Shamita P - Revision history

Shpunjabi: /* Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum) */

2012-04-17T18:12:02Z

‎Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum)

Shpunjabi: /* Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum) */

2012-04-15T15:51:00Z

‎Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum)

Shpunjabi at 15:37, 15 April 2012

2012-04-15T15:37:38Z

Shpunjabi at 15:17, 15 April 2012

2012-04-15T15:17:52Z

Shpunjabi at 15:09, 15 April 2012

2012-04-15T15:09:17Z

Shpunjabi: /* Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum) */

2012-04-12T20:20:38Z

‎Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum)

Shpunjabi: /* Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum) */

2012-04-12T20:17:55Z

‎Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum)

Shpunjabi: /* Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum) */

2012-04-12T20:04:13Z

‎Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum)

Shpunjabi: /* Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum) */

2012-04-12T20:01:37Z

‎Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum)

Shpunjabi: /* Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum) */

2012-04-12T19:56:15Z

‎Cold Tolerance of the Northern highbush blueberry (Vaccinium corymbosum)

@@ Line 50: / Line 50: @@
 '''Possible Downstream Targets of CBFs'''
-Rather than triggering a new pathway of genes, CBFs modify already existing metabolic and biological pathways in response to cold stress. Depending on the pathway, CBFs can induce or repress gene expression. Because the activity of CBF is extremely variable, I chose to focus on a specific common pathway on phospholipid signaling outlined in the microarray study conducted by [http://www.hort.purdue.edu/hort/research/zhu/articles/2005/leebh.pdf, Byeong-ha Lee et al]. This study discovered that the timing of induction for genes in the pathway was key to the cold acclimation process. In particular, ''IP5PII'' and ''ADTGK1'' were activated early in the cold acclimation process, while genes such as ''IPK2a'' and phospholipase C (PLC) are induced at a later time. The timing suggests that the former two genes are more upstream in the signaling pathway, while the latter two genes are more downstream.
+Rather than triggering a new pathway of genes, CBFs modify already existing metabolic and biological pathways in response to cold stress. Depending on the pathway, CBFs can induce or repress gene expression. Because the activity of CBF is extremely variable, I chose to focus on a specific common pathway on phospholipid signaling outlined in the microarray study conducted by [http://www.hort.purdue.edu/hort/research/zhu/articles/2005/leebh.pdf, Byeong-ha Lee et al]. This study discovered that the timing of induction for genes in the pathway was key to the cold acclimation process. In particular, ''IP5PII'' and ''ATDGK1'' were activated early in the cold acclimation process, while genes such as ''IPK2a'' and phospholipase C (PLC) are induced at a later time. The timing suggests that the former two genes are more upstream in the signaling pathway, while the latter two genes are more downstream.
-A KEGG Map of the Phosphotidylinositol Signaling Pathway helps us gain a better picture, that the signaling pathway is not exactly straightforward, and involves several feedback loops. The enzymes of interest are circled in red, where 3.1.3.56 is IP5PII, 2.7.1.107 is ADTGK1 and 2.7.1.140 is IPK2a. SSR Analysis was done for IP5PII, ADTGK1, and IPK2a with results shown below. <br>
+A KEGG Map of the Phosphotidylinositol Signaling Pathway helps us gain a better picture, that the signaling pathway is not exactly straightforward, and involves several feedback loops. The enzymes of interest are circled in red, where 3.1.3.56 is IP5PII, 2.7.1.107 is ATDGK1 and 2.7.1.140 is IPK2a. SSR Analysis was done for IP5PII, ATDGK1, and IPK2a with results shown below. <br>
 [[Image:KEGGMAP_cropped.jpg|thumb|center|upright=3|]]<br>
@@ Line 59: / Line 59: @@
 Using the information gleaned from the literature and also from the results gained through the Vaccinium database, I have constructed a tentative signaling pathway in response to cold environments. Though the pathway is likely correct in the general order of genes activated, it likely excludes intermediate reactions particularly between CBF and IP5II activation. In the pathway, genes in blue indicate ones for which primers have been obtained. See caption for explanation of pathway.
-[[File:Tentative_pathway_Final.jpg|thumb|center|900px|alt=Map of the world.|'''Tentative Pathway for Cold Activation in ''Vaccinium corymbosum'''''. Cold climates cause SIZ1 mediated sumoylation of ICE1. The ICE1 protein then targets CBF class of transcription factors in blueberry, which induce/repress a host of metabolic pathways. The phospholipid signaling pathway is shown above. Early genes activated in the pathway (either by CBF or CBF targets) include ''IP5PII'' and ''ADTGK1''. IP5PII continues to activate ''IPK2a'' as seen in the KEGG Map Above.]]<br><br>
+[[File:Tentative_pathway_Final.jpg|thumb|center|900px|alt=Map of the world.|'''Tentative Pathway for Cold Activation in ''Vaccinium corymbosum'''''. Cold climates cause SIZ1 mediated sumoylation of ICE1. The ICE1 protein then targets CBF class of transcription factors in blueberry, which induce/repress a host of metabolic pathways. The phospholipid signaling pathway is shown above. Early genes activated in the pathway (either by CBF or CBF targets) include ''IP5PII'' and ''ATDGK1''. IP5PII continues to activate ''IPK2a'' as seen in the KEGG Map Above.]]<br><br>
 '''Results'''
@@ Line 127: / Line 127: @@
-''[http://www.ncbi.nlm.nih.gov/nuccore/28393495?report=fasta ADTGK1]'' <br>
+''[http://www.ncbi.nlm.nih.gov/nuccore/28393495?report=fasta ATDGK1]'' <br>
 Primer Matches on Scaffold 00019 (~355,000-360,000) <br>
@@ Line 166: / Line 166: @@
 '''EST Search of Genes in the Cold Response Pathway'''
-My goal was to find whether any of the genes I had found in the cold response pathway (''ICE1'', ''ADTGK1'', ''SIZ1'', ''CBF1c'') have been captured within Expressed Sequence Tags (ESTs) for blueberry. I accomplished the search in several ways, but often began by using the sequence from the scaffold to which my gene ortholog had matched and searching for the 3' end of the genes on the scaffold. Note that all ESTs below have been found directly from the Vaccinium webpage.<br><br>
+My goal was to find whether any of the genes I had found in the cold response pathway (''ICE1'', ''ATDGK1'', ''SIZ1'', ''CBF1c'') have been captured within Expressed Sequence Tags (ESTs) for blueberry. I accomplished the search in several ways, but often began by using the sequence from the scaffold to which my gene ortholog had matched and searching for the 3' end of the genes on the scaffold. Note that all ESTs below have been found directly from the Vaccinium webpage.<br><br>
 '''SUMMARY'''<br>
 '''''ICE1''''':[http://www.ncbi.nlm.nih.gov/nucest/cv091282 CV091282] (E=10^-4), [http://www.ncbi.nlm.nih.gov/nucest/45743601?report=fasta CF811286], [http://www.ncbi.nlm.nih.gov/nucest/45744508?report=fasta CF810912], and [http://www.ncbi.nlm.nih.gov/nucest/51569995?report=fasta CV090656] (E>1.2).<br>
-'''''ADTGK1''''':[http://www.ncbi.nlm.nih.gov/nucest/52032501?report=fasta CV190823] (E<10^-9).<br>
+'''''ATDGK1''''':[http://www.ncbi.nlm.nih.gov/nucest/52032501?report=fasta CV190823] (E<10^-9).<br>
 '''''SIZ1''''':[http://www.ncbi.nlm.nih.gov/nucest/45744136?report=fasta CF810540] (E=10^-4), [http://www.ncbi.nlm.nih.gov/nucest/51570383?report=fasta CV091044] (E=10^-26). <br>
 '''''CBF1c''''':[http://www.ncbi.nlm.nih.gov/nucest/105630232?report=fasta DW043014] (E=10^-16), [http://www.ncbi.nlm.nih.gov/nucest/105630342?report=fasta DW043054] (E=10^-16)<br><br>
@@ Line 183: / Line 183: @@
 Additionally, I decided to search a 2,233 bp fragment of the scaffold in which suspected regions of the ICE1 gene were enveloped by PCR primers from the SSR search conducted above. Searching the non-specific nucleotide collection using BLASTn for somewhat similiar sequences, I found that the fragment had excellent matches to ICE sequences in other species including grape (E=10^(-62)). I then used this same fragment in a search for ESTs in the Vaccinium database, finding results with poor E scores (E>1.2): [http://www.ncbi.nlm.nih.gov/nucest/45743601?report=fasta '''CF811286'''], [http://www.ncbi.nlm.nih.gov/nucest/45744508?report=fasta '''CF810912'''], and [http://www.ncbi.nlm.nih.gov/nucest/51569995?report=fasta '''CV090656'''].<br><br>
-'''''ADTGK1'''''<br>
+'''''ATDGK1'''''<br>
 Length: 2,914bp<br>
 Scaffold: 00019
@@ Line 189: / Line 189: @@
 I searched towards the 3' ends of the genes and matched to regions of the scaffold. All three regions searched (between 2,474-2,597 bp, corresponding to 361,728-361,851 on the scaffold) gave the same EST match of [http://www.ncbi.nlm.nih.gov/nucest/52032501?report=fasta '''CV190823'''] with the greatest E score being 10^-9. I used the EST to search for its function in BLASTn as I did above, and found that it matched closely to a DAGK gene in grape (E=10^-4). This EST comes from the '''bud library''' which is in the [http://bioinformatics.towson.edu/BBGD454/ Towson database].
-[[Image:ADTGK1_BLASTimage.jpg|thumb|center|upright=6|]]<br><br>
+[[Image:ATDGK1_BLASTimage.jpg|thumb|center|upright=6|]]<br><br>
 '''''SIZ1'''''<br>
@@ Line 197: / Line 197: @@
 Of all the genes I searched, ''SIZ1'' was the most difficult to find EST matches. I began by attempting to search scaffold matches with the 3' ends of genes, which yielded no results at all. Then, I searched a portion of the fragment enveloped by PCR primers from the SSR search. I obtained [http://www.ncbi.nlm.nih.gov/nucest/45744136?report=fasta '''CF810540'''] (E=10^-4) as a viable hit. After inputting only the EST into BLASTn search, I found that the Rhododendron RPC1 gene was the best hit. However, I also input the original scaffold fragment (used to obtain the EST) into NCBI and found that it gave SIZ1 gene in grape as a good match (E=10^-26).
-[[File:SIZ1_ScaffoldSearch.jpg|thumb|center|900px|alt=Map of the world.|'''Tentative Pathway for Cold Activation in ''Vaccinium corymbosum'''''. Cold climates cause SIZ1 mediated sumoylation of ICE1. The ICE1 protein then targets CBF class of transcription factors in blueberry, which induce/repress a host of metabolic pathways. The phospholipid signaling pathway is shown above. Early genes activated in the pathway (either by CBF or CBF targets) include ''IP5PII'' and ''ADTGK1''. IP5PII continues to activate ''IPK2a'' as seen in the KEGG Map Above.]]<br><br>
+[[File:SIZ1_ScaffoldSearch.jpg|thumb|center|900px|alt=Map of the world.|'''Tentative Pathway for Cold Activation in ''Vaccinium corymbosum'''''. Cold climates cause SIZ1 mediated sumoylation of ICE1. The ICE1 protein then targets CBF class of transcription factors in blueberry, which induce/repress a host of metabolic pathways. The phospholipid signaling pathway is shown above. Early genes activated in the pathway (either by CBF or CBF targets) include ''IP5PII'' and ''ATDGK1''. IP5PII continues to activate ''IPK2a'' as seen in the KEGG Map Above.]]<br><br>
 Additionally, I found a different region of the scaffold that I submitted for EST matching. When I input the result [http://www.ncbi.nlm.nih.gov/nucest/51570383?report=fasta '''CV091044'''] (E=10^-26) into the NCBI database, I found that it matched closely to an ''slf-s5'' gene in F-box (E=10^-6).<br>
@@ Line 281: / Line 281: @@
 scaffold02480  length=50312      2e-40 <br>
-'''''ADTGK1'''''
+'''''ATDGK1'''''
 Dr. Campbell is helping me find EST matches for this gene using the Towson database. He began with the EST I had found as a good match on the Vaccinium webpage [http://www.ncbi.nlm.nih.gov/nucest/52032501?report=fasta '''CV190823''']. Using this EST, he searched the all 454 sequences in the Towson website, and found a sufficient match to a contig09083. The name of this exact contig was found in a the results of Bud tissues, but it appears that the names are not unique identifiers because the actual sequences are different. The Bud contig was BLASTED against NR Genbank, which found the best match as a phosphoinositol phosophatase in grape.

@@ Line 273: / Line 273: @@
 Using the EST sequences, I found new scaffolds.
-'''Scaffolds Found using the EST(All New''' <br>
+'''Scaffolds Found using the EST(All New)''' <br>
 scaffold00508  length=174034     0.0 <br>
 scaffold00628  length=181951     3e-55 <br>
@@ Line 283: / Line 283: @@
 '''''ADTGK1'''''
-Dr. Campbell is helping me find EST matches for this gene using the Towson database. He began with the EST I had found as a good match on the Vaccinium webpage [http://www.ncbi.nlm.nih.gov/nucest/52032501?report=fasta '''CV190823'''].
+Dr. Campbell is helping me find EST matches for this gene using the Towson database. He began with the EST I had found as a good match on the Vaccinium webpage [http://www.ncbi.nlm.nih.gov/nucest/52032501?report=fasta '''CV190823''']. Using this EST, he searched the all 454 sequences in the Towson website, and found a sufficient match to a contig09083. The name of this exact contig was found in a the results of Bud tissues, but it appears that the names are not unique identifiers because the actual sequences are different. The Bud contig was BLASTED against NR Genbank, which found the best match as a phosphoinositol phosophatase in grape.

@@ Line 269: / Line 269: @@
 [[Image:ICE1_Towson.jpg|thumb|center|upright=6|]]<br>
-EST (F5BH0J002JLUPG) was another good hit whose sequence I was able to locate, and search in NCBI, finding that it was a good match for another populus EST in drought stressed leaves. Using the sequences, I found new scaffolds.
+EST (F5BH0J002JLUPG) was another good hit from a different portion of the scaffold whose sequence I was able to locate, and search in NCBI, finding that it was a good match for another populus EST in drought stressed leaves.
 '''Scaffolds Found using the EST(All New''' <br>
@@ Line 278: / Line 280: @@
 scaffold00936  length=116958     9e-43 <br>
 scaffold02480  length=50312      2e-40 <br>

@@ Line 211: / Line 211: @@
 '''New Scaffolds found with ESTs'''
-I used an EST for ''ICE1'' to find more scaffold matches. Here's what I found:
+I used the best EST hit for all genes to find more scaffold matches. Here's what I found:
-''ICE1''<br>
+''ICE1'' CV091282<br>
 scaffold00197<br>
 length=247576<br>
-.0<br>
+E score = 0.0<br><br>
 scaffold01278<br>
 length=69683<br>
-e-17<br>
+E score = 2e-17<br><br>
 scaffold01345<br>
 length=87746 <br>
-e-14<br><br>
+E score = 2e-14<br><br><br>
-''CBF1c''<br>
+''CBF1c'' DW043014<br>
 scaffold00009<br>
 length=735401<br>
-.0<br>
+E score = 0.0<br><br>
 scaffold01137 <br>
 length=103431 <br>
-e-10<br>
+E score = 2e-10<br><br>
 scaffold00814<br>
 length=115091  <br>
-e-05 <br>
+E score = 4e-05 <br>
 Original scaffold used
@@ Line 256: / Line 256: @@
 [[Image:SIZ1_Towson.jpg|thumb|center|upright=6|]]<br>
-Scaffolds Found using the EST(4 New) <br>
+'''Scaffolds Found using the EST(4 New)''' <br>
 scaffold02191  length=47427   e-146 *NEW<br>
 scaffold00717  length=144267  e-112 <br>
@@ Line 271: / Line 271: @@
 EST (F5BH0J002JLUPG) was another good hit whose sequence I was able to locate, and search in NCBI, finding that it was a good match for another populus EST in drought stressed leaves. Using the sequences, I found new scaffolds.
-Scaffolds Found using the EST(All New) <br>
+'''Scaffolds Found using the EST(All New''' <br>
 scaffold00508  length=174034     0.0 <br>
 scaffold00628  length=181951     3e-55 <br>

@@ Line 238: / Line 238: @@
 ---
-I discovered the Bioinformatics Towson database with the help of Dr. Rowland, and found that it contained a host of EST sequences taken from different physical portions of the the blueberry plant under different conditions.
+I discovered the Bioinformatics Towson database with the help of Dr. Rowland, and found that it contained a host of EST sequences taken from different tissues of the the blueberry plant under different environmental conditions.
 Using the BLAST tool to search portions of the scaffolds for the corresponding genes, I was able to find some ESTs that were good matches. I conducted a non-specific nucleotide search for these ESTs in general BLAST to find their functions. If I was satisfied with the functions I saw, I used the ESTs to find new scaffold matches for the genes.
@@ Line 245: / Line 245: @@
 '''''SIZ1'''''
-Portion of the SIZ1 scaffold (pg 34) was insterted in BLASTn against All 454 Sequences
+Portion of the SIZ1 scaffold (pg 34) was insterted in BLASTn against All 454 Sequences.
 Best result obtained was F5QOTHQ01DH7A0 (E=10^-112). Then, I downloaded all sequences (available as a zip file) and opened each of the three fna files until I found this sequences (no description available).
-F5QOTHQ01DH7A0 rank=0490157 x=1320.5 y=1514.0 length=381
+F5QOTHQ01DH7A0 length=381
 ATCAGACACGTCTAGAGGCCGAGGCGGCCGACATGTTTTGTCTTTTGTTCTGTTTCTTTTTTTTTCGACAAGAAACTCTTCATTAAAATTACTCTAAGTCTTTACAAAGAACAACTTCAAAACCGGGCGGAATACAACCCGTATTAAGCAAAAAGGAACTATCAAGACATTTAGAAGCTAACCAATGTGCGGCTTTGTTTTTCTCTCTACAACACCAAACAAAAGACCAGTTGCTAGAAGTTGCCCAATACTTGATGTCTTCTACCAGAGCTCGAATCTCCCAAGGACCTGTAGAATTTACCGATTGAAGGCAAGTGATGAGTTCCAAGCAGTCAGATTCAAACACTACCTCTGAGAACTTCATCTGCCTTGCGACATCAC
-I input this sequence into the nonspecific nucleotide BLASTn search of NCBI and found that there were several sequences that matched very well to the general pathway that SIZ1 is involved in ie) cellular stresses associated with cold tolerance (and drought) because the movement of water is similar in both of these pathways.
+I input this sequence into the nonspecific nucleotide BLASTn search of NCBI and found that there were several good matches to the general pathway that SIZ1 is involved in ie) cellular stresses associated with cold tolerance (and drought). The movement of water is similar under stresses of cold and drought.
 [[Image:SIZ1_Towson.jpg|thumb|center|upright=6|]]<br>
@@ Line 266: / Line 266: @@
 '''''ICE1'''''
-Same method to obtain EST as above was used for this gene. THe best hit obtained for a portion of the scaffold 00051 was a contig08655
+Same method to obtain EST as above was used for this gene. The best hit obtained for a portion of the scaffold 00051 was a contig08655.
 [[Image:ICE1_Towson.jpg|thumb|center|upright=6|]]<br>
-I additionally found an EST (F5BH0J002JLUPG) whose sequence I was able to locate, and search in NCBI, finding that it was a good match for another populus EST in drought stressed leaves. Using the sequences, I found new scaffolds.
+EST (F5BH0J002JLUPG) was another good hit whose sequence I was able to locate, and search in NCBI, finding that it was a good match for another populus EST in drought stressed leaves. Using the sequences, I found new scaffolds.
 Scaffolds Found using the EST(All New) <br>

← Older revision		Revision as of 20:17, 12 April 2012
Line 268:		Line 268:
	Same method to obtain EST as above was used for this gene. THe best hit obtained for a portion of the scaffold 00051 was a contig08655ز		Same method to obtain EST as above was used for this gene. THe best hit obtained for a portion of the scaffold 00051 was a contig08655ز
	[[Image:ICE1_Towson.jpg\|thumb\|center\|upright=6\|]]<br>		[[Image:ICE1_Towson.jpg\|thumb\|center\|upright=6\|]]<br>
		+
		+	scaffold00508 length=174034 0.0 <br>
		+	scaffold00628 length=181951 3e-55 <br>
		+	scaffold00440 length=239660 3e-55 <br>
		+	scaffold01645 length=53899 4e-45 <br>
		+	scaffold00936 length=116958 9e-43 <br>
		+	scaffold02480 length=50312 2e-40 <br>

@@ Line 261: / Line 261: @@
 scaffold00530  length=187309  1e-66 *NEW<br>
 scaffold00751  length=152548  9e-52 *NEW<br>
-scaffold04605  length=6686    6e-16 *NEW<br>
+scaffold04605  length=6686    6e-16 *NEW<br><br>