Difference between revisions of "Mike N"
Line 19: | Line 19: | ||
-'''Scaffold 03861'''' 3,400-5,800 | -'''Scaffold 03861'''' 3,400-5,800 | ||
− | Unfortunately, the scaffold | + | Unfortunately, the scaffold length is only 7,403bp long, so no adequate SSRs were detected and appropriate primers could not be found. |
== '''Gigantea (GI)''' == | == '''Gigantea (GI)''' == |
Revision as of 08:58, 15 March 2012
This is my page.
Contents
Crytochrome 1 (CRY1)
-Scaffold 000331 122,000-129,000
tc (X5) at 120,300 product size: 251bp forward primer: CATTTTGGGACAGAGGGAGTAG reverse primer: CAGTAACCAACATGCAAAAGGA
atc (X4) at 122,800 product size: 258bp forward primer: TCCAATACCACTTTCTTCACCC reverse primer: GATAATAGGGCAGAAGTTCCGA
-Scaffold 01561 18,500-23,800
-Scaffold 00649 28,300-28,600
Phytochrome A (PHYA)
-Scaffold 03861' 3,400-5,800
Unfortunately, the scaffold length is only 7,403bp long, so no adequate SSRs were detected and appropriate primers could not be found.
Gigantea (GI)
-Scaffold 00100 192,000-200,600
Cryptochrome 2 (CRY2)
-Scaffold 00649 16,000-30,000
-Scaffold 01561 20,000-21,000
Phytochrome B (PHYB)
-Scaffold 00751 84,000-89,200
aga (X8) at 81,900 product size: 265bp forward primer: CCCGAAAATACCCTTTCTCTCT reverse primer: GGCAATTACCAATTACGTGTCA
ag (X10) at 92,400 product size: 262bp forward primer: AAGAGGGGTAGACCAAAATTGA reverse primer: AATTTCACTCCAACCAAGAAGG
Constans (CO)
-Scaffold 01843 40,900-41,000
Constitutive Photomorphogenisis 1 (COP1)
-Scaffold 00752 17,000-24,800
ga (X6) at 14,800 product size: 277bp forward primer: CTCCAACTCTGAACTGATTCCC reverse primer: GAAACGCGTCCTTGATTATCTC
tta (X4) at 25,400 product size: 276bp forward primer: CGTACGAAGATTTGTTCAGCAG reverse primer: GCTACGCAAACATGATGACTTC
-Scaffold 00111 154,000-162,000
ct (X9) at 144,800 product size: 164bp forward primer: GTGGAAAATGTAAAGACACGCA reverse primer: AAAGCTTTCTAACCTCCGATCC
at (X5) at 165,400 product size: 300bp forward primer: CTTTCTTCCACTCAAGCCCTAA reverse primer: GAATCTTGTGCACCACACACTT
Cycling DOF Factor (CDF)
-Scaffold 00079 69,000-69,200
-Scaffold 00651 19,900-20,100
-Scaffold 01102 51,500-51,700
-Scaffold 00292 195,200-195,300
Apetala 1 (AP1)
-Scaffold 00988 71,100-71,200
Flowering Locus T (FT)
-Scaffold 00357 56,800-58,200
Leafy (LFY)
No ortholog could be found in Vaccinium when the Arabidopsis sequence was used as the query.