Difference between revisions of "Oligo design for XOR Hybrid Promoters"
(→Mnt/TetR hybrid promoter) |
|||
| (47 intermediate revisions by 4 users not shown) | |||
| Line 1: | Line 1: | ||
| − | ''' | + | ==Lux-cI hybrid promoter== |
| + | '''Responsible:Xiao Zhu''' | ||
| − | + | '''Rationale''' | |
| − | + | ||
| + | This hybrid promoter is designed to respond to activation by LuxR when it is bound to AHL and to repression by the phage lambda cI repressor. The repression needs to win over activation. According to Ron Weiss, “the effect of cI is dominant over LuxR”(Ron Weiss, part description for R0065). | ||
| + | |||
| + | '''References and links''' | ||
| + | |||
| + | [http://www.pnas.org/cgi/content/full/101/17/6355 Spatiotemporal control of gene expression with pulse-generating networks] | ||
| + | |||
| + | [http://www.pnas.org/cgi/content/full/0307571101/DC1 Its supporting information] | ||
[http://partsregistry.org/Part:BBa_R0062 Lux/HSL] | [http://partsregistry.org/Part:BBa_R0062 Lux/HSL] | ||
| Line 8: | Line 16: | ||
[http://partsregistry.org/Part:BBa_R0051 cI] | [http://partsregistry.org/Part:BBa_R0051 cI] | ||
| − | + | '''Design Considerations''' | |
| − | + | We have come up with three possible designs for this promoter. Designs A and B are based on the idea of replacing the region of the Lux promoter downstream of the -35 either the OR1 or the OR2 cI half-operator. A) cI OR1, containing the lambda pR -10 region. B) cI OR2, added LuxR-10 region. Based on what we have found up to now, promoters which are constructed just by inserting OR1/2 downstream of Lux are all very leaky. | |
| − | + | We hope that doing in this way could lead a stronger regulation for cI OR1/2. There’s a journal talking about a research that used Lux-cI hybrid promoter in their system. What they did is to insert cI OR1 upstream of Lux +1(they had a mutant for OR1 sequence), and it’s leaky (“In this case, even without AHL, leaky CI expression completely represses luxPRcI-OR1”). | |
Design C, to use OR2 twice, is because “it requires the binding of two cI repressor dimers for maximal repression”, but as BBa_R0065 has shown, if we put both OR2 and OR1 downstream of Lux, the promoter won’t work very well, it’s very leaky at high copy number. And we found that ETHZ iGEM’07 team were building these hybrid promoters as well. They used OR2 twice. We don’t know whether OR2 has any advantages over OR1 for functioning. | Design C, to use OR2 twice, is because “it requires the binding of two cI repressor dimers for maximal repression”, but as BBa_R0065 has shown, if we put both OR2 and OR1 downstream of Lux, the promoter won’t work very well, it’s very leaky at high copy number. And we found that ETHZ iGEM’07 team were building these hybrid promoters as well. They used OR2 twice. We don’t know whether OR2 has any advantages over OR1 for functioning. | ||
| − | '''A | + | '''Design A - LuxR/HSL + OR1''' |
| − | ''' | + | '''Desired sequence A (101bp)''' |
| − | 5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TACCTCTGGCGGTGATAA T GGTTGC TACTAGTAGC GGCCGCTGCA | + | 5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TACCTCTGGCGGTGATAA T GGTTGC TACTAGTAGC GGCCGCTGCA GATGC 3’ |
| − | ''' | + | '''Annotation of desired sequence A''' |
| − | + | Oligos have 15bp overlap for direct synthesis | |
| − | + | BBa_Prefix: GCAT GAATTCGCGGCCGCTTCTAGAG | |
| − | + | LuxR/HSL Box (only includes region upstream of -35 and the first T of -35): ACCTGTAGGA TCGTACAGG T | |
| − | + | LuxR -35: TTTACG | |
| − | + | cI Half-Operator OR1: TACCTCTGGCGGTGATAA | |
| − | + | Lambda pR -10: GATAAT | |
| − | ' | + | Spacer: (naturally occurring just 3' to -10 in cI promoter): GGTTGC |
| − | + | Suffix: TACTAGTAGCGGCCGCTGCAG ATGC | |
| − | ''' | + | '''Forward primer (58bp)''' |
| − | + | 5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TACCTCT3’ | |
| + | '''Reverse Primer (58bp)''' | ||
| − | + | 5’ GCAT CTGCAG CGGCCGCTAC TAGTAGCAAC CATTATCACC GCCAGAGGTA CGTAAACC 3’ | |
| − | ''' | + | '''Design B - LuxR/HSL + OR2''' '''CHOSEN DESIGN''' |
| − | + | '''Desired sequence B (108bp)''' | |
| − | + | 5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TAACACCGTG CGTGTTGA TATAGT CGAATAAA TACTAGTAGCGGCCGCTGCAGATGC 3’ | |
| − | + | '''Annotated desired sequence B''' | |
| − | + | BBa_Prefix: GCAT GAATTCGCGGCCGCTTCTAGAG | |
| − | + | LuxR/HSL Box (only includes region upstream of -35 and the first T of -35): ACCTGTAGGA TCGTACAGG T | |
| − | + | LuxR -35: TTTACG | |
| − | + | Lambda Half-Operator OR2: TAACACCGTG CGTGTTGA | |
| − | + | LuxR -10: TATAGT (we used the -10 region from LuxR in order to reduce the risk that LuxR -35 region won’t work well with -10 region from other sources.) | |
| − | + | Spacer (naturally occurs after LuxR -10): CGAATAAA | |
| − | + | Suffix: TACTAGTAGCGGCCGCTGCAG ATGC | |
| − | ''' | + | '''Forward Primer pLuxR/CI forward (63bp)''' |
| − | + | 5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TAACACCGTGCG 3’ | |
| + | '''Reverse Primer pLuxR/CI reverse(61bp)''' | ||
| − | + | 5’ GCAT CTGCAG CGGCCGCTAC TAGTATTTAT TCGACTATAT CAACACGCAC GGTGTTACGTA 3’ | |
| − | |||
| − | + | '''Design C - LuxR/HSL + 2xOR2''' | |
| − | ''' | + | '''Desired sequence C (141bp)''' |
| − | 5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT | + | 5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA TACTAGTAGCGGCCGCTGCAGATGC 3’ |
| − | ''' | + | '''Annotated desired sequence C''' |
| − | + | BBa_Prefix: GCAT GAATTCGCGGCCGCTTCTAGAG | |
| − | + | Lux/HSL (the whole sequence, including -35 and -10): ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C | |
| − | + | Lux -35: TTTACG | |
| − | + | Lux -10: TATAGT | |
| − | + | 2xOR2 with 6 bp that naturally exist in Lambda promoter between OR2 and OR1 (we inserted the 6 bp spacer backwards so as to break the cI -35 region): TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA | |
| − | + | Suffix: TACTAGTAGCGGCCGCTGCAG ATGC | |
| − | ''' | + | '''Forward Primer (78bp)''' |
| + | 5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C TAAC 3’ | ||
| − | + | '''Reverse Primer (78bp)''' | |
| − | + | 5’ GCAT CTGCAGCGGCCGCTACTAGTA TCAACACGCA CGGTGTTAGA TAAATCAACA CGCACGGTGT TAGACTATA ACAA 3’ | |
| − | + | ==Mnt/LacI hybrid promoter== | |
| − | |||
| + | '''Responsible:Robert Cool''' | ||
| + | '''Rationale''' | ||
| + | This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG. | ||
| − | ''' | + | '''References and Links''' |
| − | + | [http://partsregistry.org/wiki/index.php?title=Part:BBa_R0073 R0073][http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 R0010] | |
| + | '''Design considerations''' | ||
| + | Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of a LacI binding site between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by LacI. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tgtgtggaattgtga, and 2) Position lacI binding site (composed of an inverted repeat) from the lacI regulated promoter (R0010) immediately 3’ to truncated mnt promoter. | ||
| − | ''' | + | '''Entire desired sequence (138 bp)''' |
| + | Gcat Gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tgtgtggaattgtgagcggataacaatttcacaca tactagtagcggccgctgcag atgc | ||
| − | ''' | + | '''Annotated desired sequence''' |
| + | Biobrick prefix: GCAT gaattcgcggccgcttctagag | ||
| − | + | Mnt promoter (everything before and including -10): ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt | |
| + | LacI binding site (last 35bp, everything after -10): tgtgtggaattgtgagcggataacaatttcacacagagtcgtattaattt | ||
| + | Biobrick suffix: tactagtagcggccgctgcag ATCG | ||
| − | |||
| − | + | '''Forward Primer pMnt/Lac forward(75bp)''' | |
| + | gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctat | ||
| + | '''Reverse Primer pMnt/Lac reverse(75 bp)''' | ||
| − | + | gcatctgcagcggccgctactagtatgtgtgaaattgttatccgctcacaattccacacaactataggagatcta | |
| + | ==Mnt/TetR hybrid promoter== | ||
| − | ''' | + | '''Responsible:Robert Cool''' |
| + | '''Background''' | ||
| − | + | This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc. | |
| + | '''References and links''' | ||
| + | [http://partsregistry.org/wiki/index.php?title=Part:BBa_R0073 R0073] [http://partsregistry.org/Part:BBa_R0040 R0040] | ||
| + | '''Design considerations''' | ||
| + | Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta), but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3’ to truncated mnt -10 sequence. | ||
| + | '''Entire desired sequence (149 bp)''' | ||
| + | Gcat gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tccctatcagtgatagaga actgta atccctatcagtgatagagat tactagtagcggccgctgcag atgc | ||
| + | '''Annotated desired sequence''' | ||
| − | + | Biobrick prefix: GCAT gaattcgcggccgcttctagag | |
| − | + | Mnt promoter (everything before and including -10): ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt | |
| − | + | TetR binding site, tetR1: tccctatcagtgatagaga | |
| − | |||
| + | Spacer: actgta | ||
| + | TetR binding site, tetR2: atccctatcagtgatagagat | ||
| − | + | Biobrick suffix: tactagtagcggccgctgcag TAGC | |
| + | '''Forward primer pMnt/Tet forward(81 bp)''' | ||
| − | + | Gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagttcc | |
| − | ''' | + | '''Reverse primer pMnt/Tet reverse(81 bp)''' |
| + | gcatctgcagcggccgctactagtaatctctatcactgatagggattacagttctctatcactgatagggaactataggag | ||
| − | + | ==LsrA/cI hybrid promoter== | |
| − | + | '''Responsible: Andrew Gordon''' | |
| − | ''' | ||
| + | '''Rationale''' | ||
| − | + | This hybrid promoter uses the LsrA promoter that is capable of being repressed by LsrR - induction can occur with phospho-AI-2. Binding sites for cI repressor also occur. As a result the promoter is off in the absence of AI-2 and on in the presence of AI-2, but always off in the presence of cI. | |
| + | '''References and links''' | ||
| − | + | [http://jb.asm.org/cgi/content/full/187/6/2066?view=long&pmid=15743955#F7 Wang et al] | |
| + | [http://fruitfly.org:9005/seq_tools/promoter.html Promoter predictor] | ||
| + | '''Design considerations''' | ||
| − | ''' | + | The promoter region for LsrA should remain unaltered while cI binding sites (OR2) are introduced downstream. The OR2 sites with cI bound should not allow transcription. The cI binding sites have a natural 6 bp spacer between them. It would be desirable to position the cI binding sites immediately downstream of the -10 region of the LsrA promoter. However, experimental evidence for the txn start (+1) appears to be lacking. |
| + | |||
| + | '''Design A - OR1 cI Cassette''' | ||
| − | + | This will involve direct synthesis from two oligos of a biobricked part that contains two copies of the cI binding sites. These can then be assembled behind the existing pLsrA promoter. | |
| − | ''' | + | '''Entire desired sequence''' |
| − | + | TAACACCGTGCGTGTTGATTTATCTAACACCGTGCGTGTTGA | |
| + | Prefix: gcat gaattcgcggccgcttctagag | ||
| − | ' | + | 5' half of part: TAACACCGTGCGTGTTGATTTATCTAAC |
| − | + | '''Forward oligo, pLsr/cI forward''' | |
| − | + | gcat gaattcgcggccgcttctagag TAACACCGTGCGTGTTGATTTATCTAAC | |
| − | + | 3' half of part: TTGATTTATCTAACACCGTGCGTGTTGA | |
| − | + | Reverse complement of 3' half of part: TAACACCGTGCGTGTTGATTTATCTAAC | |
| − | + | Suffix: gcat ctgcagcggccgctactagta | |
| − | + | '''Reverse oligo pLsrA/cI reverse''' | |
| − | + | gcat ctgcagcggccgctactagta TCAACACGCTCGGTGTTAGATAAATCAA | |
| − | + | Oligos have a 15 bp overlap for direct synthesis | |
| − | + | '''Design B - de novo pLsrA/cI promoter''' '''CHOSEN DESIGN''' | |
| − | + | According to [http://jb.asm.org/cgi/content/full/187/6/2066?view=long&pmid=15743955#F7 Wang et al], the start site for transcription predicted by the BDGP software (we could not replicate this!) is as indicated below in bold on the sequence of the pLsrA promoter that we built: | |
| − | + | AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAA'''TACAT T'''TGTTCA'''A'''AA CTCACCTGCA AAACTGAA | |
| − | + | So, a possible design for a hybrid LsrR/CI promoter would be to place two binding sites for cI immediately downstream of the -10 sequence of the LsrA promoter. | |
| − | + | Truncated LsrA promoter: AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAATACAT T | |
| − | + | cI binding site, OR1 and OR2 with 6 bp that naturally exists in Lambda promoter between OR2 and OR1, a 6 bp spacer has been inserted between the two OR sites so as to mutate the cI -35 region: TAACACCGTGCGTGTTGAagATTTTACCTCTGGCGGTGATAA | |
| − | + | Synthesis could be accomplished with the already purchased primer "pLsrA forward" and a new primer that binds to the last portion of the truncated LsrA promoter. | |
| − | + | '''Entire Desired Sequence''' AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAATACAT T TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA | |
| − | + | '''New primer needed - "pLsrA/cI reverse" {82 bp}''' | |
| − | + | GCAT CTGCAGCGGCCGCTACTAGTA TTATCACCGCCAGAGGTAAAATctTCAACACGCACGGTGTTA AATGTATTTCTGCTT | |
| − | + | Suffix with spacer (reverse complement): GCAT CTGCAGCGGCCGCTACTAGTA | |
| − | + | OR1 and OR2 sites with -35 mutations in the last 2 bases:TAACACCGTGCGTGTTGAagATTTTACCTCTGGCGGTGATAA | |
| − | + | OR1 and OR2 sites with -35 mutations in the last 2 bases(reverse complement): TTATCACCGCCAGAGGTAAAATctTCAACACGCACGGTGTTA | |
| − | + | 15 nt from 3' end of truncated LsrA promoter (reverse complement): A ATGTATTTCT GCTT | |
Latest revision as of 16:51, 18 June 2008
Contents
Lux-cI hybrid promoter
Responsible:Xiao Zhu
Rationale
This hybrid promoter is designed to respond to activation by LuxR when it is bound to AHL and to repression by the phage lambda cI repressor. The repression needs to win over activation. According to Ron Weiss, “the effect of cI is dominant over LuxR”(Ron Weiss, part description for R0065).
References and links
Spatiotemporal control of gene expression with pulse-generating networks
Design Considerations
We have come up with three possible designs for this promoter. Designs A and B are based on the idea of replacing the region of the Lux promoter downstream of the -35 either the OR1 or the OR2 cI half-operator. A) cI OR1, containing the lambda pR -10 region. B) cI OR2, added LuxR-10 region. Based on what we have found up to now, promoters which are constructed just by inserting OR1/2 downstream of Lux are all very leaky.
We hope that doing in this way could lead a stronger regulation for cI OR1/2. There’s a journal talking about a research that used Lux-cI hybrid promoter in their system. What they did is to insert cI OR1 upstream of Lux +1(they had a mutant for OR1 sequence), and it’s leaky (“In this case, even without AHL, leaky CI expression completely represses luxPRcI-OR1”).
Design C, to use OR2 twice, is because “it requires the binding of two cI repressor dimers for maximal repression”, but as BBa_R0065 has shown, if we put both OR2 and OR1 downstream of Lux, the promoter won’t work very well, it’s very leaky at high copy number. And we found that ETHZ iGEM’07 team were building these hybrid promoters as well. They used OR2 twice. We don’t know whether OR2 has any advantages over OR1 for functioning.
Design A - LuxR/HSL + OR1
Desired sequence A (101bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TACCTCTGGCGGTGATAA T GGTTGC TACTAGTAGC GGCCGCTGCA GATGC 3’
Annotation of desired sequence A
Oligos have 15bp overlap for direct synthesis
BBa_Prefix: GCAT GAATTCGCGGCCGCTTCTAGAG
LuxR/HSL Box (only includes region upstream of -35 and the first T of -35): ACCTGTAGGA TCGTACAGG T
LuxR -35: TTTACG
cI Half-Operator OR1: TACCTCTGGCGGTGATAA
Lambda pR -10: GATAAT
Spacer: (naturally occurring just 3' to -10 in cI promoter): GGTTGC
Suffix: TACTAGTAGCGGCCGCTGCAG ATGC
Forward primer (58bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TACCTCT3’
Reverse Primer (58bp)
5’ GCAT CTGCAG CGGCCGCTAC TAGTAGCAAC CATTATCACC GCCAGAGGTA CGTAAACC 3’
Design B - LuxR/HSL + OR2 CHOSEN DESIGN
Desired sequence B (108bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TAACACCGTG CGTGTTGA TATAGT CGAATAAA TACTAGTAGCGGCCGCTGCAGATGC 3’
Annotated desired sequence B
BBa_Prefix: GCAT GAATTCGCGGCCGCTTCTAGAG
LuxR/HSL Box (only includes region upstream of -35 and the first T of -35): ACCTGTAGGA TCGTACAGG T
LuxR -35: TTTACG
Lambda Half-Operator OR2: TAACACCGTG CGTGTTGA
LuxR -10: TATAGT (we used the -10 region from LuxR in order to reduce the risk that LuxR -35 region won’t work well with -10 region from other sources.)
Spacer (naturally occurs after LuxR -10): CGAATAAA
Suffix: TACTAGTAGCGGCCGCTGCAG ATGC
Forward Primer pLuxR/CI forward (63bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TAACACCGTGCG 3’
Reverse Primer pLuxR/CI reverse(61bp)
5’ GCAT CTGCAG CGGCCGCTAC TAGTATTTAT TCGACTATAT CAACACGCAC GGTGTTACGTA 3’
Design C - LuxR/HSL + 2xOR2
Desired sequence C (141bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA TACTAGTAGCGGCCGCTGCAGATGC 3’
Annotated desired sequence C
BBa_Prefix: GCAT GAATTCGCGGCCGCTTCTAGAG
Lux/HSL (the whole sequence, including -35 and -10): ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C
Lux -35: TTTACG
Lux -10: TATAGT
2xOR2 with 6 bp that naturally exist in Lambda promoter between OR2 and OR1 (we inserted the 6 bp spacer backwards so as to break the cI -35 region): TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA
Suffix: TACTAGTAGCGGCCGCTGCAG ATGC
Forward Primer (78bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT C TAAC 3’
Reverse Primer (78bp)
5’ GCAT CTGCAGCGGCCGCTACTAGTA TCAACACGCA CGGTGTTAGA TAAATCAACA CGCACGGTGT TAGACTATA ACAA 3’
Mnt/LacI hybrid promoter
Responsible:Robert Cool
Rationale
This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG.
References and Links
Design considerations Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of a LacI binding site between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by LacI. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tgtgtggaattgtga, and 2) Position lacI binding site (composed of an inverted repeat) from the lacI regulated promoter (R0010) immediately 3’ to truncated mnt promoter.
Entire desired sequence (138 bp)
Gcat Gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tgtgtggaattgtgagcggataacaatttcacaca tactagtagcggccgctgcag atgc
Annotated desired sequence
Biobrick prefix: GCAT gaattcgcggccgcttctagag
Mnt promoter (everything before and including -10): ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt
LacI binding site (last 35bp, everything after -10): tgtgtggaattgtgagcggataacaatttcacacagagtcgtattaattt
Biobrick suffix: tactagtagcggccgctgcag ATCG
Forward Primer pMnt/Lac forward(75bp)
gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctat
Reverse Primer pMnt/Lac reverse(75 bp)
gcatctgcagcggccgctactagtatgtgtgaaattgttatccgctcacaattccacacaactataggagatcta
Mnt/TetR hybrid promoter
Responsible:Robert Cool
Background
This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc.
References and links
Design considerations Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta), but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3’ to truncated mnt -10 sequence.
Entire desired sequence (149 bp)
Gcat gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tccctatcagtgatagaga actgta atccctatcagtgatagagat tactagtagcggccgctgcag atgc
Annotated desired sequence
Biobrick prefix: GCAT gaattcgcggccgcttctagag
Mnt promoter (everything before and including -10): ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt
TetR binding site, tetR1: tccctatcagtgatagaga
Spacer: actgta
TetR binding site, tetR2: atccctatcagtgatagagat
Biobrick suffix: tactagtagcggccgctgcag TAGC
Forward primer pMnt/Tet forward(81 bp)
Gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagttcc
Reverse primer pMnt/Tet reverse(81 bp)
gcatctgcagcggccgctactagtaatctctatcactgatagggattacagttctctatcactgatagggaactataggag
LsrA/cI hybrid promoter
Responsible: Andrew Gordon
Rationale
This hybrid promoter uses the LsrA promoter that is capable of being repressed by LsrR - induction can occur with phospho-AI-2. Binding sites for cI repressor also occur. As a result the promoter is off in the absence of AI-2 and on in the presence of AI-2, but always off in the presence of cI.
References and links
Design considerations
The promoter region for LsrA should remain unaltered while cI binding sites (OR2) are introduced downstream. The OR2 sites with cI bound should not allow transcription. The cI binding sites have a natural 6 bp spacer between them. It would be desirable to position the cI binding sites immediately downstream of the -10 region of the LsrA promoter. However, experimental evidence for the txn start (+1) appears to be lacking.
Design A - OR1 cI Cassette
This will involve direct synthesis from two oligos of a biobricked part that contains two copies of the cI binding sites. These can then be assembled behind the existing pLsrA promoter.
Entire desired sequence
TAACACCGTGCGTGTTGATTTATCTAACACCGTGCGTGTTGA
Prefix: gcat gaattcgcggccgcttctagag
5' half of part: TAACACCGTGCGTGTTGATTTATCTAAC
Forward oligo, pLsr/cI forward
gcat gaattcgcggccgcttctagag TAACACCGTGCGTGTTGATTTATCTAAC
3' half of part: TTGATTTATCTAACACCGTGCGTGTTGA
Reverse complement of 3' half of part: TAACACCGTGCGTGTTGATTTATCTAAC
Suffix: gcat ctgcagcggccgctactagta
Reverse oligo pLsrA/cI reverse
gcat ctgcagcggccgctactagta TCAACACGCTCGGTGTTAGATAAATCAA
Oligos have a 15 bp overlap for direct synthesis
Design B - de novo pLsrA/cI promoter CHOSEN DESIGN
According to Wang et al, the start site for transcription predicted by the BDGP software (we could not replicate this!) is as indicated below in bold on the sequence of the pLsrA promoter that we built:
AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAATACAT TTGTTCAAAA CTCACCTGCA AAACTGAA
So, a possible design for a hybrid LsrR/CI promoter would be to place two binding sites for cI immediately downstream of the -10 sequence of the LsrA promoter.
Truncated LsrA promoter: AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAATACAT T
cI binding site, OR1 and OR2 with 6 bp that naturally exists in Lambda promoter between OR2 and OR1, a 6 bp spacer has been inserted between the two OR sites so as to mutate the cI -35 region: TAACACCGTGCGTGTTGAagATTTTACCTCTGGCGGTGATAA
Synthesis could be accomplished with the already purchased primer "pLsrA forward" and a new primer that binds to the last portion of the truncated LsrA promoter.
Entire Desired Sequence AACCGTGA AAATCAAAAT AGCATAAAT TGTGATCTATT CGTCGGAAAT ATGTGCAATG TCCACCTAAG GTTATGAACA AATTAAAAGC AGAAATACAT T TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA
New primer needed - "pLsrA/cI reverse" {82 bp}
GCAT CTGCAGCGGCCGCTACTAGTA TTATCACCGCCAGAGGTAAAATctTCAACACGCACGGTGTTA AATGTATTTCTGCTT
Suffix with spacer (reverse complement): GCAT CTGCAGCGGCCGCTACTAGTA
OR1 and OR2 sites with -35 mutations in the last 2 bases:TAACACCGTGCGTGTTGAagATTTTACCTCTGGCGGTGATAA
OR1 and OR2 sites with -35 mutations in the last 2 bases(reverse complement): TTATCACCGCCAGAGGTAAAATctTCAACACGCACGGTGTTA
15 nt from 3' end of truncated LsrA promoter (reverse complement): A ATGTATTTCT GCTT