Difference between revisions of "PCR for Bio113"

From GcatWiki
Jump to: navigation, search
Line 1: Line 1:
 
==PCR Verification of Successful GGA==
 
==PCR Verification of Successful GGA==
 
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel).  
 
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel).  
−
# Use negative control colonies as template to see the MW of the PCR product when TT is still in the plasmid and no GGA has occurred. Run one lane of this negative control PCR product for each row on your gel.  
+
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 10 µL of cells from the overnight culture. This will serve as your template.
−
# Use these two primers:
+
# Use 10 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred.  
−
* Forward = 5’ GAATTCGCGGCCGCTTCTAG 3’
+
# Add the cell cultures to the labeled tubes for your particular receiving plasmid.  
−
* Reverse = 5’ TTTGATAACATCTTCGGAGG 3’
+
 
−
* PCR product with the original TT still in place is 251 bp
+
 
−
* size of TT that should be removed by GGA is 107 bp
+
== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==
 +
 
 +
'''J119137; pClone Red  (remove 70 bp, insert <60 bp)'''
 +
113_pClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C
 +
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C
 +
113 bp amplicon for J119137
 +
 
 +
 
 +
'''J119384; rClone Red (remove 815 bp, insert <60 bp)'''
 +
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC TM = 61 C
 +
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C
 +
856 bp amplicon for J119384
 +
 
 +
'''J100204; actClone Red (remove 119 bp, insert <60 bp)'''
 +
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C
 +
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG Tm = 61 C
 +
250 bp amplicon for J100204
 +
 
 +
 
 +
'''J100205; repClone Red (remove 129 bp, insert <60 bp)'''
 +
113_repClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C
 +
113_repClone_confirm_Rev; GGTTTCTAATGGCTTCCTC Tm = 60 C
 +
340 bp amplicon for J100205

Revision as of 20:28, 18 July 2017

PCR Verification of Successful GGA

If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel).

  1. For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 10 µL of cells from the overnight culture. This will serve as your template.
  2. Use 10 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred.
  3. Add the cell cultures to the labeled tubes for your particular receiving plasmid.


PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega)

J119137; pClone Red (remove 70 bp, insert <60 bp) 113_pClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C 113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C 113 bp amplicon for J119137


J119384; rClone Red (remove 815 bp, insert <60 bp) 113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC TM = 61 C 113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C 856 bp amplicon for J119384

J100204; actClone Red (remove 119 bp, insert <60 bp) 113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C 113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG Tm = 61 C 250 bp amplicon for J100204


J100205; repClone Red (remove 129 bp, insert <60 bp) 113_repClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C 113_repClone_confirm_Rev; GGTTTCTAATGGCTTCCTC Tm = 60 C 340 bp amplicon for J100205