Difference between revisions of "Davidson Projects with Updates"

From GcatWiki
Jump to: navigation, search
(Building LasR receiver '''TESTER''' cell)
(Building XOR Gate)
Line 110: Line 110:
 
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]
 
The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone ([http://partsregistry.org/3OC6HSL 3OC6HSL])}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented [http://www.bio.davidson.edu/courses/synthetic/papers/LuxR.pdf by Egland and Greenberg]
  
[[Oligos_to_Build]]: Sequences we will need to make this XOR gate.
+
'''Sequences we will need to make this XOR gate.''' <br>
 +
{| border="1" cellpadding="2"
 +
!width="50"|Part
 +
!width="50"|Oligos
 +
!width="50"|Oligo Design
 +
|-
 +
|lpLas'|| [[Image:pLasOligos.jpg]] || [[Image:pLas' oligos diagram.jpg]]
 +
|-
 +
|pLasXOR|| [[Image:pLasXOR Oligos.jpg]] || [[Image:pLasXOR.jpg]]
 +
|}
  
 
== Testing XOR Gate ==
 
== Testing XOR Gate ==

Revision as of 15:34, 25 June 2008

Building LuxI sender TESTER cell

R0011 (verified) + F1610 (not right part from registry)
Going after S03608 (pLac_RBS_LuxI) from 2007 registry
If we get this and verify, we are done with this. If not, we are in need of LuxI part.

Colonies from Registry Recovery? Gel Verification? Successful Ligation? Status of Testing the Device
S03608 Yes Not necessary

Building LuxR receiver TESTER cell

Part K09100 has been built.

Colonies from Registry Recovery? Gel Verification? Successful Ligation? Status of Testing the Device
K09100 Yes Yes Not necessary

Ready to test.

Building LuxS sender TESTER cell

Parts to be built
LacIpL (R0011) + RBS (B0034) + LuxS + TT

LuxS is the synthase protein for AI-2. This part is not available in the registry. The promoter and ribosome binding site were taken from the LuxI tester system.

Building LsrK/LsrR receiver TESTER cell

LsrKp + RBS + LsrK + TT

LsrRp + RBS + LsrR + reporter (GFP/RFP/YFP) + TT

LsrK needs to be constitutively expressed in order to receive the AI-2 signal. LsrR acts as its own repressor, so the reporter should not be activated until the AI-2 signal is received. Once LsrR binds to AI-2 molecule, the LsrR gene is activated and the positive feedback loop is initiated, which also turns on the reporter gene.

Building LasI sender TESTER cell

R0011+ S03154.

Colonies from Registry Recovery? Gel Verification? Successful Ligation? Status of Testing the Device
R0011 Yes Yes
S03154 Yes Yes

Building LasR receiver TESTER cell

Ligatiion 1A S03156 + B0015
Ligation 1B R0079 + E0240
Ligation 1C B0015 + R0079

Ligation 2: Successful Ligation 1A + unccessful Ligation 1B
Ligation 3: Successful Ligation 2 + R0011

Colonies from Registry Recovery? Gel Verification? Successful Ligation? Status of Testing the Device
S03156 Yes Yes
B0015 Yes Yes
R0079 Yes Yes
E0240 Yes Yes
R0011 Yes Yes

Testing Crosstalk between Lux and Las

1) Mix LuxI sender cells with LasR receiver tester cells: negative control
2) Mix LasI sender cells with LuxR receiver tester cells: negative control
3) Mix LuxI sender cells with LuxR receiver tester cells: experiment we hope will glow green
4) Mix LasI sender cells with LasR receiver tester cells: experiment we hope will glow green
5) Verify LuxR receiver tester cells don't glow solo
6) Verify LasR receiver tester cells don't glow solo

AND gate using pTetLac promoter

We have successfully built the pTetLac AND promoter: K091101.
This is sequence verified.
Now we need the various LacI proteins (I12, X86 and I12+X86 variants).
We need tetR repressor protein. We have tried to get it from the paper registry.
We need to see if this AND gate works as designed.
We need to test output to see if the two halves are balanced.

Building XOR Gate

List of auto-inducers and their catalog numbers.

Davidson Approach

Here is an idea Malcolm and Laurie developed.

Everyone please look at this and ask questions and find holes in it now so we don't waste time building something that won't work.
Error creating thumbnail: Unable to save thumbnail to destination

The idea is to have two mirrored halves of the system. LasR is regulated by PAI-1 {3-oxododecanoyl-HSL (3OC12HSL)} and LuxR is activated by AI-1 {3-oxohexanoyl-homoserine lactone (3OC6HSL)}. There is a potential problem in that the Lux half is more likely to get positive feedback than the Las half. This MAY not be a problem because 0/0 is leaky so we put a weak RBS to minimize leaky protein production. Also, if we add AI-2 and AI-1 is produced by leak, then the entire system shuts down. The repressor site is located between -35 and -10 of the promoter. The activator binding site is upstream of -35. This has been documented by Egland and Greenberg

Sequences we will need to make this XOR gate.

Part Oligos Oligo Design
lpLas'
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
pLasXOR
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination

Testing XOR Gate

We will need to have constitutive LasR and LuxR made in these cells.
Then we will need to hit them with the two chemicals AHL types and commercial sources.

Making Better pLac promoter and LacI proteins

LacI wild-type gene sequence (ORF begins at the first amino acid) ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI_I12 Mutation (amino acid 3 is changed from CCA to TAT)
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI_X86 Mutation (amino acid 61 is changed from TCG to CTG)
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI_I12_X86 Mutation
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA

LacI Promoter
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG

LacIQ Promoter
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG

LacIQ1 Promoter
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG

-These promoter sequences are taken from Glascock and Weickert 1998

Part Forward Reverse
lacIQ1 Promoter
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
lacIQ Promoter
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
LacI_I12
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
LacI
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
LacI_X86 (Primers for step 1 of PCR)
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
LacI_I12X86 (Primers for step 1 of PCR)
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
### ### ###