Revision history of "J-GGA Promoter Sequence"

From GcatWiki
Jump to: navigation, search

Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

  • (cur | prev) 15:44, 11 June 2013Spolpitiyaarachchige (talk | contribs). . (1,820 bytes) (+1,820). . (Created page with "Design of promoters for use in J-GGA Scaffold Promoters Used P5 highest J119031 BBa_J119031 Part-only sequence (36 bp) ttgacaattaatcatccggctcgtaatttatgtgga P14 medium J11...")