Difference between revisions of "Catherinel Notebook1"

From GcatWiki
Jump to: navigation, search
(Created page with '__NOTOC__ <!-- ==~~== Notes thumb|100px|none|1.0% gel. Lane 1:None. === === <pre> to do </pre> --> Back to Main Page ==[[User:C…')
 
Line 11: Line 11:
 
[[Catherine_Doyle's Notebook|Back to Main Page]]
 
[[Catherine_Doyle's Notebook|Back to Main Page]]
  
−
==[[User:Catherine|cadoyle]] , 25 August 2013 (EDT)==
+
==[[User:Catherine|cadoyle]], 25 August 2013 (EDT)==
 +
I meet with Dr. Campbell on Wednesday, 21st of August 2013. We discussed finishing up my thesis proposal by adding in the aptamer sequences for caffeine and 3-methylxanthine that I will be designing riboswitches for.
 +
 
 +
I found caffeine's aptamer from Alpha Diagnostic Intl. Inc [[http://www.4adi.com/ccpc2774-27034-caffeine-28tct8-429--rna-aptamer--unlabeled-rna-aptamers-ar-214-u.htm]]. I downloaded the paper: Ferguson et al. 2004 that characterized the aptamer and obtained the sequence. On Alpha Diagnostic Int. Inc website there is a  product data sheet for the caffeine aptamer that will be useful [[http://www.4adi.com/objects/catalog/product/extras/AR-214-U.pdf]].
 +
 
 +
I found the apatmer for 3-methylxanthine from Soukop et al. (2000). I found this paper while I was doing research for my proposal. I read in Lee et al. (2010) that a 3-methylxanthien apatamer had been discovered from mutation in the theophylline aptamer. Lee et al. (2010) cited Soukop et al. (2000) for the characterization of the 3-methylxanthine aptamer. In Soukop et al. (2000) they list two aptamers for 3-methylxanthine I picked the one with C22 mutation only because it had a stronger affinity for 3-methlyxanthine (Figure 2C) despite Figure 1B showing that it's specificity for 3-methylxanthine is low.
 +
 
 +
{| class="wikitable"
 +
|-
 +
! Name !! Sequence !! Reference
 +
|-
 +
| Caffeine || 5-GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGGAUCAUCGGACUUUGUCCUGUGGAGUAAGAUCG CGAAACGGUGAAAGCCGUAGGUCU-3 || Ferguson et al. (2004)
 +
|-
 +
| 3-methlyxanthine|| 5- AUACCAGCCGAAAGGCCAUUGGCAG-3 || Soukop et al. (2000)
 +
|-
 +
|}
 +
 
 +
I find it interesting and concerning that the aptamer for 3-methylxanthine is so short. Maybe the hammerhead ribozyme needs to be added to the sequence. I will check with Dr. Campbell about it.
 +
 
 +
Also, In my meeting with Dr. Campbell we talked about comparing the structure of theophylline aptamer in Riboswitch D from Topp et al. (2010) to the structures of the caffeine aptamer and 3-methylxanthien aptamer in Riboswitch D. M-fold is web base software that predicts secondary structures of DNA and  RNA, which we can use to compare the structures of the aptamers to see if the Riboswitch D will work for the three aptamers.
 +
 
 +
I read the paper characterizing the software program Zuker (2003) to understand what the input and output values mean for the program.
 +
 
 +
M-Fold Characterization of the Theophylline, Caffiene, and 3-Methylxanthine Aptamers
 +
 
 +
 
 +
Theophylline:
 +
 
 +
M-Fold Server Input (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form):
 +
 
 +
I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).
 +
 
 +
 
 +
Figure 1. Default values for user input describing folding conditions.
 +
 
 +
 
 +
 
 +
Figure 2. Default values for user input describing output conditions.
 +
 
 +
 
 +
 
 +
Results:
 +
Theophylline Sequence:
 +
 
 +
 +
Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 5. Window size id determined by program based on sequence length.
 +
 
 +
 
 +
Energy dot plot
 +
In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 +
Figure 4. Energy Diagram.
 +
The optimal energy for optimal folding in -71.8kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.
 +
 
 +
 
 +
 
 +
 
 +
 
 +
ss-count
 +
ss-count is the propensity of a base to be single stranded, as measured by the number of times it is single stranded in a group of predicted foldings. The ss-count file gives the number of predicted foldings on the first line. The ith subsequent line contains i and the number of foldings in which the ith base was single stranded. The plotting option gives plots of ss-count values averaged over a user selected window.
 +
 
 +
 +
Curricular structural plots.
 +
 +
 +
 
 +
Predicted structures:
 +
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 +
 
 +
 
 +
 
 +
 
 +
 
 +
08/25/1992
 +
 
 +
Caffeine:
 +
 
 +
M-Fold Server Input (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form):
 +
 
 +
I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
Figure 1. Default values for user input describing folding conditions.
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
Figure 2. Default values for user input describing output conditions.
 +
 
 +
 
 +
 
 +
Results:
 +
Caffeine Sequence:
 +
 
 +
 +
Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 2. Window size is determined by program based on sequence length.
 +
 
 +
 
 +
Energy dot plot
 +
In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.
 +
 
 +
 
 +
 
 +
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
Figure 4. Energy Diagram.
 +
The optimal energy for optimal folding in -25.6kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.
 +
 
 +
 
 +
 
 +
 
 +
 
 +
ss-count
 +
ss-count is the propensity of a base to be single stranded, as measured by the number of times it is single stranded in a group of predicted foldings. The ss-count file gives the number of predicted foldings on the first line. The ith subsequent line contains i and the number of foldings in which the ith base was single stranded. The plotting option gives plots of ss-count values averaged over a user selected window.
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
Curricular structural plots.
 +
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
Predicted structures:
 +
 
 +
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 +
 
 +
 
 +
 
 +
 +
 
 +
 
 +
3-Methylxanthine:
 +
 
 +
M-Fold Server Input (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form):
 +
 
 +
I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
Figure 1. Default values for user input describing folding conditions.
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
Figure 2. Default values for user input describing output conditions.
 +
 
 +
 
 +
 
 +
 
 +
 
 +
Results:
 +
3-methylxanthine Sequence:
 +
 +
 
 +
Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 0. Window size is determined by program based on sequence length.
 +
 
 +
 
 +
Energy dot plot
 +
In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.
 +
 
 +
 
 +
 
 +
 +
 
 +
 
 +
Figure 4. Energy Diagram.
 +
The optimal energy for optimal folding in -8.9kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
Curricular structural plots.
 +
 +
 
 +
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
Predicted structures:
 +
 
 +
 
 +
 
 +
 +
 
  
  
 
=== ===
 
=== ===

Revision as of 11:09, 28 August 2013

Back to Main Page

cadoyle, 25 August 2013 (EDT)

I meet with Dr. Campbell on Wednesday, 21st of August 2013. We discussed finishing up my thesis proposal by adding in the aptamer sequences for caffeine and 3-methylxanthine that I will be designing riboswitches for.

I found caffeine's aptamer from Alpha Diagnostic Intl. Inc [[1]]. I downloaded the paper: Ferguson et al. 2004 that characterized the aptamer and obtained the sequence. On Alpha Diagnostic Int. Inc website there is a product data sheet for the caffeine aptamer that will be useful [[2]].

I found the apatmer for 3-methylxanthine from Soukop et al. (2000). I found this paper while I was doing research for my proposal. I read in Lee et al. (2010) that a 3-methylxanthien apatamer had been discovered from mutation in the theophylline aptamer. Lee et al. (2010) cited Soukop et al. (2000) for the characterization of the 3-methylxanthine aptamer. In Soukop et al. (2000) they list two aptamers for 3-methylxanthine I picked the one with C22 mutation only because it had a stronger affinity for 3-methlyxanthine (Figure 2C) despite Figure 1B showing that it's specificity for 3-methylxanthine is low.

Name Sequence Reference
Caffeine 5-GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGGAUCAUCGGACUUUGUCCUGUGGAGUAAGAUCG CGAAACGGUGAAAGCCGUAGGUCU-3 Ferguson et al. (2004)
3-methlyxanthine 5- AUACCAGCCGAAAGGCCAUUGGCAG-3 Soukop et al. (2000)

I find it interesting and concerning that the aptamer for 3-methylxanthine is so short. Maybe the hammerhead ribozyme needs to be added to the sequence. I will check with Dr. Campbell about it.

Also, In my meeting with Dr. Campbell we talked about comparing the structure of theophylline aptamer in Riboswitch D from Topp et al. (2010) to the structures of the caffeine aptamer and 3-methylxanthien aptamer in Riboswitch D. M-fold is web base software that predicts secondary structures of DNA and RNA, which we can use to compare the structures of the aptamers to see if the Riboswitch D will work for the three aptamers.

I read the paper characterizing the software program Zuker (2003) to understand what the input and output values mean for the program.

M-Fold Characterization of the Theophylline, Caffiene, and 3-Methylxanthine Aptamers


Theophylline:

M-Fold Server Input (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form):

I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).


Figure 1. Default values for user input describing folding conditions.


Figure 2. Default values for user input describing output conditions.


Results: Theophylline Sequence:


Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 5. Window size id determined by program based on sequence length.


Energy dot plot In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.







Figure 4. Energy Diagram. The optimal energy for optimal folding in -71.8kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.



ss-count ss-count is the propensity of a base to be single stranded, as measured by the number of times it is single stranded in a group of predicted foldings. The ss-count file gives the number of predicted foldings on the first line. The ith subsequent line contains i and the number of foldings in which the ith base was single stranded. The plotting option gives plots of ss-count values averaged over a user selected window.


Curricular structural plots.


Predicted structures:










08/25/1992

Caffeine:

M-Fold Server Input (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form):

I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).









Figure 1. Default values for user input describing folding conditions.








Figure 2. Default values for user input describing output conditions.


Results: Caffeine Sequence:


Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 2. Window size is determined by program based on sequence length.


Energy dot plot In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.







Figure 4. Energy Diagram. The optimal energy for optimal folding in -25.6kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.



ss-count ss-count is the propensity of a base to be single stranded, as measured by the number of times it is single stranded in a group of predicted foldings. The ss-count file gives the number of predicted foldings on the first line. The ith subsequent line contains i and the number of foldings in which the ith base was single stranded. The plotting option gives plots of ss-count values averaged over a user selected window.














Curricular structural plots.















Predicted structures:








3-Methylxanthine:

M-Fold Server Input (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form):

I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).









Figure 1. Default values for user input describing folding conditions.








Figure 2. Default values for user input describing output conditions.



Results: 3-methylxanthine Sequence:


Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 0. Window size is determined by program based on sequence length.


Energy dot plot In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.




Figure 4. Energy Diagram. The optimal energy for optimal folding in -8.9kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.




Curricular structural plots.





Predicted structures: