Difference between revisions of "Catherinel Notebook1"

From GcatWiki
Jump to: navigation, search
Line 160: Line 160:
 
Energy dot plot
 
Energy dot plot
 
In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.
 
In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
  
 
Figure 4. Energy Diagram.  
 
Figure 4. Energy Diagram.  
 
The optimal energy for optimal folding in -25.6kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.  
 
The optimal energy for optimal folding in -25.6kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.  
−
 
−
 
−
 
−
 
  
 
ss-count
 
ss-count
 
ss-count is the propensity of a base to be single stranded, as measured by the number of times it is single stranded in a group of predicted foldings. The ss-count file gives the number of predicted foldings on the first line. The ith subsequent line contains i and the number of foldings in which the ith base was single stranded. The plotting option gives plots of ss-count values averaged over a user selected window.
 
ss-count is the propensity of a base to be single stranded, as measured by the number of times it is single stranded in a group of predicted foldings. The ss-count file gives the number of predicted foldings on the first line. The ith subsequent line contains i and the number of foldings in which the ith base was single stranded. The plotting option gives plots of ss-count values averaged over a user selected window.
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
  
  
 
Curricular structural plots.  
 
Curricular structural plots.  
 
   
 
   
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
 
Predicted structures:
 
Predicted structures:
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
  
  
Line 258: Line 178:
  
 
I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).  
 
I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).  
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
  
  
 
Figure 1. Default values for user input describing folding conditions.  
 
Figure 1. Default values for user input describing folding conditions.  
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
−
 
  
  
 
Figure 2. Default values for user input describing output conditions.  
 
Figure 2. Default values for user input describing output conditions.  
−
 
−
 
−
 
  
  
Line 306: Line 195:
 
Energy dot plot
 
Energy dot plot
 
In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.
 
In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.
−
 
−
 
−
 
−
 
  
  
Line 315: Line 200:
 
The optimal energy for optimal folding in -8.9kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.  
 
The optimal energy for optimal folding in -8.9kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.  
  
 +
Curricular structural plots.
 +
  
 +
Predicted structures:
  
 +
=== ===
 +
==[[User:Catherine|cadoyle]], 28 August 2013 (EDT)==
 +
After meeting with Dr. Campbell yesterday 27 August 2013 we decided to write Dr. Heyer and email about getting together for a riboswitch design meeting. I was assigned to write Dr. Heyer and email explaining our goals and questions about rationally designing riboswitches for known aptamers. Below is the email I sent Dr. Heyer with attached PDFs. I am currently waiting Dr. Heyer's response.
  
 +
Dr. Heyer,
  
 +
Dr. Campbell and I would like to meet with you to talk about how we can look at the structures of riboswitches for theophylline and determine how they converted aptamers into riboswitches, in hopes to rationally design riboswitches for caffiene, 3-methylxanthine, and xanthine. By looking at the paper Topp et al (2010) we would like to compare and contrast the different riboswitches built and determine 1) how they were able to get the RBS to base pair with the theophylline aptamer and 2) why certain riboswitch structures did not work. We were thinking that we could utilize M-fold to help us understand the differences in the riboswitch designs and how they relate to the folding of the aptamer. In our meeting I will present  information on whether 1) Topp et al (2010) changed the sequence of the previously characterized theophylline aptamer and 2) how they determined which RBS to use for the theophylline riboswitch. Attached are three PDF files 1) the Topp et al. (2010) 2) Supplemental for Topp et al (2010) with figures of the designed riboswitches (Becca Evans developed riboswitch D) and methods, and 3) Zimmerman et al. (1997), which originally characterized the theophylline aptamer. Please let us know some times when you are available so we can pick one that works for both of us.
  
−
Curricular structural plots.
 
−
 
−
 
−
 
  
 +
Thanks,
  
 +
Catherine
  
 +
Lab Meeting Presentation on Aptamers and Riboswitches:
  
 +
For Friday's lab meeting (08/30/2013) I am presenting the aims of my project. My main objective is to explain what an aptamer and riboswitch are and how we can use them to detect an unknown metabolite of caffeine.
  
 +
Aptamer:
 +
An aptamer is short nucleic acid sequence that binds to a specific small molecule or ligand.
  
−
Predicted structures:
+
I found this great video that explained an aptamer as a dart aiming for a specific point on a target. "A Customized DNA dart" [[http://www.youtube.com/watch?v=sy_qEWLI4Qw]]
  
 +
Riboswitch:
 +
A riboswitch is a regulatory segment of a messenger RNA molecule that binds to a small molecule, resulting in a change in production of the proteins encoded by the mRNA.
 +
Characteristics:
 +
-Translational control
 +
-Contains aptamer sequence
 +
-In 5’ untranslated region of mRNA
  
 +
In my presentation I made two other slides:
 +
1) showing the folding of the riboswitch with the aptamer from Topp et al (2010).
 +
2) a graph showing how different riboswitches detect theophylline in E. coli.
  
−
+
Tomorrow I will finish up power point and post in lab notebook. I need to add what the goal of my project is and a few more diagrams to explain how riboswitches and aptamers interact.
−
 
 
−
 
 
  
 
=== ===
 
=== ===

Revision as of 01:54, 29 August 2013

Back to Main Page

cadoyle, 25 August 2013 (EDT)

I meet with Dr. Campbell on Wednesday, 21st of August 2013. We discussed finishing up my thesis proposal by adding in the aptamer sequences for caffeine and 3-methylxanthine that I will be designing riboswitches for.

I found caffeine's aptamer from Alpha Diagnostic Intl. Inc [[1]]. I downloaded the paper: Ferguson et al. 2004 that characterized the aptamer and obtained the sequence. On Alpha Diagnostic Int. Inc website there is a product data sheet for the caffeine aptamer that will be useful [[2]].

I found the apatmer for 3-methylxanthine from Soukop et al. (2000). I found this paper while I was doing research for my proposal. I read in Lee et al. (2010) that a 3-methylxanthien apatamer had been discovered from mutation in the theophylline aptamer. Lee et al. (2010) cited Soukop et al. (2000) for the characterization of the 3-methylxanthine aptamer. In Soukop et al. (2000) they list two aptamers for 3-methylxanthine I picked the one with C22 mutation only because it had a stronger affinity for 3-methlyxanthine (Figure 2C) despite Figure 1B showing that it's specificity for 3-methylxanthine is low.

Name Sequence Reference
Caffeine 5-GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGGAUCAUCGGACUUUGUCCUGUGGAGUAAGAUCG CGAAACGGUGAAAGCCGUAGGUCU-3 Ferguson et al. (2004)
3-methlyxanthine 5- AUACCAGCCGAAAGGCCAUUGGCAG-3 Soukop et al. (2000)

I find it interesting and concerning that the aptamer for 3-methylxanthine is so short. Maybe the hammerhead ribozyme needs to be added to the sequence. I will check with Dr. Campbell about it.

Also, In my meeting with Dr. Campbell we talked about comparing the structure of theophylline aptamer in Riboswitch D from Topp et al. (2010) to the structures of the caffeine aptamer and 3-methylxanthien aptamer in Riboswitch D. M-fold is web base software that predicts secondary structures of DNA and RNA, which we can use to compare the structures of the aptamers to see if the Riboswitch D will work for the three aptamers.

I read the paper characterizing the software program Zuker (2003) to understand what the input and output values mean for the program.

M-Fold Characterization of the Theophylline, Caffiene, and 3-Methylxanthine Aptamers


Theophylline:

M-Fold Server Input (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form):

I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).


Figure 1. Default values for user input describing folding conditions.


Figure 2. Default values for user input describing output conditions.


Results: Theophylline Sequence:


Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 5. Window size id determined by program based on sequence length.


Energy dot plot In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.







Figure 4. Energy Diagram. The optimal energy for optimal folding in -71.8kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.



ss-count ss-count is the propensity of a base to be single stranded, as measured by the number of times it is single stranded in a group of predicted foldings. The ss-count file gives the number of predicted foldings on the first line. The ith subsequent line contains i and the number of foldings in which the ith base was single stranded. The plotting option gives plots of ss-count values averaged over a user selected window.


Curricular structural plots.


Predicted structures:










08/25/1992

Caffeine:

M-Fold Server Input (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form):

I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).









Figure 1. Default values for user input describing folding conditions.








Figure 2. Default values for user input describing output conditions.


Results: Caffeine Sequence:


Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 2. Window size is determined by program based on sequence length.


Energy dot plot In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.

Figure 4. Energy Diagram. The optimal energy for optimal folding in -25.6kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.

ss-count ss-count is the propensity of a base to be single stranded, as measured by the number of times it is single stranded in a group of predicted foldings. The ss-count file gives the number of predicted foldings on the first line. The ith subsequent line contains i and the number of foldings in which the ith base was single stranded. The plotting option gives plots of ss-count values averaged over a user selected window.


Curricular structural plots.

Predicted structures:


3-Methylxanthine:

M-Fold Server Input (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form):

I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).


Figure 1. Default values for user input describing folding conditions.


Figure 2. Default values for user input describing output conditions.


Results: 3-methylxanthine Sequence:


Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 0. Window size is determined by program based on sequence length.


Energy dot plot In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.


Figure 4. Energy Diagram. The optimal energy for optimal folding in -8.9kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.

Curricular structural plots.


Predicted structures:

cadoyle, 28 August 2013 (EDT)

After meeting with Dr. Campbell yesterday 27 August 2013 we decided to write Dr. Heyer and email about getting together for a riboswitch design meeting. I was assigned to write Dr. Heyer and email explaining our goals and questions about rationally designing riboswitches for known aptamers. Below is the email I sent Dr. Heyer with attached PDFs. I am currently waiting Dr. Heyer's response.

Dr. Heyer,

Dr. Campbell and I would like to meet with you to talk about how we can look at the structures of riboswitches for theophylline and determine how they converted aptamers into riboswitches, in hopes to rationally design riboswitches for caffiene, 3-methylxanthine, and xanthine. By looking at the paper Topp et al (2010) we would like to compare and contrast the different riboswitches built and determine 1) how they were able to get the RBS to base pair with the theophylline aptamer and 2) why certain riboswitch structures did not work. We were thinking that we could utilize M-fold to help us understand the differences in the riboswitch designs and how they relate to the folding of the aptamer. In our meeting I will present information on whether 1) Topp et al (2010) changed the sequence of the previously characterized theophylline aptamer and 2) how they determined which RBS to use for the theophylline riboswitch. Attached are three PDF files 1) the Topp et al. (2010) 2) Supplemental for Topp et al (2010) with figures of the designed riboswitches (Becca Evans developed riboswitch D) and methods, and 3) Zimmerman et al. (1997), which originally characterized the theophylline aptamer. Please let us know some times when you are available so we can pick one that works for both of us.


Thanks,

Catherine

Lab Meeting Presentation on Aptamers and Riboswitches:

For Friday's lab meeting (08/30/2013) I am presenting the aims of my project. My main objective is to explain what an aptamer and riboswitch are and how we can use them to detect an unknown metabolite of caffeine.

Aptamer: An aptamer is short nucleic acid sequence that binds to a specific small molecule or ligand.

I found this great video that explained an aptamer as a dart aiming for a specific point on a target. "A Customized DNA dart" [[3]]

Riboswitch: A riboswitch is a regulatory segment of a messenger RNA molecule that binds to a small molecule, resulting in a change in production of the proteins encoded by the mRNA. Characteristics: -Translational control -Contains aptamer sequence -In 5’ untranslated region of mRNA

In my presentation I made two other slides: 1) showing the folding of the riboswitch with the aptamer from Topp et al (2010). 2) a graph showing how different riboswitches detect theophylline in E. coli.

Tomorrow I will finish up power point and post in lab notebook. I need to add what the goal of my project is and a few more diagrams to explain how riboswitches and aptamers interact.