Difference between revisions of "Davidson Projects with Updates"

From GcatWiki
Jump to: navigation, search
(Building LasR constitutive protein)
(Building LasI sender '''TESTER''' cell)
 
(34 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
== Building LuxI sender '''TESTER''' cell ==
 
== Building LuxI sender '''TESTER''' cell ==
DONE! (ready to test)<BR>
+
<BR>
 
{| border="1" cellpadding="2"
 
{| border="1" cellpadding="2"
 
!width"50"|Part #
 
!width"50"|Part #
Line 15: Line 15:
  
 
== Building LuxR receiver '''TESTER''' cell ==
 
== Building LuxR receiver '''TESTER''' cell ==
DONE! (ready to test) <br>
+
<br>
 
 
 
{| border="1" cellpadding="2"
 
{| border="1" cellpadding="2"
 
!width"50"|
 
!width"50"|
Line 29: Line 28:
 
[[Image:K09100.jpg]]<br>
 
[[Image:K09100.jpg]]<br>
 
<br>
 
<br>
 +
 +
== '''TESTING''' Lux Sender & Receiver Cells ==
 +
<BR>
 +
[[Image:setup1.jpg]]
 +
<br><br><br><br>
 +
[[Image:official.jpg]]
 +
<br><br>
  
 
== Building LuxR constitutive protein ==
 
== Building LuxR constitutive protein ==
Promoter (pBad?) + [http://partsregistry.org/Part:BBa_ Fix this]
+
[http://partsregistry.org/Part:BBa_J23100 J23100] + [http://partsregistry.org/wiki/index.php?title=Part:BBa_J37033 J37033]
  
 
{| border="1" cellpadding="2"
 
{| border="1" cellpadding="2"
Line 40: Line 46:
 
!width="100"|Experimental Outcome
 
!width="100"|Experimental Outcome
 
|-
 
|-
|[http://partsregistry.org/Part:BBa_S03954 Fix This]|| ? || ? || ? || ?
+
|[http://partsregistry.org/Part:BBa_J23100 J23100]|| Yes || ? || ? || ?
 
|-
 
|-
 +
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_J37033 J37033]|| Yes || ? || ? || ?
 
|}<br>
 
|}<br>
[[Image:Const_LuxR.jpg]]
+
[[Image:promoter.jpg]] + [[Image:coding.jpg]]
  
 
== Building LasI sender '''TESTER''' cell ==
 
== Building LasI sender '''TESTER''' cell ==
Line 62: Line 69:
 
|}
 
|}
 
<br>
 
<br>
 
+
[[Image:las.jpg]]
 
<br>
 
<br>
  
Line 77: Line 84:
 
|B0015|| Yes|| Yes|| Yes ||
 
|B0015|| Yes|| Yes|| Yes ||
 
|-
 
|-
|R0079|| Yes|| Yes || Yes ||
+
|R0079|| Yes || Yes || Yes ||
 
|-
 
|-
|E0240|| Yes|| Yes || Yes ||
+
|E0240|| Yes || Yes || Yes ||
 +
|-
 +
|S03954|| N/A || Yes || Yes ||
 +
|-
 +
|S03955|| N/A || Yes || Yes ||
 +
|-
 +
|S03956|| N/A || Yes || Yes ||
 +
|-
 +
|S03966|| N/A || Yes || Yes ||
 +
|-
 +
|K091134|| N/A || Yes || Yes || Ready ||
 
|-
 
|-
|R0011|| Yes|| Yes|| Pending ||
 
|-
 
 
|}
 
|}
 
<br>
 
<br>
Line 90: Line 105:
 
Ligation 1C B0015 + R0079<br>
 
Ligation 1C B0015 + R0079<br>
 
Done!<br>
 
Done!<br>
A
+
A ([http://partsregistry.org/Part:BBa_S03954 S03954])
 
[[Image:S03954.jpg]]<br>
 
[[Image:S03954.jpg]]<br>
B
+
B ([http://partsregistry.org/Part:BBa_S03956 S03956])
 
[[Image:S03956.jpg]]<br>
 
[[Image:S03956.jpg]]<br>
C
+
C([http://partsregistry.org/Part:BBa_S03955 S03955])
 
[[Image:C_1.jpg]]
 
[[Image:C_1.jpg]]
 
<br>
 
<br>
 
<br>
 
<br>
Ligation 2: Successful Ligation 1A + Successful Ligation 1B<br>
+
Ligation 2: pLacI ([http://partsregistry.org/Part:BBa_R0011 R0011]) + Successful Ligation 1A ([http://partsregistry.org/Part:BBa_S03954 S03954])<br>
 +
Done! ('''in pSB1AK3''')<br>
 +
[[Image:pLacI.jpg]] + [[Image:S03954.jpg]]<br>
 +
<br>
 +
Ligation 3: Successful Ligation 2 ([http://partsregistry.org/Part:BBa_S03966 S03966])+ [http://partsregistry.org/Part:BBa_S03956 S03956]<br>
 +
[[Image:pLacI.jpg]][[Image:S03954.jpg]] + [[Image:S03956.jpg]]<br>
 
Done!<br>
 
Done!<br>
[[Image:K091118.jpg]]<br>
+
([http://partsregistry.org/Part:BBa_K091134 K091134])<br>
 +
[[Image:K091134.jpg]]
 
<br>
 
<br>
Ligation 3: R0011 + Ligation 2<br>
 
  
 
== Building LasR constitutive protein ==
 
== Building LasR constitutive protein ==
Promoter [http://partsregistry.org/Part:BBa_J23100 J23100]
+
[http://partsregistry.org/Part:BBa_J23100 J23100] + [http://partsregistry.org/Part:BBa_S03954 S03954]
  
 
{| border="1" cellpadding="2"
 
{| border="1" cellpadding="2"
Line 114: Line 134:
 
!width="100"|Experimental Outcome
 
!width="100"|Experimental Outcome
 
|-
 
|-
|[http://partsregistry.org/Part:BBa_J23100 J23100]| ? || ? || ? || ?
+
|[http://partsregistry.org/Part:BBa_J23100 J23100]|| Yes || Yes || ? || ?  
 
|-
 
|-
 
|[http://partsregistry.org/Part:BBa_S03954 S03954]|| Yes || Yes || Ready || Pending
 
|[http://partsregistry.org/Part:BBa_S03954 S03954]|| Yes || Yes || Ready || Pending
 
|-
 
|-
 
|}<br>
 
|}<br>
[[Image:Const_LasR.jpg]]
+
[[Image:J23100.jpg]] + [[Image:S03954.jpg]]
  
 
== Building LsrK/LsrR receiver '''TESTER''' cell ==
 
== Building LsrK/LsrR receiver '''TESTER''' cell ==
Line 188: Line 208:
 
We will need to have constitutive LasR and LuxR made in these cells.<br>
 
We will need to have constitutive LasR and LuxR made in these cells.<br>
 
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]
 
Then we will need to hit them with the two chemicals [http://partsregistry.org/AHL AHL types and commercial sources.]
 +
  
 
== Making Better pLac promoter and LacI proteins ==
 
== Making Better pLac promoter and LacI proteins ==
Line 265: Line 286:
 
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]
 
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]
 
|-
 
|-
|}
+
|} <br>
 +
'''Testing Lac promoters and proteins''' <br>
 +
''Construct One'' <br>
 +
[[Image:Construct12.jpg]] <br>
 +
''Construct Two'' <br>
 +
[[Image:Construct2.jpg]] <br>
 +
-We will test by ligating each of these constructs together with the 3 different lac promoters and the 4 different Lac proteins. We will measure the output of GFP to characterize the strength of each promoter and protein. We will have 12 constructs all together.

Latest revision as of 00:05, 22 July 2008

Building LuxI sender TESTER cell


Part # Colonies from Registry Recovery? Gel Verification? Status of Testing the Device Experimental Outcome
S03608 Yes Yes Ready Successful

Error creating thumbnail: Unable to save thumbnail to destination


Building LuxR receiver TESTER cell


Colonies from Registry Recovery? Gel Verification? Status of Testing the Device Experimental Outcome
K09100 Yes Yes Ready Successful

Error creating thumbnail: Unable to save thumbnail to destination


TESTING Lux Sender & Receiver Cells


Error creating thumbnail: Unable to save thumbnail to destination





Error creating thumbnail: Unable to save thumbnail to destination



Building LuxR constitutive protein

J23100 + J37033

Colonies from Registry Recovery? Gel Verification? Status of Testing the Device Experimental Outcome
J23100 Yes  ?  ?  ?
J37033 Yes  ?  ?  ?

Error creating thumbnail: Unable to save thumbnail to destination
+
Error creating thumbnail: Unable to save thumbnail to destination

Building LasI sender TESTER cell

R0011 + B0034 + C0178.
File:InsertHere.jpg

Colonies from Registry Recovery? Gel Verification? Successful Ligation? Status of Testing the Device
R0011 Yes Yes
B0034 Yes Yes
C0178 Yes Yes


Error creating thumbnail: Unable to save thumbnail to destination


Building LasR receiver TESTER cell

Colonies from Registry Recovery? Gel Verification? Successful Ligation? Status of Testing the Device
S03156 Yes Yes Yes
B0015 Yes Yes Yes
R0079 Yes Yes Yes
E0240 Yes Yes Yes
S03954 N/A Yes Yes
S03955 N/A Yes Yes
S03956 N/A Yes Yes
S03966 N/A Yes Yes
K091134 N/A Yes Yes Ready


Ligation 1A S03156 + B0015
Ligation 1B R0079 + E0240
Ligation 1C B0015 + R0079
Done!
A (S03954)

Error creating thumbnail: Unable to save thumbnail to destination

B (S03956)

Error creating thumbnail: Unable to save thumbnail to destination

C(S03955)

Error creating thumbnail: Unable to save thumbnail to destination



Ligation 2: pLacI (R0011) + Successful Ligation 1A (S03954)
Done! (in pSB1AK3)

Error creating thumbnail: Unable to save thumbnail to destination
+
Error creating thumbnail: Unable to save thumbnail to destination


Ligation 3: Successful Ligation 2 (S03966)+ S03956

Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
+
Error creating thumbnail: Unable to save thumbnail to destination

Done!
(K091134)

Error creating thumbnail: Unable to save thumbnail to destination


Building LasR constitutive protein

J23100 + S03954

Colonies from Registry Recovery? Gel Verification? Status of Testing the Device Experimental Outcome
J23100 Yes Yes  ?  ?
S03954 Yes Yes Ready Pending

Error creating thumbnail: Unable to save thumbnail to destination
+
Error creating thumbnail: Unable to save thumbnail to destination

Building LsrK/LsrR receiver TESTER cell

LsrKp + RBS + LsrK + TT

LsrRp + RBS + LsrR + reporter (GFP/RFP/YFP) + TT

LsrK needs to be constitutively expressed in order to receive the AI-2 signal. LsrR acts as its own repressor, so the reporter should not be activated until the AI-2 signal is received. Once LsrR binds to AI-2 molecule, the LsrR gene is activated and the positive feedback loop is initiated, which also turns on the reporter gene.

Colonies from Registry Recovery? Gel Verification? Status of Testing the Device Experimental Outcome
part no.  ?  ?  ?  ?

Testing Crosstalk between Lux and Las

1) Mix LuxI sender cells with LasR receiver tester cells: negative control
2) Mix LasI sender cells with LuxR receiver tester cells: negative control
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green
5) Verify LuxR receiver tester cells don't glow solo
6) Verify LasR receiver tester cells don't glow solo

AND gate using pTetLac promoter

We have successfully built the pTetLac AND promoter: K091101.
This is sequence verified.
Now we need the various LacI proteins (I12, X86 and I12+X86 variants).
We need tetR repressor protein. We have tried to get it from the paper registry.
We need to see if this AND gate works as designed.
We need to test output to see if the two halves are balanced.

Building XOR Gate

List of auto-inducers and their catalog numbers.

Davidson Approach

Here is an idea Malcolm and Laurie developed.

Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.
Error creating thumbnail: Unable to save thumbnail to destination

The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone (3OC6HSL)}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented by Egland and Greenberg

Sequences we will need to make this XOR gate.

Part Oligos Oligo Design
lpLas'
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
pLasXOR
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination

Part Forward Primer Reverse Primer
pLux
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
pLuxXOR
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination

Testing XOR Gate

We will need to have constitutive LasR and LuxR made in these cells.
Then we will need to hit them with the two chemicals AHL types and commercial sources.


Making Better pLac promoter and LacI proteins

LacI wild-type gene sequence (ORF begins at the first amino acid) ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI_I12_X86 Mutation
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI Promoter
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG

LacIQ Promoter
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG

LacIQ1 Promoter
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG

-These promoter sequences are taken from Glascock and Weickert 1998

Part Forward Reverse
lacIQ1 Promoter
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
lacIQ Promoter
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
LacI_I12
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
LacI
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
LacI_X86 (Primers for step 1 of PCR)
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
LacI_I12X86 (Primers for step 1 of PCR)
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination

Testing Lac promoters and proteins
Construct One

Error creating thumbnail: Unable to save thumbnail to destination

Construct Two

Error creating thumbnail: Unable to save thumbnail to destination

-We will test by ligating each of these constructs together with the 3 different lac promoters and the 4 different Lac proteins. We will measure the output of GFP to characterize the strength of each promoter and protein. We will have 12 constructs all together.