Hypothetical Protein 644029933 (Olivia Ho-Shing) - Revision history

Olhoshing at 14:59, 9 September 2009

2009-09-09T14:59:29Z

Olhoshing at 14:35, 9 September 2009

2009-09-09T14:35:44Z

Olhoshing at 14:28, 9 September 2009

2009-09-09T14:28:12Z

New page

I randomly chose a protein with no predicted function: [http://img.jgi.doe.gov/cgi-bin/geba/main.cgi?section=GeneDetail&page=geneDetail&gene_oid=644029933 644029933] hypothetical protein

In order to search for some possible function I tried using:
#BLASTn
#BLASTp
#[http://gcat.davidson.edu/DGPB/kd/kyte-doolittle.htm Kyte-Doolittle Plot]
#[http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_preda.html PREDATOR]

== BLASTn and BLASTp ==
The nucleotide sequence for this gene does have a start codon (ATG) and stop codon (TGA) defined. The BLASTn hits for the nucleotide sequence, other than a perfect alignment with itself (Halomicrobium mukohataei complete genome), returned hits with poor Query coverage (<10%) and unreliable E-values (>0.05). <br>
[[Image:hyp-blastn|500px|center]]<br>

@@ Line 6: / Line 6: @@
 #[http://gcat.davidson.edu/DGPB/kd/kyte-doolittle.htm Kyte-Doolittle Plot]
 #[http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_preda.html PREDATOR]
 == BLASTn and BLASTp ==
 The nucleotide sequence for this gene does have a start codon (ATG) and stop codon (TGA) defined. The BLASTn hits for the nucleotide sequence, other than a perfect alignment with itself (Halomicrobium mukohataei complete genome), returned hits with poor Query coverage (<10%) and unreliable E-values (>0.05). <br>
-[[Image:hyp-blastn|500px|center]]<br>
+[[Image:hyp-blastn.png|500px|center]]<br>
 For the BLASTp hits, there were several hits for a monooxygenase protein, but the E-values were very unreliable.
-<br>[[Image:hyp-blastp|500px|center]]<br>
+<br>[[Image:hyp-blastp.png|500px|center]]<br>
-[[Image:hyp-blastp-align|thumb|500px|center]]<br>
+[[Image:hyp-blastp-align.png|thumb|500px|center]]<br>
 == Kyte-Doolittle Plot ==
-Kyte Doolittle plots
+Kyte Doolittle hydropathy plots use an amino acid sequence to predict whether the protein crosses the plasma membrane, as in an integral membrane protein. Predicting if this hypothetical protein is an integral membrane protein would give some clue to its function. When I submitted the amino acid sequence, the plot indicated that this sequence probably does not cross the plasma membrane (If it did, there would be peaks spanning above the red line at 1.8).
-== PREDATOR ==
+== Shine Dalgarno ==
-a [http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=Retrieve&db=protein&dopt=GenPept&RID=AFEVZ8ST012&log%24=prottop&blast_rank=6&list_uids=167567057 monooxygenase] from the BLASTp hits.
+The 50 bp upstream of the start codon are: TCTGGAGATCGACCGCAAGGCCGTGACCGTCCGAGCGGAGGACTGACAGC

← Older revision		Revision as of 14:35, 9 September 2009
Line 10:		Line 10:
	The nucleotide sequence for this gene does have a start codon (ATG) and stop codon (TGA) defined. The BLASTn hits for the nucleotide sequence, other than a perfect alignment with itself (Halomicrobium mukohataei complete genome), returned hits with poor Query coverage (<10%) and unreliable E-values (>0.05). <br>		The nucleotide sequence for this gene does have a start codon (ATG) and stop codon (TGA) defined. The BLASTn hits for the nucleotide sequence, other than a perfect alignment with itself (Halomicrobium mukohataei complete genome), returned hits with poor Query coverage (<10%) and unreliable E-values (>0.05). <br>
	[[Image:hyp-blastn\|500px\|center]]<br>		[[Image:hyp-blastn\|500px\|center]]<br>
		+
		+	For the BLASTp hits, there were several hits for a monooxygenase protein, but the E-values were very unreliable.
		+	<br>[[Image:hyp-blastp\|500px\|center]]<br>
		+	[[Image:hyp-blastp-align\|thumb\|500px\|center]]<br>
		+
		+	== Kyte-Doolittle Plot ==
		+	Kyte Doolittle plots
		+
		+
		+	== PREDATOR ==
		+	a [http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=Retrieve&db=protein&dopt=GenPept&RID=AFEVZ8ST012&log%24=prottop&blast_rank=6&list_uids=167567057 monooxygenase] from the BLASTp hits.