Catherinel Notebook1

Back to Main Page of Catherine's Notebook

cadoyle, 25 August 2013

I meet with Dr. Campbell on Wednesday, 21st of August 2013. We discussed finishing up my thesis proposal by adding in the aptamer sequences for caffeine and 3-methylxanthine that I will be designing riboswitches for.

I found caffeine's aptamer from Alpha Diagnostic Intl. Inc [[1]]. I downloaded the paper: File:Ferguson et al. 2004.pdf that characterized the aptamer and obtained the sequence. On Alpha Diagnostic Int. Inc website there is a product data sheet for the caffeine aptamer that will be useful [[2]].

I found the apatmer for 3-methylxanthine from File:Soukop et al. (2000).pdf. I found this paper while I was doing research for my proposal. I read in File:Lee et al. (2010).pdf that the 3-methylxanthien aptamer had been discovered from a mutation in the theophylline aptamer. Lee et al. (2010) cited Soukop et al. (2000) for the characterization of the 3-methylxanthine aptamer. In Soukop et al. (2000) they list two aptamers for 3-methylxanthine. I picked the aptamer with C22 mutation only because it had a stronger affinity for 3-methlyxanthine (Figure 2C) despite Figure 1B showing that it's specificity for 3-methylxanthine is low.

Name	Sequence	Reference
Caffeine	5-GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGGAUCAUCGGACUUUGUCCUGUGGAGUAAGAUCG CGAAACGGUGAAAGCCGUAGGUCU-3	Ferguson et al. (2004)
3-methlyxanthine	5- AUACCAGCCGAAAGGCCAUUGGCAG-3	Soukop et al. (2000)

I find it interesting and concerning that the aptamer for 3-methylxanthine is so short. Maybe the hammerhead ribozyme needs to be added to the sequence. I will check with Dr. Campbell about it.

Also, in my meeting with Dr. Campbell we talked about comparing the structure of theophylline aptamer in Riboswitch D from File:Topp et al. (2010).pdf to the structures of the caffeine aptamer and 3-methylxanthien aptamer in Riboswitch D. M-fold is a web based software that predicts secondary structures of DNA and RNA, which we can use to compare the structures of the aptamers to see if Riboswitch D will work for the other three aptamers.

I read the paper characterizing the software program File:Zuker(2003).pdf to understand what the input and output values mean for the program.

Information on interpreting output results:

Energy dot plot In the upper triangular region, a dot in row i and column j represents a base pair between the ith and jth bases. The dots represent the superposition of all possible foldings within p% of ΔGmfe, the minimum free energy, where p is the maximium percent deviation from ΔGmfe. Different colors are used to indicate varying levels of suboptimality. The number of colors ranges from two to eight (the default). If n colors are used, the first color indicates base pairs in optimal foldings. These base pairs are also plotted in the lower left triangle (reversing row and column) for emphasis. The remaining n-1 colors are used for base pairs in suboptimal foldings. If ΔGi.j is the minimum of the free energies of all possible structures containing base pair i.j, and if ΔGmfe+(k-2)pΔG/(n-1) < ΔGi.j ≤ ΔGmfe+(k-1)pΔG/(n-1), then color k is used for base pair i.j, for 2 ≤ k ≤ n. When n is 8 (the default), the optimal base pairs are colored in red and black colors base pairs that are least likely to form. M-Fold Characterization of the Theophylline, Caffiene, and 3-Methylxanthine Aptamers

M-Fold Characterization of the Theophylline, Caffiene, and 3-Methylxanthine Aptamers

M-Fold Server Input (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form):

I used the RNA Folding Form with no constraints. I kept the default values. I selected immediate job since the sequence is short. Also, I kept the default values for output.

File:Defaultvaluesinput.jg

Default values for user input describing folding conditions.

Default values for user input describing output conditions.

Theophylline Results: Theophylline Sequence:

Sequence output with number of nucleotide bases, max folds, for window size 5. Window size is determined by program based on sequence length.

Energy Diagram. The optimal energy for optimal folding in -71.8kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.

Curricular structural plots.

Caffeine Results: Caffeine Sequence:

Sequence output with number of nucleotide bases, max folds, for window size 3. Window size is determined by program based on sequence length.

Energy Diagram. The optimal energy for optimal folding in -25.6kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.

Curricular structural plots.

3-Methlyxanthine Results: 3-Methlyxanthine Sequence:

Sequence output with number of nucleotide bases, max folds, for window size 0. Window size id determined by program based on sequence length.

Energy Diagram. The optimal energy for optimal folding in -8.9kcal/mol. I,j, k, which define the helix are plotted in integer units of kcal/mol.

Curricular structural plots.

I put all the structures of the three aptamers together so we can compare their structures.

Conclusion: None of the aptamers are similar in structure. The second structure of caffeine is slightly similar to the second structure of theophylline. 3-Methylxanthine looks very odd and very different from the rest of the apatmers. I am going to send this information to Dr. Heyer to see if she can help us explain the results.

cadoyle, 26 August 2013

My objective for today is to start designing a method to build riboswitches for caffeine and 3-methlyxanthine.

I can build the riboswitches using Golden Gate Assembly (GGA). Adapting riboswitch D for theophylline from Topp et al. (2010) modified by Becca in the lab during the summer of 2012, I can build riboswitches for the new aptamers.

I looked at Becca's power point and designed a protocol for making a new riboswitch from scratch using GGA.

Outline: 1) Get each part including destination plasmid 2) Perform iPCR on each part 3) Perform GGA 4) Sequence Verify 5) Test

I have a few questions about the method I generated to ask Dr. Campbell: 1) What vector should the riboswitches be cloned into? 2) How do we get the sequence of the aptamer cloned?

Meeting with Dr. Campbell about method to design riboswitches:

The way I had designed the protocol for riboswitch design still utilizes the old method of cloning and PCR. There is no reason to start from scratch to build the riboswtich. We can design primers for anywhere on the existing riboswitch for theophylline and remove the aptamer and replace it with any aptamer we like. We can clone the aptamer upstream of the RBS and screen by size to see if the aptamer is the correct position. Dr. Campbell said that any vector ending in an 8 will work because it has the BSAI removed for GGA.

Therefore, we need to the apatmers sequences for caffeine and 3-methylxanthine to be synthesized. IDT has a product called g-blocks where you can a sequence synthesized but not cloned cheaply. I will pull the aptamer sequences together and send to Dr. Campbell.

What I need to do to move forward: 1) Get sequences to Dr. Campbell for production of G-blocks 2) Design primers to insert aptamers into theophylline riboswitch 3) Design primers to remove theophllyine aptamer 4) I need to send to Dr. Campbell Lee et al. (2010) which I believe contains information on how the location of an RBS effects the affinity of a riboswitch for a metabolite.

I submitted my Thesis Proposal today and should know by Friday if it was approved. Click here to download File:DoyleThesisProposal.doc

cadoyle, 27 August 2013

My objective today is to gather sequences for making G-blocks and design primers to insert the aptamer G-blocks into the existing riboswitch for theophylline.

I emailed Dr. Campbell the Lee et al (2010) paper and he said we needed reference 20 for the theophylline aptamer. Reference 20 is Soukop et al (2000). Relooking at this paper we noticed that there are two aptamers for 3-methylxanthine. From the data it seems that the 3-methylxanthine aptamer with only a C22 has a higher affinity for 3-methylxanthien despite low specificity overall. We decided that it would be better to test both as we are unsure how either will operate in our riboswitch. Therefore, we will have two aptamers for 3-methlyxanthine and 1 for caffeine.

Below is the G-block information and primer design for caffeine, 3-methlyxanthine, and the theophylline riboswitch:

Riboswitch Designs:

Caffeine:

Aptamer Sequence (99mer): ‘5-GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGGAUCAUCGGACUUUGUCCUGUGGAGUAAGAUCG CGAAACGGUGAAAGCCGUAGGUCU-3'

Primers to add BSAI:

Caffeine Aptamer For (27mer): GGTCTC A GGAUGUCCAGUCGCUUGCAA BSAI 1bp 20mer of caffeine aptamer

Caffeine Aptamer Rev (27mer): GGTCTC A UGUCCTUCGGCTTTCUCCGT BSAI 1bp 20mer of caffeine apatmer

3-methlyxanthine:

Aptamer sequence (25mer): 5- AUACCAGCCGAAAGGCCAUUGGCAG-3

Primers to add BSAI:

3-MethylC22 Aptamer For (20mer): GGTCTC A AUACCAGCCGAAA BSAI 1bp 13mer of 3-methylxanthine

3-MethylC22 Aptamer Rev (19mer): GGTCTC A CTGCCUUTGGCC BSAI 1bp 12mer of 3-methylxanthine

3-Methylxanthine Protoypic Aptamer Sequence: 5’-AUACCAAGC-GAAAGGCCAUUGGAAG-3’

3-Methylprototypic Aptamer For (20mer): GGTCTC A AUACCAAGC-GAA BSAI 1bp 13mer of 3-methylxanthine

3-Methylprototypic Aptamer Rev (19mer): GGTCTC A CTTCCUUTGGCCT BSAI 1bp 12mer of 3-methylxanthine

Theophylline: ‘5-ggtgataccagcatcgtcttgatgcccttggcagcaccctgct-3’

Theophylline Aptamer For (27mer): GGTCTC A ggtgataccagcatcgtctt BSAI 1bp 20mer of caffeine aptamer

Theophylline Aptamer Rev (27mer): GGTCTC A agcagggtgctgccaagggc BSAI 1bp 20mer of caffeine apatmer

Riboswitch Addition:

BBA_J100065 Gaattcgcggccgcttctagagaaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaattactagagatacgactcactataggtaccggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggtaacaacaagatgctgagacctactagtagcggccgctgcag

Primers to Perform GGA to remove existing aptamer and insert desired aptamer:

For aptamer remover (27mer): GGTCTC A aaggtaacaacaagatgctg BSAI 1bp 20mer of RBS + spacer + GGA prefix

Rev aptamer remover (27mer): GGTCTC A ggtacctatagtgagtcgta BSAI 1bp 20mer of KpnI + Lac Operon

Meeting with Dr. Campbell about Primer design:

Dr. Campbell and I decided that it was better to wait on ordering primers and G-blocks and plan out the design of the riboswitch more carefully. It seems that it is not possible to plug and chug different aptamers into an existing riboswtich but that each riboswitch must be designed methodically.

Our objective is to look at the original paper that characterized the theophylline aptamer and Topp et al (2010) that designed a riboswitch for the aptamer to see if we can rationally design a method to develop a riboswitch for any aptamer.

We generated a few questions about how Zimmerman (1997) developed the original aptamer for theophylline and how Topp et al. (2010) designed a riboswitch for the aptamer: 1) What did Zimmerman do to characterize the apatamer? 2) How did Topp connect the aptamer with the riboswitch? 3) How did Topp get the RBS to fold up and hide in the aptamer? 4) Was the RBS random or specific for the aptamer?

We decided that we could use M-fold to look at the structures of the riboswitches and see why certain designs failed to detect theophylline in Topp et al (2010). Therefore, we are going to try to meet with Dr. Heyer, who is an expert in M-fold to devise a plan. I am going to write Dr. Heyer and email and explain out objectives and send her Topp et al and Zimmerman papers. Also, I will look to answer the following questions 1) Did Topp et al (2010) change the sequence of the previously characterized theophylline aptamer and 2) how did they determine which RBS to use for the theophylline riboswitch.

cadoyle, 28 August 2013

After meeting with Dr. Campbell yesterday 27 August 2013 we decided to write Dr. Heyer and email about getting together for a riboswitch design meeting. I was assigned to write Dr. Heyer and email explaining our goals and questions about rationally designing riboswitches for known aptamers. Below is the email I sent Dr. Heyer with attached PDFs. I am currently waiting Dr. Heyer's response.

Dr. Heyer,

Dr. Campbell and I would like to meet with you to talk about how we can look at the structures of riboswitches for theophylline and determine how they converted aptamers into riboswitches, in hopes to rationally design riboswitches for caffiene, 3-methylxanthine, and xanthine. By looking at the paper Topp et al (2010) we would like to compare and contrast the different riboswitches built and determine 1) how they were able to get the RBS to base pair with the theophylline aptamer and 2) why certain riboswitch structures did not work. We were thinking that we could utilize M-fold to help us understand the differences in the riboswitch designs and how they relate to the folding of the aptamer. In our meeting I will present information on whether 1) Topp et al (2010) changed the sequence of the previously characterized theophylline aptamer and 2) how they determined which RBS to use for the theophylline riboswitch. Attached are three PDF files 1) the Topp et al. (2010) 2) Supplemental for Topp et al (2010) with figures of the designed riboswitches (Becca Evans developed riboswitch D) and methods, and 3) Zimmerman et al. (1997), which originally characterized the theophylline aptamer. Please let us know some times when you are available so we can pick one that works for both of us.

Thanks,

Catherine

Lab Meeting Presentation on Aptamers and Riboswitches:

For Friday's lab meeting (08/30/2013) I am presenting the aims of my project. My main objective is to explain what an aptamer and riboswitch are and how we can use them to detect an unknown metabolite of caffeine.

Aptamer: An aptamer is short nucleic acid sequence that binds to a specific small molecule or ligand.

I found this great video that explained an aptamer as a dart aiming for a specific point on a target. "A Customized DNA dart" [[3]]

Riboswitch: A riboswitch is a regulatory segment of a messenger RNA molecule that binds to a small molecule, resulting in a change in production of the proteins encoded by the mRNA. Characteristics: -Translational control -Contains aptamer sequence -In 5’ untranslated region of mRNA

In my presentation I made two other slides: 1) showing the folding of the riboswitch with the aptamer from Topp et al (2010). 2) a graph showing how different riboswitches detect theophylline in E. coli.

Tomorrow I will finish up power point and post in the lab notebook. I need to add what the goal of my project is and a few more diagrams to explain how riboswitches and aptamers interact.

cadoyle, 29 August 2013

My objective today is to finish lab the presentation and practice the presentation.

I added a slide showing theophylline biosynthesis, caffeine metabolism, and caffeine derivatives with known aptamers.

I will present this final version tomorrow in lab meeting File:LabMeeting08-30-13.pptx

cadoyle, 1 September 2013

My objective today is to read Topp et al. 2010 and Zimmeran 1998 paper to see if I can determine where Topp et al got the RBS used in their riboswitches and if they mutated the aptamer sequence for theophylline.

After Reading Topp et al (2010) and Zimmerman (1998) I found out a few things: 1. The riboswitches tested were generated using a combination of rational design and in vivo screening. 2. Before they started there had already been published theophylline synthetic riboswitches by Lynch et al. (2007). 3. They made a library of random parts and through high-put screening found the riboswitch that optimized the detection of E.coli. 4. The aptamer was not from Zimmerman 1998 but from Zimmeran 2000. It was not mutated. 5. I am still not sure how they choose the RBS but they mention it is important for it to base pair with aptamer 5. Randomized sequences truley are random. 6. Shorter spacing between the RBS and start codon increased specificity. Supplemental Table 1.

I am going read two papers by Lynch describing screening protocol and generation of random sequences. Also, I am going to read the paper by Topp and Galivan (2008) that describes a screening method for the riboswithces once you have candidates.

Notes from Lynch et al. (2007): - Lynch uses cassette-based PCR mutagenesis to create 5 different libraries where the distance between the aptamer and the RBS were varied between 4 to 8 bases and the sequence was radonmized fully. It had been shown earlier that longer or shorter spacing resulted in poorly functioning riboswitches.

-Once they had the libraries they tested them using a Miller assay. To be considered a good riboswitch they had to meet four requirments:

(1) showed an activation ratio of greater than 2.0 in two separate determinations (2) displayed a mini- mum level of b-galactosidase activity in the presence of theophylline (an OD420 R 0.04 in the Miller assay, regard- less of cell density) (3) grew normally relative to others in the plate (as represented by OD600) (4) showed con- sistent results between the two plates. This simple analy- sis significantly reduced the number of potential candi- dates, of which greater than 90% were confirmed as functional synthetic riboswitches when assayed individu- ally in larger volumes of culture

- the pairing region between the aptamer and the ribosome binding site is important for riboswitch function.

Need to read paper on how lynch made the riboswitch (Desaia and Gallivan, 2004).

cadoyle, 2 September 2013

My Objective today is to read the original paper that characterized the theophylline riboswitch and make a presentation on how the riboswitche evolved to give to Dr. Campbell and Dr. Heyer tomorrow in our meeting.

Notes: Desaia and Gallivan, 2004: 1. This the first paper published on the theophylline riboswitch 2. Their original design started with trying to insert the mTCT8-4 theophylline aptamer from Zimmerman (2000) 5 bp upstream of the RBS in the 5' untranslated region. 3. The reporter gene used was B-gal 4. The RBS used was Shine-Dalgarno sequence: AGGAGGU 5. To insert the aptamer into the 5' untranslated region they used a primer containing a Kpn1 site, the aptamer, 5bp randomized sequence, and 35 bp overhand of the RBS. 6. To test their riboswitch they transformed the riboswitched into E.coli than plated the cells on media containing theophylline, caffeine, or no small molecule. The riboswitch was more responsive to theophylline but did respond to caffeine. 7. The paper does not tell how but they realized that having the ribsowtch 8bp upstream of the RBS increased the riboswtich specificity.

Notes Lynch et al., 2007: 1. After Desaia and Gallivan published their paper Lynch et al looked to improve teh specificty of the ribsowtch and see if they could understand why the riboswitch published by Desaia and Gallivan worked. 2. In the riboswitch by Desaia and Gallivan there is a section of randomized bases. Lynch wanted to see how important these bases are. 3. They used cassette-based PCR mutagenesis to create 5 different libraries in which the distance between the RBS and aptamer varied between 4 and 8 bases and the sequence was completely randomized. 4. Then they performed a high-through put assay where they plated colonies that grew white on X-gal media with no theophylline in cultures o/n containing theophylline. 5. They found two clones that had high B-gal expression in a culture supplemented with theophylline. 6. Both these clones contained the aptamer 8bp upstream of the RBS like Desaia and Gallivan had seen. 7. They also realized that when they used M-fold (They have methods on how they used it) that the RBS base paired with the aptamer and the randomized sequence making the switch in a "off" state. 8. This showed that the RBS being able to bind to the aptamer and their being 8 bp between the RBS and aptamer essential to a functional riboswitch.

Notes: Topp et al. 2010: 1. Now rereading Topp et al. I understand how they came to the design of the final theophylline riboswitch 2. The paper wanted to see if mutating the RBS to make it base pair with the aptamer would increase its affinity. 3. They found that two switches worked best and those switches had more bp to the RBs

Questions: 1) can you mutate a RBS and it still function? 2) should we use the same RBS? 3) Don't mention why they choose that RBS?

Link to my ppt presentation with figures and data from the papers. File:Riboswitch History.pptx

All the papers I read and used for the Riboswitch History ppt are: File:Desai dissertation.pdf File:Desaia and Galivan Supp.pdf File:DesaiandGallivan(2004).pdf File:Lynchetal.pdf File:Supp Topp(2010).doc File:Topp dissertation.pdf File:Topp(2010.pdf) File:ToppandGallivan.pdf File:Zimmerman1997.pdf File:Zimmerman2000.pdf

cadoyle, 3 September 2013

Today I met with Dr. Campbell and Dr. Heyer and presented my ppt on the Riboswitch History.

Notes from meeting: 1. Dr. Campbell had an idea that we could feed the cells xanthine or 3-methlyxanthine and overload the cells so they will stop theoretically producing xanthine or 3-methylxanthine and go ahead and produce theophylline. It would stop the de-methylation process. 2. After going over the ppr it seems that we can predict the free energy of each aptamer using m-fold. Lynch et al did this to show the on and off switch of the riboswitch for theophylline. 3. There has to be 8 bases between the RBS and aptamer. 4. D riboswitch had 1/2 the base pairing with aptamer than riboswitch E maybe. The specificty of E is greater by it off is not very off. Maybe if we have 5,6, or 7 base pairing the riboswitch would work better.

Plan of action: 1. Verify the results of Lynch et al. using M-fold to see the free energy calculations are correct 2. Design a program that can randomize the 8 bp spacer between the RBS and aptamer creating 65,00 combinations needed for each aptamer. We can run the sequences through M-fold and using the free energy of each known aptamer predict which riboswitch will work. Then we can it synthesized and start testing. 3. In the mean time I will feed the cells xanthine and 3-methylxanthine and see if we get theophylline to be produced. 4. Also, as a back up there is an riboswitch that can detect 3-methlyxanthien and theophylline and we can use it see if 3-methylxanthine is present.

Tomorrow I will verify Lynch et al. results on M-fold and start writing the pseudo code.

cadoyle, 4 September 2013

My objective today is to run the riboswitches designed by Lynch et al through M-fold to verify the change in free energy they viewed with the riboswitches 8.1 and 8.2 depending on the random bases in the 8bp spacer.

Predicted folding structure of riboswitches 8.1 and 8.2

Computational RNA Folding Protocol Secondary structures of riboswitches were determined using the RNA mFold web server (http://www.bioinfo.rpi.edu/applications/mfold/rna/form1.cgi). Sequences stretching from 5’’- end of the theophylline aptamer to 3’’-end of the AUG start codon of riboswitches 8.1 and 8.2 were entered and secondary structures were calculated without constraints at 37C with 50% suboptimality.

I confirmed Lynch et al. (2007) results. M-fold yielded 9 and 8 structures respectively. Extending the sequences of 8.1 and 8.2 to the transcription start site increased the number of suboptimal folds, but did not change the structure of the lowest-energy fold. See below for results and figures.

Results for 8.1 Riboswitch:

Inputted sequence:

Results for 8.2 Riboswitch:

Inputted sequence:

File:8.2 seq.jpg

Now that we know that the Lynch et al (2007) protocol works I can start writing the code to randomize the sequences and determine the free energy of different riboswitch designs. The free energy needs to be less than the energy of aptamer ensuring binding of the aptamer to the small molecule.

cadoyle, 4 September 2013

My objective today to is write pseudo code for the program that will determine the free energy of the different riboswitches by randomizing the 8 bp spacer. This will allow us to test 65,000 combinations and pick the optimal ones for testing in the lab.

See below for diagram of how the code will operate