Difference between revisions of "Davidson Projects with Updates"
MaCampbell (talk | contribs) (→Building LasI sender '''TESTER''' cell) |
(→Building LasI sender '''TESTER''' cell) |
||
(58 intermediate revisions by 4 users not shown) | |||
Line 1: | Line 1: | ||
== Building LuxI sender '''TESTER''' cell == | == Building LuxI sender '''TESTER''' cell == | ||
− | + | <BR> | |
{| border="1" cellpadding="2" | {| border="1" cellpadding="2" | ||
!width"50"|Part # | !width"50"|Part # | ||
Line 8: | Line 8: | ||
!width="100"|Experimental Outcome | !width="100"|Experimental Outcome | ||
|- | |- | ||
− | |[http://partsregistry.org/Part:BBa_S03608 S03608]|| Yes || Yes || Ready || | + | |[http://partsregistry.org/Part:BBa_S03608 S03608]|| Yes || Yes || Ready || Successful |
|- | |- | ||
|}<br> | |}<br> | ||
Line 15: | Line 15: | ||
== Building LuxR receiver '''TESTER''' cell == | == Building LuxR receiver '''TESTER''' cell == | ||
− | + | <br> | |
− | |||
{| border="1" cellpadding="2" | {| border="1" cellpadding="2" | ||
!width"50"| | !width"50"| | ||
Line 24: | Line 23: | ||
!width="100"|Experimental Outcome | !width="100"|Experimental Outcome | ||
|- | |- | ||
− | |[http://partsregistry.org/Part:BBa_K09100 K09100]|| Yes || Yes || Ready || | + | |[http://partsregistry.org/Part:BBa_K09100 K09100]|| Yes || Yes || Ready || Successful |
|- | |- | ||
|}<br> | |}<br> | ||
Line 30: | Line 29: | ||
<br> | <br> | ||
− | == | + | == '''TESTING''' Lux Sender & Receiver Cells == |
− | + | <BR> | |
− | + | [[Image:setup1.jpg]] | |
− | + | <br><br><br><br> | |
+ | [[Image:official.jpg]] | ||
+ | <br><br> | ||
− | + | == Building LuxR constitutive protein == | |
+ | [http://partsregistry.org/Part:BBa_J23100 J23100] + [http://partsregistry.org/wiki/index.php?title=Part:BBa_J37033 J37033] | ||
{| border="1" cellpadding="2" | {| border="1" cellpadding="2" | ||
Line 44: | Line 46: | ||
!width="100"|Experimental Outcome | !width="100"|Experimental Outcome | ||
|- | |- | ||
− | | | + | |[http://partsregistry.org/Part:BBa_J23100 J23100]|| Yes || ? || ? || ? |
− | |||
− | |||
− | |||
− | |||
|- | |- | ||
+ | |[http://partsregistry.org/wiki/index.php?title=Part:BBa_J37033 J37033]|| Yes || ? || ? || ? | ||
|}<br> | |}<br> | ||
− | + | [[Image:promoter.jpg]] + [[Image:coding.jpg]] | |
− | |||
− | |||
== Building LasI sender '''TESTER''' cell == | == Building LasI sender '''TESTER''' cell == | ||
− | [http://partsregistry.org/Part:BBa_R0011 R0011]+ [http://partsregistry.org/Part: | + | [http://partsregistry.org/Part:BBa_R0011 R0011] + [http://partsregistry.org/Part:BBa_B0034 B0034] + [http://partsregistry.org/Part:BBa_C0078 C0178].<br> |
− | [[Image: | + | [[Image:InsertHere.jpg]] |
{| border="1" cellpadding="2" | {| border="1" cellpadding="2" | ||
!width="50"| | !width="50"| | ||
Line 67: | Line 64: | ||
|[http://partsregistry.org/Part:BBa_R0011 R0011]|| Yes || Yes || || | |[http://partsregistry.org/Part:BBa_R0011 R0011]|| Yes || Yes || || | ||
|- | |- | ||
− | |[http://partsregistry.org/Part: | + | |[http://partsregistry.org/Part:BBa_B0034 B0034]|| Yes|| Yes || || |
+ | |- | ||
+ | |[http://partsregistry.org/Part:BBa_C0178 C0178]|| Yes|| Yes || || | ||
|} | |} | ||
<br> | <br> | ||
− | + | [[Image:las.jpg]] | |
<br> | <br> | ||
Line 85: | Line 84: | ||
|B0015|| Yes|| Yes|| Yes || | |B0015|| Yes|| Yes|| Yes || | ||
|- | |- | ||
− | |R0079|| Yes|| Yes || Yes || | + | |R0079|| Yes || Yes || Yes || |
+ | |- | ||
+ | |E0240|| Yes || Yes || Yes || | ||
+ | |- | ||
+ | |S03954|| N/A || Yes || Yes || | ||
+ | |- | ||
+ | |S03955|| N/A || Yes || Yes || | ||
+ | |- | ||
+ | |S03956|| N/A || Yes || Yes || | ||
+ | |- | ||
+ | |S03966|| N/A || Yes || Yes || | ||
|- | |- | ||
− | | | + | |K091134|| N/A || Yes || Yes || Ready || |
|- | |- | ||
− | |||
− | |||
|} | |} | ||
<br> | <br> | ||
Line 98: | Line 105: | ||
Ligation 1C B0015 + R0079<br> | Ligation 1C B0015 + R0079<br> | ||
Done!<br> | Done!<br> | ||
− | A | + | A ([http://partsregistry.org/Part:BBa_S03954 S03954]) |
[[Image:S03954.jpg]]<br> | [[Image:S03954.jpg]]<br> | ||
− | B | + | B ([http://partsregistry.org/Part:BBa_S03956 S03956]) |
[[Image:S03956.jpg]]<br> | [[Image:S03956.jpg]]<br> | ||
− | C | + | C([http://partsregistry.org/Part:BBa_S03955 S03955]) |
[[Image:C_1.jpg]] | [[Image:C_1.jpg]] | ||
<br> | <br> | ||
<br> | <br> | ||
− | Ligation 2: Successful Ligation 1A + Successful Ligation | + | Ligation 2: pLacI ([http://partsregistry.org/Part:BBa_R0011 R0011]) + Successful Ligation 1A ([http://partsregistry.org/Part:BBa_S03954 S03954])<br> |
+ | Done! ('''in pSB1AK3''')<br> | ||
+ | [[Image:pLacI.jpg]] + [[Image:S03954.jpg]]<br> | ||
+ | <br> | ||
+ | Ligation 3: Successful Ligation 2 ([http://partsregistry.org/Part:BBa_S03966 S03966])+ [http://partsregistry.org/Part:BBa_S03956 S03956]<br> | ||
+ | [[Image:pLacI.jpg]][[Image:S03954.jpg]] + [[Image:S03956.jpg]]<br> | ||
Done!<br> | Done!<br> | ||
− | [[Image: | + | ([http://partsregistry.org/Part:BBa_K091134 K091134])<br> |
+ | [[Image:K091134.jpg]] | ||
<br> | <br> | ||
− | + | ||
+ | == Building LasR constitutive protein == | ||
+ | [http://partsregistry.org/Part:BBa_J23100 J23100] + [http://partsregistry.org/Part:BBa_S03954 S03954] | ||
+ | |||
+ | {| border="1" cellpadding="2" | ||
+ | !width"50"| | ||
+ | !width="100"|Colonies from Registry Recovery? | ||
+ | !width="100"|Gel Verification? | ||
+ | !width="100"|Status of Testing the Device | ||
+ | !width="100"|Experimental Outcome | ||
+ | |- | ||
+ | |[http://partsregistry.org/Part:BBa_J23100 J23100]|| Yes || Yes || ? || ? | ||
+ | |- | ||
+ | |[http://partsregistry.org/Part:BBa_S03954 S03954]|| Yes || Yes || Ready || Pending | ||
+ | |- | ||
+ | |}<br> | ||
+ | [[Image:J23100.jpg]] + [[Image:S03954.jpg]] | ||
== Building LsrK/LsrR receiver '''TESTER''' cell == | == Building LsrK/LsrR receiver '''TESTER''' cell == | ||
Line 179: | Line 208: | ||
We will need to have constitutive LasR and LuxR made in these cells.<br> | We will need to have constitutive LasR and LuxR made in these cells.<br> | ||
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.] | Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.] | ||
+ | |||
== Making Better pLac promoter and LacI proteins == | == Making Better pLac promoter and LacI proteins == | ||
Line 256: | Line 286: | ||
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]] | |LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]] | ||
|- | |- | ||
− | |} | + | |} <br> |
+ | '''Testing Lac promoters and proteins''' <br> | ||
+ | ''Construct One'' <br> | ||
+ | [[Image:Construct12.jpg]] <br> | ||
+ | ''Construct Two'' <br> | ||
+ | [[Image:Construct2.jpg]] <br> | ||
+ | -We will test by ligating each of these constructs together with the 3 different lac promoters and the 4 different Lac proteins. We will measure the output of GFP to characterize the strength of each promoter and protein. We will have 12 constructs all together. |
Latest revision as of 00:05, 22 July 2008
Contents
- 1 Building LuxI sender TESTER cell
- 2 Building LuxR receiver TESTER cell
- 3 TESTING Lux Sender & Receiver Cells
- 4 Building LuxR constitutive protein
- 5 Building LasI sender TESTER cell
- 6 Building LasR receiver TESTER cell
- 7 Building LasR constitutive protein
- 8 Building LsrK/LsrR receiver TESTER cell
- 9 Testing Crosstalk between Lux and Las
- 10 AND gate using pTetLac promoter
- 11 Building XOR Gate
- 12 Testing XOR Gate
- 13 Making Better pLac promoter and LacI proteins
Building LuxI sender TESTER cell
Part # | Colonies from Registry Recovery? | Gel Verification? | Status of Testing the Device | Experimental Outcome |
---|---|---|---|---|
S03608 | Yes | Yes | Ready | Successful |
Building LuxR receiver TESTER cell
Colonies from Registry Recovery? | Gel Verification? | Status of Testing the Device | Experimental Outcome | |
---|---|---|---|---|
K09100 | Yes | Yes | Ready | Successful |
TESTING Lux Sender & Receiver Cells
Building LuxR constitutive protein
Colonies from Registry Recovery? | Gel Verification? | Status of Testing the Device | Experimental Outcome | |
---|---|---|---|---|
J23100 | Yes | ? | ? | ? |
J37033 | Yes | ? | ? | ? |
Building LasI sender TESTER cell
R0011 + B0034 + C0178.
File:InsertHere.jpg
Colonies from Registry Recovery? | Gel Verification? | Successful Ligation? | Status of Testing the Device | |
---|---|---|---|---|
R0011 | Yes | Yes | ||
B0034 | Yes | Yes | ||
C0178 | Yes | Yes |
Building LasR receiver TESTER cell
Colonies from Registry Recovery? | Gel Verification? | Successful Ligation? | Status of Testing the Device | ||
---|---|---|---|---|---|
S03156 | Yes | Yes | Yes | ||
B0015 | Yes | Yes | Yes | ||
R0079 | Yes | Yes | Yes | ||
E0240 | Yes | Yes | Yes | ||
S03954 | N/A | Yes | Yes | ||
S03955 | N/A | Yes | Yes | ||
S03956 | N/A | Yes | Yes | ||
S03966 | N/A | Yes | Yes | ||
K091134 | N/A | Yes | Yes | Ready |
Ligation 1A S03156 + B0015
Ligation 1B R0079 + E0240
Ligation 1C B0015 + R0079
Done!
A (S03954)
B (S03956)
C(S03955)
Ligation 2: pLacI (R0011) + Successful Ligation 1A (S03954)
Done! (in pSB1AK3)
+
Ligation 3: Successful Ligation 2 (S03966)+ S03956
+
Done!
(K091134)
Building LasR constitutive protein
Colonies from Registry Recovery? | Gel Verification? | Status of Testing the Device | Experimental Outcome | |
---|---|---|---|---|
J23100 | Yes | Yes | ? | ? |
S03954 | Yes | Yes | Ready | Pending |
Building LsrK/LsrR receiver TESTER cell
LsrKp + RBS + LsrK + TT
LsrRp + RBS + LsrR + reporter (GFP/RFP/YFP) + TT
LsrK needs to be constitutively expressed in order to receive the AI-2 signal. LsrR acts as its own repressor, so the reporter should not be activated until the AI-2 signal is received. Once LsrR binds to AI-2 molecule, the LsrR gene is activated and the positive feedback loop is initiated, which also turns on the reporter gene.
Colonies from Registry Recovery? | Gel Verification? | Status of Testing the Device | Experimental Outcome | |
---|---|---|---|---|
part no. | ? | ? | ? | ? |
Testing Crosstalk between Lux and Las
1) Mix LuxI sender cells with LasR receiver tester cells: negative control
2) Mix LasI sender cells with LuxR receiver tester cells: negative control
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green
5) Verify LuxR receiver tester cells don't glow solo
6) Verify LasR receiver tester cells don't glow solo
AND gate using pTetLac promoter
We have successfully built the pTetLac AND promoter: K091101.
This is sequence verified.
Now we need the various LacI proteins (I12, X86 and I12+X86 variants).
We need tetR repressor protein. We have tried to get it from the paper registry.
We need to see if this AND gate works as designed.
We need to test output to see if the two halves are balanced.
Building XOR Gate
List of auto-inducers and their catalog numbers.
Here is an idea Malcolm and Laurie developed.
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone (3OC6HSL)}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented by Egland and Greenberg
Sequences we will need to make this XOR gate.
Part | Oligos | Oligo Design |
---|---|---|
lpLas' | ||
pLasXOR |
Part | Forward Primer | Reverse Primer |
---|---|---|
pLux | ||
pLuxXOR |
Testing XOR Gate
We will need to have constitutive LasR and LuxR made in these cells.
Then we will need to hit them with the two chemicals AHL types and commercial sources.
Making Better pLac promoter and LacI proteins
LacI wild-type gene sequence (ORF begins at the first amino acid)
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA
ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG
CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC
TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT
GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG
GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC
AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA
LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA
LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC
GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC
AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC
ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC
GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG
CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG
TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA
GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG
CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA
LacI_I12_X86 Mutation
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG
CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC
GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC
CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC
TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG
AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT
CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC
GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT
TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA
LacI Promoter
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG
LacIQ Promoter
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG
LacIQ1 Promoter
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG
-These promoter sequences are taken from Glascock and Weickert 1998
Part | Forward | Reverse |
---|---|---|
lacIQ1 Promoter | ||
lacIQ Promoter | ||
LacI_I12 | ||
LacI | ||
LacI_X86 (Primers for step 1 of PCR) | ||
LacI_I12X86 (Primers for step 1 of PCR) |
Testing Lac promoters and proteins
Construct One
Construct Two
-We will test by ligating each of these constructs together with the 3 different lac promoters and the 4 different Lac proteins. We will measure the output of GFP to characterize the strength of each promoter and protein. We will have 12 constructs all together.