Difference between revisions of "Davidson - Riboswitches"

From GcatWiki
Jump to: navigation, search
(→‎New Ammeline Riboswitches)
(→‎Corrected mutations (Jon))
 
(3 intermediate revisions by 2 users not shown)
Line 123: Line 123:
 
| style ="text-align:center;" |Sequence verified
 
| style ="text-align:center;" |Sequence verified
 
| style ="text-align:center;" |Not registered due to promoter mutation
 
| style ="text-align:center;" |Not registered due to promoter mutation
−
| style ="text-align:center;" |2: T20C, C852T (also has M6 mutation-A431G)
+
| style ="text-align:center;" |2: T20C, C852T (also has M6 mutation-A432G)
 
|-
 
|-
 
| style ="text-align:center;" |M6-R2
 
| style ="text-align:center;" |M6-R2
Line 166: Line 166:
 
|-
 
|-
 
| style ="text-align:center;" |M6-R10
 
| style ="text-align:center;" |M6-R10
−
| style ="text-align:center;" |Sequence verified-registered
+
| style ="text-align:center;" |Sequence verified
−
| style ="text-align:center;" |  
+
| style ="text-align:center;" |[//parts.igem.org/Part:BBa_J100163 J100163]
−
| style ="text-align:center;" |  
+
| style ="text-align:center;" |M6 Mutation: A431G
 
|-
 
|-
 
| style ="text-align:center;" |M6"-R1
 
| style ="text-align:center;" |M6"-R1
 
| style ="text-align:center;" |Miniprepped
 
| style ="text-align:center;" |Miniprepped
−
| style ="text-align:center;" |  
+
| style ="text-align:center;" |
−
| style ="text-align:center;" |  
+
| style ="text-align:center;" |
 
|-
 
|-
 
| style ="text-align:center;" |M6"-R2
 
| style ="text-align:center;" |M6"-R2
 
| style ="text-align:center;" |Sequence verified  
 
| style ="text-align:center;" |Sequence verified  
−
| style ="text-align:center;" |  
+
| style ="text-align:center;" |[http://parts.igem.org/Part:BBa_J100170 J100170]
−
| style ="text-align:center;" |  
+
| style ="text-align:center;" |A433G (RFP)
 
|-
 
|-
 
| style ="text-align:center;" |M6"-R3
 
| style ="text-align:center;" |M6"-R3
 
| style ="text-align:center;" |Sequence verified  
 
| style ="text-align:center;" |Sequence verified  
−
| style ="text-align:center;" |  
+
| style ="text-align:center;" |[http://parts.igem.org/Part:BBa_J100171 J100171]
−
| style ="text-align:center;" |  
+
| style ="text-align:center;" |A432G (RFP)
 
|-
 
|-
 
| style ="text-align:center;" |M6"-R4
 
| style ="text-align:center;" |M6"-R4
 
| style ="text-align:center;" |Sequence verified
 
| style ="text-align:center;" |Sequence verified
−
| style ="text-align:center;" |  
+
| style ="text-align:center;" |[http://parts.igem.org/Part:BBa_J100172 J100172]
−
| style ="text-align:center;" |  
+
| style ="text-align:center;" |A432G (RFP)
 
|-
 
|-
 
| style ="text-align:center;" |M6"-R5
 
| style ="text-align:center;" |M6"-R5
Line 221: Line 221:
 
|}
 
|}
  
−
Process:  
+
'''Process:'''
 +
 
 +
PCR (Cloning) > Clean and Concentrate DNA/Gel Purify DNA > GGA > Transformation > cPCR > Miniprep > Sequence Verify
 +
 
 +
 
 +
'''NOTE:''' "M6 Mutation" refers to the mutation in the original M6 riboswitch (A430G) and this mutation will appear in
  
−
PCR (Cloning) > Clean and Concentrate DNA/Gel Purify DNA > GGA > Transformation > cPCR > Miniprep > Sequence Verify > Register
+
different locations in the new riboswitches depending on the lengths of the riboswitches.

Latest revision as of 18:14, 18 July 2014

Research

There are 6 different ammeline riboswitches that have been created by Neil Dixon, John N. Duncan, Torsten Geerlings, Mark S. Dunstan, John E. G. McCarthy, David Leys, and Jason Micklefield. Their research is described in the article Reengineering orthogonally selective riboswitches. The article shows that the two best riboswitches seem to be M6 and M6C, however neither of these riboswitches appear to be truly "off". When there is no ammeline present there is still a production of GFP. This presents a problem because when using a fitness module like antibiotic resistance those cells that are not producing ammeline will still be able to live, not allowing for the evolution that we desire. Another problem comes from the fact that the induction factor (the expression when ammeline is present/the expression when ammeline is absent) is not extremely high. Supplemental Information For Article

Figures From Report

Secondary structure model of the parental add A-riboswitch in the ON-state

Data From Testing Different Riboswitches


There are two options that we can do to fix these riboswitch systems

1) Create a better riboswitch that is "off" when ammeline is absent, but still allows for an "on" system when ammeline is present

2) Change the fitness module from antibiotic resistance to a thyA module


Known Riboswitches

Riboswitch AddA

TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGTTTCTACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG

Riboswitch M6

TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG

Riboswitch M6C

TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG

Riboswitch M6’

TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG

Riboswitch M6’’

TCAACGCTTCATATAATCCGAATGATATGGTTTCGGAGCTTCCACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG

Riboswitch M6C’

TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG

Riboswitch M6C"

TCAACGCTTCATATAATCCGAATGATATGGTTTCGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG

Riboswitch M6C (A172G Mutation)

TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAGAGAGAAGACTATGAAG

Riboswitch M6C (T92C Mutation)

TCAACGCTTCATATAATCCCAATGATATGGTTTGGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATGAAG

Riboswitch M6C’ (T167C Mutation)

TCAACGCTTCATATAATCCTAATGATATGGTTTAGGAGCTTCCACCAAGAGCCTTAAACTCTTGACTATGAAGTCTGTCGCTTTATCCGAAATTCTATAAAGAGAAGACTATGAAG


Experimentation

Materials

  • 10 riboswitch clones
  • LB (amp?) plate for spotting
  • LB (amp?) broth - 1 Liter: LB w/ DMSO (control), LB w/ DMSO and ammeline (experiment), LB (growing cells)
  • Sterile, Filtered DMSO
  • 20 test tubes (10 for freezing, 10 for miniprep and spotting)
  • 20 test tubes (10 control w/o ammeline, 10 experiment w/ ammeline)

Outline of Methods

Wednesday 5/28/14:

1) Get riboswitch clones in mail from MWSU

2) Grow 2 (2mL) test tubes of each clone overnight

3) Prepare 5 mL of 5 mM ammeline stock

  • Much more difficult than originally thought..will work on this using dilute NaOH, heating DMSO, or possibly using dilute DEA

Thursday 5/29/14:

1) Freeze down cells, put in GCAT-alog

2) Perform miniprep

3) Spot 10 clones on plate, leave to grow until Sunday night

Sunday 6/1/14:

1) Come in and grow cells for experimentation tomorrow

  • 2 test tubes for each clone, 1 w/DMSO (control), 1 w/ ammeline dissolved in DMSO (experimental)

Monday 6/2/14:

1) Measure Fluorescence using Synergy Machine

  • Find control and experimental
  • Find induction factor (experimental/control)


*The collaborating MSWU research and experimentation can be found on MWSU Different Riboswitches

New Ammeline Riboswitches

20 New Davidson Ammeline Riboswitch Sequences File:New Ammeline Riboswitches.docx

New Ammeline Riboswitches
Riboswitch Status Part Number Mutations?
M6-R1 Sequence verified Not registered due to promoter mutation 2: T20C, C852T (also has M6 mutation-A432G)
M6-R2 PCR (Cloning)
M6-R3 cPCR
M6-R4 cPCR
M6-R5 cPCR
M6-R6
M6-R7
M6-R8
M6-R9
M6-R10 Sequence verified J100163 M6 Mutation: A431G
M6"-R1 Miniprepped
M6"-R2 Sequence verified J100170 A433G (RFP)
M6"-R3 Sequence verified J100171 A432G (RFP)
M6"-R4 Sequence verified J100172 A432G (RFP)
M6"-R5 Miniprepped
M6"-R6 Transformation
M6"-R7 Sequence verified-one mutation
M6"-R8 PCR (Cloning)
M6"-R9 PCR (Cloning)
M6"-R10 Sequence verified-registered

Process:

PCR (Cloning) > Clean and Concentrate DNA/Gel Purify DNA > GGA > Transformation > cPCR > Miniprep > Sequence Verify


NOTE: "M6 Mutation" refers to the mutation in the original M6 riboswitch (A430G) and this mutation will appear in

different locations in the new riboswitches depending on the lengths of the riboswitches.