Golden Gate Assembly protocol

From GcatWiki
Revision as of 13:21, 8 August 2012 by Macampbell (talk | contribs) (→‎Protocol Details for GGA)
Jump to: navigation, search
Protocol to insert new promoter made into pSB1A2 that contains BBa_J119044


Starting with Boiled then Cooled Oligos

Go to the Loligator web page to determine how to prepare your oligos to add to the solution described below.

If you don't have time to ethanol precipitate and quantify your DNA, you can use this shortcut:

  • 1 µL cooled oligos.
  • 99 µL water to make a 100X dilution.
  • Use 1 µL of the 100X diluted oligos and add to the 9 µL described below.


Starting wtih Promoter already cloned in a Plasmid

You can start with BBa_J119022 which contains a promoter that is flanked by BsaI sites. Use 50 ng of this plasmid for your "insert" DNA to be added to the ligation mixture listed below.

Protocol Details for GGA

  1. Get two new, small microfuge tubes designed to fit into the PCR machine.
  2. One tube will be labeled "ligation", the other "plasmid only". Also put your initials on the tubes.
  3. 1 µL diluted oligos cooled overnight (use water instead for "plasmid only" tube). If you are using BBa_J119022, use 50 ng in 1 µL volume.
  4. 9 µL ligations mixture provided by your instructor.
  5. Use the promoter DNA for the ligation tube but use only water for the plasmid only tube.

Ligation mixture contains:
1 µL (50 ng) plasmid containing part J119044
5 µL dH2O
1 µL 10X Promega Ligase Buffer
1 µL 500 mM KOAc
0.5 µL Bsa I high fidelity (HF) restriction enzyme
0.5 µL T4 DNA Ligase
9 µL final volume

Turn on the PCR machine. Put both of your tubes into the machine.
Program it for the following cylces:

  • 20 cycles of 37C for 1 minute/16C for 1 minute
  • 1 cycle of 37C for 15 minutes
  • 22C holding temperature

This DNA ligation is ready for transformation.

You can increase the cycles to 30 if you want to increase yield. However, we have gotten good success with as few as 5 cycles.

Transformations after GGA

You want to do 3 transformations:

  1. a positive control that contains known promoter + RBS + RFP to be used for comparison RFP expression.
  2. your experimental ligation
  3. your negative control ligation

Use all 10 µL of the ligations for a transformation.
You will want to perform a transformation positive control using K315008 which contains pLacI+RBS+RFP in plasmid pSB1A2.

Use between 20 - 50 µL of Zippy competent cells into each of three 1.5 mL tubes labeled appropriately for each of the three transformations listed above. Plate all three transformations on LB amp plates.

PCR Verification of Successful GGA

If you want to PCR verify that GGA has happened, you can use colony PCR and analyze the product by gel electrophoresis (1.7% agarose gel).

  1. Use negative control colonies as template to see the MW of the PCR product when TT is still in the plasmid and no GGA has occurred. Run one lane of this negative control PCR product for each row on your gel.
  2. Use these two primers:
  • Forward = 5’ GAATTCGCGGCCGCTTCTAG 3’
  • Reverse = 5’ TTTGATAACATCTTCGGAGG 3’
  • PCR product with the original TT still in place is 251 bp
  • size of TT that should be removed by GGA is 107 bp


This protocols was developed at MWSU by Dr. Todd Eckdahl, and modified at Davidson College by Annie Wacker and Malcolm Campbell.