Difference between revisions of "Catherinel Notebook1"

From GcatWiki
Jump to: navigation, search
Line 13: Line 13:
 
==[[User:Catherine|cadoyle]], 25 August 2013 (EDT)==
 
==[[User:Catherine|cadoyle]], 25 August 2013 (EDT)==
 
     I meet with Dr. Campbell on Wednesday, 21st of August 2013. We discussed finishing up my thesis proposal by adding in the aptamer sequences for caffeine and 3-methylxanthine that I will be designing riboswitches for.  
 
     I meet with Dr. Campbell on Wednesday, 21st of August 2013. We discussed finishing up my thesis proposal by adding in the aptamer sequences for caffeine and 3-methylxanthine that I will be designing riboswitches for.  
−
 
  
 
     I found caffeine's aptamer from Alpha Diagnostic Intl. Inc [[http://www.4adi.com/ccpc2774-27034-caffeine-28tct8-429--rna-aptamer--unlabeled-rna-aptamers-ar-214-u.htm]]. I downloaded the paper: Ferguson et al. 2004 that characterized the aptamer and obtained the sequence. On Alpha Diagnostic Int. Inc website there is a  product data sheet for the caffeine aptamer that will be useful [[http://www.4adi.com/objects/catalog/product/extras/AR-214-U.pdf]].  
 
     I found caffeine's aptamer from Alpha Diagnostic Intl. Inc [[http://www.4adi.com/ccpc2774-27034-caffeine-28tct8-429--rna-aptamer--unlabeled-rna-aptamers-ar-214-u.htm]]. I downloaded the paper: Ferguson et al. 2004 that characterized the aptamer and obtained the sequence. On Alpha Diagnostic Int. Inc website there is a  product data sheet for the caffeine aptamer that will be useful [[http://www.4adi.com/objects/catalog/product/extras/AR-214-U.pdf]].  

Revision as of 10:27, 30 August 2013

Back to Main Page of Catherine's Notebook

cadoyle, 25 August 2013 (EDT)

   I meet with Dr. Campbell on Wednesday, 21st of August 2013. We discussed finishing up my thesis proposal by adding in the aptamer sequences for caffeine and 3-methylxanthine that I will be designing riboswitches for. 
   I found caffeine's aptamer from Alpha Diagnostic Intl. Inc [[1]]. I downloaded the paper: Ferguson et al. 2004 that characterized the aptamer and obtained the sequence. On Alpha Diagnostic Int. Inc website there is a  product data sheet for the caffeine aptamer that will be useful [[2]]. 


   I found the apatmer for 3-methylxanthine from File:Soukop et al. (2000).pdf. I found this paper while I was doing research for my proposal. I read in File:Lee et al. (2010).pdf that a 3-methylxanthien apatamer had been discovered from mutation in the theophylline aptamer. Lee et al. (2010) cited Soukop et al. (2000) for the characterization of the 3-methylxanthine aptamer. In Soukop et al. (2000) they list two aptamers for 3-methylxanthine I picked the one with C22 mutation only because it had a stronger affinity for 3-methlyxanthine (Figure 2C) despite Figure 1B showing that it's specificity for 3-methylxanthine is low. 


Name Sequence Reference
Caffeine 5-GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGGAUCAUCGGACUUUGUCCUGUGGAGUAAGAUCG CGAAACGGUGAAAGCCGUAGGUCU-3 Ferguson et al. (2004)
3-methlyxanthine 5- AUACCAGCCGAAAGGCCAUUGGCAG-3 Soukop et al. (2000)


   I find it interesting and concerning that the aptamer for 3-methylxanthine is so short. Maybe the hammerhead ribozyme needs to be added to the sequence. I will check with Dr. Campbell about it. 


   Also, in my meeting with Dr. Campbell we talked about comparing the structure of theophylline aptamer in Riboswitch D from File:Topp et al. (2010).pdf to the structures of the caffeine aptamer and 3-methylxanthien aptamer in Riboswitch D. M-fold is web base software that predicts secondary structures of DNA and  RNA, which we can use to compare the structures of the aptamers to see if the Riboswitch D will work for the three aptamers. 


  I read the paper characterizing the software program File:Zuker(2003) to understand what the input and output values mean for the program. 


Information on interpreting output results:


Energy dot plot

   In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form.

M-Fold Characterization of the Theophylline, Caffiene, and 3-Methylxanthine Aptamers


ss-count

   ss-count is the propensity of a base to be single stranded, as measured by the number of times it is single stranded in a group of predicted foldings. The ss-count file gives the number of predicted foldings on the first line. The ith subsequent line contains i and the number of foldings in which the ith base was single stranded. The plotting option gives plots of ss-count values averaged over a user selected window.


M-Fold Characterization of the Theophylline, Caffiene, and 3-Methylxanthine Aptamers


Theophylline:

M-Fold Server Input (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form):

I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).

File:Defaultvaluesinput.jg

Figure 1. Default values for user input describing folding conditions.


Error creating thumbnail: Unable to save thumbnail to destination

Figure 2. Default values for user input describing output conditions.


Results: Theophylline Sequence:

Error creating thumbnail: Unable to save thumbnail to destination

Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 5. Window size id determined by program based on sequence length.


Error creating thumbnail: Unable to save thumbnail to destination

Figure 4. Energy Diagram. The optimal energy for optimal folding in -71.8kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.


Curricular structural plots.

Error creating thumbnail: Unable to save thumbnail to destination


Predicted structures:

File:Theoprestru.jpg


Caffeine:


I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).

File:DefaultvaluesinputC.jg

Figure 1. Default values for user input describing folding conditions.


File:DefaultvaluesoutputC.jpg

Figure 2. Default values for user input describing output conditions.


Results: Theophylline Sequence:

Error creating thumbnail: Unable to save thumbnail to destination

Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 3. Window size id determined by program based on sequence length.


Error creating thumbnail: Unable to save thumbnail to destination

Figure 4. Energy Diagram. The optimal energy for optimal folding in -25.6kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.


Curricular structural plots.

Error creating thumbnail: Unable to save thumbnail to destination


Predicted structures:

File:Caffprestru.jpg


3-Methlyxanthine


I used the RNA Folding Form with no constraints. I kept default values (Figure 1). I selected immediate job since the sequence is short. I kept the default values for output (Figure 2).

File:Defaultvaluesinput3.jg

Figure 1. Default values for user input describing folding conditions.


File:Defaultvaluesoutput3.jpg

Figure 2. Default values for user input describing output conditions.


Results: Theophylline Sequence:


Error creating thumbnail: Unable to save thumbnail to destination

Figure 3. Sequence output with number of nucleotide bases, max folds, for window size 0. Window size id determined by program based on sequence length.


Error creating thumbnail: Unable to save thumbnail to destination

Figure 4. Energy Diagram. The optimal energy for optimal folding in -8.9kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.


Curricular structural plots.

Error creating thumbnail: Unable to save thumbnail to destination


Predicted structures:

File:3Metprestru.jpg

I put all the structures of the three aptamers together so we can compare their structures.

Error creating thumbnail: Unable to save thumbnail to destination


Conclusion: None of the aptamers are similar in structure. The second structure of caffeine is slightly similar to the second structure of theophylline. 3-Methylxanthine looks very odd and very different from the rest of the apatmers. I am going to send this information to Dr. Heyer to see if she can help us explain the results.


cadoyle, 26 August 2013 (EDT)

My objective for today is to start designing a method to build riboswitches for caffeine and 3-methlyxanthine.


   I can build the riboswitches using Golden Gate Assembly (GGA). Adapting  riboswitch D for theophylline from Topp et al. (2010) modified by Becca in the lab during the summer of 2012, I can build riboswitches for the new aptamers. 


I looked at Becca's power point and designed a protocol for making a new riboswitch from scratch using GGA.


Outline: 1) Get each part including destination plasmid 2) Perform iPCR on each part 3) Perform GGA 4) Sequence Verify 5) Test


Error creating thumbnail: Unable to save thumbnail to destination


Error creating thumbnail: Unable to save thumbnail to destination


Error creating thumbnail: Unable to save thumbnail to destination


Error creating thumbnail: Unable to save thumbnail to destination


File:RiboPro5.jpg


Error creating thumbnail: Unable to save thumbnail to destination


Error creating thumbnail: Unable to save thumbnail to destination


I have a few questions about the method I generated to ask Dr. Campbell: 1) What vector should the riboswitches be cloned into? 2) How doe we the sequence of the aptamer cloned?


   Meeting with Dr. Campbell about method to design riboswitches:
   The way I had designed the protocol for riboswitch design still utilizes the old method of cloning and PCR. There is not reason to start from scratch to build the riboswtich we design primers for anywhere on the existing riboswitch for theophylline and remove the aptamer and replace it with any aptamer we like. We can clone the aptamer upstream of the RBS and screen by size to see if the aptamer is the correct position.Dr. Campbell said that any vector ending in a 8 will work because it has the BSAI removed for GGA. 
   Therefore, we need to the apatmers for caffeine and 3-methylxanthine synthesized. IDT has a product called g-blocks where you can a sequence synthesized but cloned cheaply. I will pull the aptamer sequences together and send to Dr. Campbell. 


What I need to do to move forward: 1) Get sequences for Dr. Campbell for production of G-blocks 2) Design primers to insert aptamers into theophylline riboswitch 3) Design primers to remove theophllyine aptamer 4) I need to send to Dr. Campbell Lee et al which I believe contain information on how the location of an RBS effects the affinity of a riboswitch for a metabolite.


I submitted my Thesis Proposal Today and should know by Friday if it was approved. Click here to download File:DoyleThesisProposal.docx

cadoyle, 27 August 2013 (EDT)

My objective today is to gather sequences for making G-blocks and design primers to insert the aptamer G-blocks into the existing riboswitch for theophylline.

   I emailed Dr. Campbell Lee et al (2010) paper and he said we needed reference 20 for the theophylline aptamer. Reference 20 is Soukop et al (2000). Relooking at this paper we noticed that there are two aptamers for 3-methylxanthine. From the data it seems that the 3-methylxanthine aptamer with only a C22 has a higher affinity for 3-methylxanthien despite low specificity overall. We decided that it would be better to test both as we are unsure how either will operate in our riboswitch. Therefore, we will have two aptamers for 3-methlyxanthine and 1 for caffeine. 

Below is the G-block information and primer design for caffeine, 3-methlyxanthine, the theophylline riboswitch:

Riboswitch Designs:

Caffeine:

Aptamer Sequence (99mer): ‘5-GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGGAUCAUCGGACUUUGUCCUGUGGAGUAAGAUCG CGAAACGGUGAAAGCCGUAGGUCU-3'

Primers to add BSAI:

Caffeine Aptamer For (27mer): GGTCTC A GGAUGUCCAGUCGCUUGCAA BSAI 1bp 20mer of caffeine aptamer


Caffeine Aptamer Rev (27mer): GGTCTC A UGUCCTUCGGCTTTCUCCGT BSAI 1bp 20mer of caffeine apatmer


3-methlyxanthine:

Aptamer sequence (25mer): 5- AUACCAGCCGAAAGGCCAUUGGCAG-3

Primers to add BSAI:

3-MethylC22 Aptamer For (20mer): GGTCTC A AUACCAGCCGAAA BSAI 1bp 13mer of 3-methylxanthine

3-MethylC22 Aptamer Rev (19mer): GGTCTC A CTGCCUUTGGCC BSAI 1bp 12mer of 3-methylxanthine


3-Methylxanthine Protoypic Aptamer Sequence: 5’-AUACCAAGC-GAAAGGCCAUUGGAAG-3’


3-Methylprototypic Aptamer For (20mer): GGTCTC A AUACCAAGC-GAA BSAI 1bp 13mer of 3-methylxanthine

3-Methylprototypic Aptamer Rev (19mer): GGTCTC A CTTCCUUTGGCCT BSAI 1bp 12mer of 3-methylxanthine


Theophylline: ‘5-ggtgataccagcatcgtcttgatgcccttggcagcaccctgct-3’

Theophylline Aptamer For (27mer): GGTCTC A ggtgataccagcatcgtctt BSAI 1bp 20mer of caffeine aptamer


Theophylline Aptamer Rev (27mer): GGTCTC A agcagggtgctgccaagggc BSAI 1bp 20mer of caffeine apatmer


Riboswitch Addition:

BBA_J100065 Gaattcgcggccgcttctagagaaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaattactagagatacgactcactataggtaccggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggtaacaacaagatgctgagacctactagtagcggccgctgcag


Primers to Perform GGA to remove existing aptamer and insert desired aptamer:

For aptamer remover (27mer): GGTCTC A aaggtaacaacaagatgctg BSAI 1bp 20mer of RBS + spacer + GGA prefix


Rev aptamer remover (27mer): GGTCTC A ggtacctatagtgagtcgta BSAI 1bp 20mer of KpnI + Lac Operon


Meeting with Dr. Campbell about Primer design:

   Dr. Campbell and I decided that it was better to wait or ordering primers and G-blocks and plan out the design of the riboswitch more carefully. It seems that it is not possible to plug and chug different aptamers into a existing riboswtich but that each riboswitch must be designed methodically. 
   Out objective is to look at the original paper that characterized the theophylline aptamer and Topp et al (2010) that designed a riboswitch for the aptamer to see if we can rationally design a method to develop a riboswitch for any aptamer. 


We generated a few questions about how Zimmerman 1997 developed the original aptamer for theophylline and how Topp et al. (2010) designed a riboswitch for the aptamer: 1) What did Zimmerman do to characterize the apatamer? 2) How did Topp connect the aptamer with the riboswitch? 3) How did Topp get the RBS to fold up and hide in the aptamer? 4) Was the RBS random or specific for the aptamer?


   We decided that we could use M-fold to look at the structures of the riboswitches and see why certain designs failed to detect theophylline in Topp et al (2010). Therefore, we are going to try to meet with Dr. Heyer, who is an expert in M-fold to devise a plan. I am going to write Dr. Heyer and email and explain out objectives and send hr Topp et al and Zimmerman papers. Also, I will look to answer 1) Did Topp et al (2010) change the sequence of the previously characterized theophylline aptamer and 2) how did they determine which RBS to use for the theophylline riboswitch. 

cadoyle, 28 August 2013 (EDT)

   After meeting with Dr. Campbell yesterday 27 August 2013 we decided to write Dr. Heyer and email about getting together for a riboswitch design meeting. I was assigned to write Dr. Heyer and email explaining our goals and questions about rationally designing riboswitches for known aptamers. Below is the email I sent Dr. Heyer with attached PDFs. I am currently waiting Dr. Heyer's response.

Dr. Heyer,

Dr. Campbell and I would like to meet with you to talk about how we can look at the structures of riboswitches for theophylline and determine how they converted aptamers into riboswitches, in hopes to rationally design riboswitches for caffiene, 3-methylxanthine, and xanthine. By looking at the paper Topp et al (2010) we would like to compare and contrast the different riboswitches built and determine 1) how they were able to get the RBS to base pair with the theophylline aptamer and 2) why certain riboswitch structures did not work. We were thinking that we could utilize M-fold to help us understand the differences in the riboswitch designs and how they relate to the folding of the aptamer. In our meeting I will present information on whether 1) Topp et al (2010) changed the sequence of the previously characterized theophylline aptamer and 2) how they determined which RBS to use for the theophylline riboswitch. Attached are three PDF files 1) the Topp et al. (2010) 2) Supplemental for Topp et al (2010) with figures of the designed riboswitches (Becca Evans developed riboswitch D) and methods, and 3) Zimmerman et al. (1997), which originally characterized the theophylline aptamer. Please let us know some times when you are available so we can pick one that works for both of us.


Thanks,

Catherine


Lab Meeting Presentation on Aptamers and Riboswitches:


For Friday's lab meeting (08/30/2013) I am presenting the aims of my project. My main objective is to explain what an aptamer and riboswitch are and how we can use them to detect an unknown metabolite of caffeine.


Aptamer: An aptamer is short nucleic acid sequence that binds to a specific small molecule or ligand.


I found this great video that explained an aptamer as a dart aiming for a specific point on a target. "A Customized DNA dart" [[3]]


Riboswitch: A riboswitch is a regulatory segment of a messenger RNA molecule that binds to a small molecule, resulting in a change in production of the proteins encoded by the mRNA. Characteristics: -Translational control -Contains aptamer sequence -In 5’ untranslated region of mRNA


In my presentation I made two other slides: 1) showing the folding of the riboswitch with the aptamer from Topp et al (2010). 2) a graph showing how different riboswitches detect theophylline in E. coli.


Tomorrow I will finish up power point and post in lab notebook. I need to add what the goal of my project is and a few more diagrams to explain how riboswitches and aptamers interact.

cadoyle, 29 August 2013 (EDT)

My objective today is to finish lab presentation and practice the presentation.

I add a slide showing theophylline biosnythesis, caffeine metabolism, and caffeine derivatives with known aptamers.

I will present this final version tomorrow in lab meeting File:LabMeeting08/30/13


cadoyle, 30 August 2013 (EDT)