
		<title>Can we solve a 3-SAT problem with supressor logic?</title>
		<link rel="alternate" type="text/html" href="http://gcat.davidson.edu/GcatWiki/index.php?title=Can_we_solve_a_3-SAT_problem_with_supressor_logic%3F&amp;diff=7729"/>
				<updated>2009-04-08T22:44:01Z</updated>
		
		<summary type="html">&lt;p&gt;Wvernon: /* How could suppressor logic be used to solve the Sakamoto 3-SAT problem? */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== What is the 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
== How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem? == &lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/GcatWiki/images/3/39/Sakamoto_DNA_computer_3SAT.pdf Sakamoto et al.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:hairpin2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
Sakamoto used hairpin formations in single stranded DNA (ssDNA) as a molecular computer. Hairpin structures are formed when complimentary bases on the same strand attach to each other forming a loop. As shown in Picture B above, C and -C are compliments of each other, and bind together. Picture A is what a normal ssDNA should look like. Sakamoto used this self assembly of secondary structures on a satisfiability (SAT) problem. The problem had six inputs and ten clauses. An example of a clause would be (a or b or -c), and could include any combinations of inputs from a to f including -a to -f. If the problem is satisfied, the ssDNA stays in it's normal form. If the problem is not satisfied, the ssDNA forms a hairpin. Later in the paper it explains that the hairpin forming molecules can be removed from the others with certain techniques. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The 10 clause 3-SAT problem solved in the paper is:&lt;br /&gt;
&lt;br /&gt;
(a or b or –c)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or d) &amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or –c or e)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or d or –f)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or d)&amp;lt;br&amp;gt;&lt;br /&gt;
(a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or –c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
(-a or c or –d)&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== What is suppressor logic? ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Suppressor Suppressor logic uses suppressor tRNAs to avoid frameshift mutations in an amino acid sequence.'''&lt;br /&gt;
&lt;br /&gt;
A frameshift is a genetic mutation caused by the addition or deletion of nucelotides to a given sequence which codes for a protein.  Since codons are read in a series of three, the addition or deletion of nucleotides will disrupt the reading frame.  This disruption will most likely cause the production of a nonfunctional protein.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor4.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
A frameshift occurs and, in this case, a guanine is added to the sequence.  If nothing is done, enzyme A will not be made, meaning the clause will not be satisfied.&lt;br /&gt;
&lt;br /&gt;
The suppressor tRNA allows the 4 letter sequence to be read as a single codon, therefore, keeping the protein on track.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
If more than one frameshift mutation is introduced into a coding sequence, then logical operators can be encoded. Suppressor a binds to CCCG, supressor b binds to CUGC, and suppressor c binds to ACCG below:&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
# AUG CCCG CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG CUGC CUG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG  gg CUGC AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
# AUG CCCG gg CUGC gg ACCG AGG ... rest of Gene &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Construct&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Gene&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | Logical operation&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Phenotype || a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Phenotype || a AND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Phenotype || a OR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Phenotype || a OR b OR c&lt;br /&gt;
|-&lt;br /&gt;
| 1 || Repressor|| NOT a&lt;br /&gt;
|-&lt;br /&gt;
| 2 || Repressor|| a NAND b&lt;br /&gt;
|-&lt;br /&gt;
| 3 || Repressor|| a NOR b&lt;br /&gt;
|-&lt;br /&gt;
| 4 || Repressor|| NOT (a OR b OR c)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Logical clauses can be connected by AND operators if the proteins produced are part of a biochemical pathway.'''  In this case, a AND b AND c: &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:suppressor2.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== How could suppressor logic be used to solve the Sakamoto 3-SAT problem? ==&lt;br /&gt;
&lt;br /&gt;
'''Definitions'''&lt;br /&gt;
&lt;br /&gt;
Inputs = framshift suppressor tRNAs &lt;br /&gt;
&lt;br /&gt;
Input value = supp a is 1, supp g is 0; supp b is 1, supp h is 0, etc. up to tth 6th pair of f and l&lt;br /&gt;
&lt;br /&gt;
Logical clause (LC) = three inputs connected by OR, eg. (a OR b OR e)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Translation into DNA sequence cag CCCG aa GGGC tt GTTG cag&lt;br /&gt;
&lt;br /&gt;
This makes an XOR logic gate as only one suppressor can be used at one time to maintain the reading frame.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Logical expression (LE) = string of LCs connected by AND&lt;br /&gt;
&lt;br /&gt;
'''Subroutine'''&lt;br /&gt;
&lt;br /&gt;
1. Individual bacteral cells use Hin/hix system to randomly choose of of the 64 possible combinations of 6 inputs.&lt;br /&gt;
&lt;br /&gt;
2. Each bacterial cell carries out the following subroutine on each LC: IF LC=TRUE THEN &amp;quot;check the next LC&amp;quot; ELSEIF LC=FALSE &amp;quot;go get a new set of inputs with step 1&amp;quot;&lt;br /&gt;
&lt;br /&gt;
3. If/when a bacterial cell finds a set of inputs that satisfies the entire LE (ie. a solution to the 3-SAT problem), it will glow green.&lt;br /&gt;
&lt;br /&gt;
== Things we need to learn about ==&lt;br /&gt;
&lt;br /&gt;
'''Processing of tRNA precursors in E. coli''' &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[http://www.nature.com/embor/journal/v2/n1/full/embor501.html Mörl and Marchfelder] describe processing &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt; [[Image:the_final_cut.GIF]]&amp;lt;br&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Discovery of frameshift tRNAs.  How many are known?'''  &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Is there any evidence concerning the use of several (six?) frameshift tRNAs in one cell?''' &amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Wvernon</name></author>	</entry>

	</feed>