Difference between revisions of "Oligo design for XOR Hybrid Promoters"
| Line 191: | Line 191: | ||
This hybrid promoter uses the CI promoter as a repressor. The promoter region for LsrA is unaffected awhile CI is allowed to bind to the OR2 sites. The OR2 sites with CI bound do not allow transcription. The CI binding sites have a natural 6bp spacer. | This hybrid promoter uses the CI promoter as a repressor. The promoter region for LsrA is unaffected awhile CI is allowed to bind to the OR2 sites. The OR2 sites with CI bound do not allow transcription. The CI binding sites have a natural 6bp spacer. | ||
| − | 2xOR2 Repressor Primer Design | + | '''2xOR2 Repressor Primer Design''' |
| − | 2xOR2 Sequence | + | '''2xOR2 Sequence''' |
TAACACCGTGCGTGTTGATTTATCTAACACCGTGCGTGTTGA | TAACACCGTGCGTGTTGATTTATCTAACACCGTGCGTGTTGA | ||
| − | Forward Sequence | + | '''Forward Sequence''' |
TAACACCGTGCGTGTTGATTTATCTAAC | TAACACCGTGCGTGTTGATTTATCTAAC | ||
| − | Prefix | + | '''Prefix''' |
gcat gaattcgcggccgcttctagag | gcat gaattcgcggccgcttctagag | ||
| − | Forward Primer LsrAp | + | '''Forward Primer LsrAp''' |
gcat gaattcgcggccgcttctagag TAACACCGTGCGTGTTGATTTATCTAAC | gcat gaattcgcggccgcttctagag TAACACCGTGCGTGTTGATTTATCTAAC | ||
| − | Forward of Second Squence | + | '''Forward of Second Squence''' |
TTGATTTATCTAACACCGTGCGTGTTGA | TTGATTTATCTAACACCGTGCGTGTTGA | ||
| − | Reverse Complement of Second Squence | + | '''Reverse Complement of Second Squence''' |
TAACACCGTGCGTGTTGATTTATCTAAC | TAACACCGTGCGTGTTGATTTATCTAAC | ||
| − | Suffix | + | '''Suffix''' |
tactagtagcggccgctgcag | tactagtagcggccgctgcag | ||
| − | Suffix reverse complement | + | '''Suffix reverse complement''' |
gcat ctgcagcggccgctactagta | gcat ctgcagcggccgctactagta | ||
| − | Reverse Primer LsrAp | + | '''Reverse Primer LsrAp''' |
gcat ctgcagcggccgctactagta TCAACACGCTCGGTGTTAGATAAATCAA | gcat ctgcagcggccgctactagta TCAACACGCTCGGTGTTAGATAAATCAA | ||
Primers have a 15bp overlap for direct synthesis | Primers have a 15bp overlap for direct synthesis | ||
Revision as of 22:05, 17 June 2008
Oligo design for XOR Hybrid Promoters
Lux-cI hybrid promoter responsible:Xiao Zhu
“The effect of cI is dominant over LuxR.”(Ron Weiss, part description for R0065)
The first 2 designs are based on the same idea to replace the downstream of Lux/HSL -35 region with A). cI OR1 (containing -10 region); B). cI OR2, added LuxR-10 region. We hope that doing in this way could lead a stronger regulation for cI OR1/2. Based on what we have found up to now, promoters which are constructed just by inserting OR1/2 downstream of Lux are all very leaky. There’s a journal talking about a research that used Lux-cI hybrid promoter in their system. What they did is to insert cI OR1 upstream of Lux +1(they had a mutant for OR1 sequence), and it’s leaky (“In this case, even without AHL, leaky CI expression completely represses luxPRcI-OR1”).
Spatiotemporal control of gene expression with pulse-generating networks
Design C, to use OR2 twice, is because “it requires the binding of two cI repressor dimers for maximal repression”, but as BBa_R0065 has shown, if we put both OR2 and OR1 downstream of Lux, the promoter won’t work very well, it’s very leaky at high copy number. And we found that ETHZ iGEM’07 team were building these hybrid promoters as well. They used OR2 twice. We don’t know whether OR2 has any advantages over OR1 for functioning.
A.LuxR/HSL + OR1
Entire designed sequence:(101bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TACCTCTGGCGGTGATAA T GGTTGC TACTAGTAGC GGCCGCTGCA GGCAT 3’
Forward primer(57bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TACCTC3’
Reverse Primer(57bp)
5’ ATGCCTGCAG CGGCCGCTAC TAGTAGCAAC CATTATCACC GCCAGAGGTA CGTAAAC 3’
BBa_Prefix GCAT GAATTCGCGGCCGCTTCTAGAG
LuxR/HSL Box (only includes region upstream of -35 and the first T of -35) ACCTGTAGGA TCGTACAGG T
LuxR -35 TTTACG
cI Half-Operator OR1 TACCTCTGGCGGTGATAA
Lambda pR -10 GATAAT
Spacer (naturally come after lambda -10): GGTTGC
Suffix: TACTAGTAGCGGCCGCTGCAGGCAT
B.LuxR/HSL + OR2
Entire designed sequence:(108bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TAACACCGTG CGTGTTGA TATAGT CGAATAAA TACTAGTAGCGGCCGCTGCAGGCAT 3’
Forward Primer:(60bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG TAACACCGTG 3’
Reverse Primer:(60bp)
5’ ATGCCTGCAG CGGCCGCTAC TAGTATTTAT TCGACTATAT CAACACGCAC GGTGTTACGT 3’
BBa_Prefix GCAT GAATTCGCGGCCGCTTCTAGAG
LuxR/HSL Box (only includes region upstream of -35 and the first T of -35) ACCTGTAGGA TCGTACAGG T
LuxR -35 TTTACG
Lambda Half-Operator OR2 TAACACCGTG CGTGTTGA
LuxR -10 TATAGT (we use -10 region from LuxR in order to reduce the risk that LuxR -35 region won’t work well with -10 region from other sources.)
Spacer: (naturally come after LuxR -10) CGAATAAA
Suffix TACTAGTAGCGGCCGCTGCAGGCAT
C.LuxR/HSL + 2xOR2
Entire sequence:(140bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA TACTAGTAGCGGCCGCTGCAGGCAT 3’
Forward Primer:(76bp)
5’ GCAT GAATTCGCGGCCGCTTCTAGAG ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT TAA3’
Reverse Primer:(76bp)
5’ ATGCCTGCAG CGGCCGCTAC TAGTATCAAC ACGCACGGTG TTAGATAAAT CAACACGCAC GGTGTTAACT ATAACA 3’
BBa_Prefix GCAT GAATTCGCGGCCGCTTCTAGAG
Lux/HSL(the whole sequence, including -35 and -10) ACCTGTAGGA TCGTACAGG TTTACG CAAGAAAATG GTTTGTTATAGT
Lux -35: TTTACG
Lux -10: TATAGT
2xOR2 with 6 bp that naturally exist in Lambda promoter between OR2 and OR1: (we insert the 6 bp spacer backwards so as to break the cI -35 region) TAACACCGTG CGTGTTGA TTTATC TAACACCGTG CGTGTTGA
Suffix: TACTAGTAGCGGCCGCTGCAGGCAT
Mnt/LacI hybrid promoter responsible:Robert Cool
This promoter is a modified version of the Mnt promoter that is also responsive to LacI. The promoter should be repressed by Mnt repressor. It should also be repressed by LacI, and in the absence of Mnt repressor, should be induced by IPTG.
Design features: Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of a LacI binding site between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by LacI. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tgtgtggaattgtga, and 2) Position lacI binding site (composed of an inverted repeat) from the lacI regulated promoter (R0010) immediately 3’ to truncated mnt promoter.
Biobrick prefix gaattcgcggccgcttctagag
Mnt (everything before and including -10) ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt
LacI last 35bp (everything after -10) tgtgtggaattgtgagcggataacaatttcacacagagtcgtattaattt
Biobrick suffix tactagtagcggccgctgcag
Entire sequence 138bp
Gcat Gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tgtgtggaattgtgagcggataacaatttcacaca tactagtagcggccgctgcag atgc
Primers (78bp)
Forward gcatgaattcgcggccgcttctagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt
Reverse (reverse complement) gcatctgcagcggccgctactagtatgtgtgaaattgttatccgctcacaattccacacaactataggagatctaggt
Mnt/TetR hybrid promoter responsible:Robert Cool
This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc.
Design features: Mnt repressor binds as a tetramer to two half-operator sites (http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11226234 ). Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3’ to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta), but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3’ to truncated mnt -10 sequence.
Biobrick prefix gaattcgcggccgcttctagag
Mnt (everything before and including -10) ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt
tetR1 tccctatcagtgatagaga
Spacer actgta
TetR 2 binding site atccctatcagtgatagagat
Biobrick suffix tactagtagcggccgctgcag
Entire sequence 143bp
Gcat gaattcgcggccgcttctagag ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagt tccctatcagtgatagaga actgta atccctatcagtgatagagat tactagtagcggccgctgcag atgc
Primers (81bp)
Forward gcatctgcagcggccgctactagtaatctctatcactgatagggattacagttctctatcactgatagggaactataggag
Reverse (reverse complement) gcatctgcagcggccgctactagtaatctctatcactgatagggattctctatcactgatagggaactataggagatct
LsrA/CI hybrid promoter responsible: Andrew Gordon
This hybrid promoter uses the CI promoter as a repressor. The promoter region for LsrA is unaffected awhile CI is allowed to bind to the OR2 sites. The OR2 sites with CI bound do not allow transcription. The CI binding sites have a natural 6bp spacer.
2xOR2 Repressor Primer Design
2xOR2 Sequence
TAACACCGTGCGTGTTGATTTATCTAACACCGTGCGTGTTGA
Forward Sequence
TAACACCGTGCGTGTTGATTTATCTAAC
Prefix
gcat gaattcgcggccgcttctagag
Forward Primer LsrAp
gcat gaattcgcggccgcttctagag TAACACCGTGCGTGTTGATTTATCTAAC
Forward of Second Squence
TTGATTTATCTAACACCGTGCGTGTTGA
Reverse Complement of Second Squence
TAACACCGTGCGTGTTGATTTATCTAAC
Suffix
tactagtagcggccgctgcag
Suffix reverse complement
gcat ctgcagcggccgctactagta
Reverse Primer LsrAp
gcat ctgcagcggccgctactagta TCAACACGCTCGGTGTTAGATAAATCAA
Primers have a 15bp overlap for direct synthesis