Difference between revisions of "Missing tRNA-trp gene found"

From GcatWiki
Jump to: navigation, search
 
(9 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
'''tRNA-trp-CCA:'''<br>
 
'''tRNA-trp-CCA:'''<br>
−
DNA Coordinates: 465777..465601
+
<br>
−
 
+
DNA Coordinates: 465601..465777 (-)<br>
−
GGGGTCGTGGCCAAGTCCGGCATGGCGACTGACTCCAGAGGCACCGCGCCCGGGACGACACTCCAGACTGATATACTGAGCGACCGGCTGATCACCGGACGCCTTGATGACCCTCTGGAGTTCCGAGGCGCAACCGGAGATATCAGTCGATCGGGAGTTCAAATCTCTCCGACCCCA<br>
+
<br>
 +
'''GGGGTCGTGGCCAAGTCCGGCATGGCGACTGACTCCAG'''AGGCACCGCGCCCGGGACGACACTCCAG<br>
 +
ACTGATATACTGAGCGACCGGCTGATCACCGGACGCCTTGATGACCCTCTGGAGTTCCGAGGCGCA<br>
 +
ACCGGAGAT'''ATCAGTCGATCGGGAGTTCAAATCTCTCCGACCCCA'''<br>
 +
<br>
 +
5' exon: 38 bp, position 1-38<br>
 +
intron: 102 bp, position 39-140<br>
 +
3' exon: 36 bp, position 141-176<br>
 
<br>
 
<br>
 
Evidence:<br>
 
Evidence:<br>
−
Similarity with ''Haloarcula marismortui tRNA-trp''<br>
+
<br>
−
Score =  163 bits (82), Expect = 4e-41
+
Similarity with ''Haloferax volcanii'' tRNA-trp<br>
−
Identities = 159/181 (87%), Gaps = 4/181 (2%)
+
Score =  190 bits (96), Expect = 2e-49<br>
−
Strand = Plus / Minus
+
Identities = 155/172 (90%), Gaps = 2/172 (1%)<br>
 +
<br>
 +
Similarity with ''Halobacterium salinarum R1'' tRNA-trp<br>
 +
Score =  174 bits (88), Expect = 1e-44<br>
 +
Identities = 154/172 (89%), Gaps = 3/172 (1%)<br>
 +
<br>
 +
Similarity with ''Haloarcula marismortui'' tRNA-trp<br>
 +
Score =  163 bits (82), Expect = 4e-41<br>
 +
Identities = 159/181 (87%), Gaps = 4/181 (2%)<br>
 +
<br>
 +
Similarity with ''Natronomonas pharaonis'' tRNA-trp<br>
 +
Score =  163 bits (82), Expect = 4e-41<br>
 +
Identities = 159/181 (87%), Gaps = 4/181 (2%)<br>
 +
<br>
 +
[http://www.jbc.org/cgi/content/abstract/263/34/17951]: "A tRNA-trp Intron Endonuclease from ''Halobacterium volcanii''"<br>
 +
(I was unable to upload the .pdf for this paper, you can download it at this site)

Latest revision as of 00:37, 14 October 2008

tRNA-trp-CCA:

DNA Coordinates: 465601..465777 (-)

GGGGTCGTGGCCAAGTCCGGCATGGCGACTGACTCCAGAGGCACCGCGCCCGGGACGACACTCCAG
ACTGATATACTGAGCGACCGGCTGATCACCGGACGCCTTGATGACCCTCTGGAGTTCCGAGGCGCA
ACCGGAGATATCAGTCGATCGGGAGTTCAAATCTCTCCGACCCCA

5' exon: 38 bp, position 1-38
intron: 102 bp, position 39-140
3' exon: 36 bp, position 141-176

Evidence:

Similarity with Haloferax volcanii tRNA-trp
Score = 190 bits (96), Expect = 2e-49
Identities = 155/172 (90%), Gaps = 2/172 (1%)

Similarity with Halobacterium salinarum R1 tRNA-trp
Score = 174 bits (88), Expect = 1e-44
Identities = 154/172 (89%), Gaps = 3/172 (1%)

Similarity with Haloarcula marismortui tRNA-trp
Score = 163 bits (82), Expect = 4e-41
Identities = 159/181 (87%), Gaps = 4/181 (2%)

Similarity with Natronomonas pharaonis tRNA-trp
Score = 163 bits (82), Expect = 4e-41
Identities = 159/181 (87%), Gaps = 4/181 (2%)

[1]: "A tRNA-trp Intron Endonuclease from Halobacterium volcanii"
(I was unable to upload the .pdf for this paper, you can download it at this site)