Blasting Spacers for Our Genome
From GcatWiki
(Difference between revisions)
| Revision as of 17:37, 3 November 2009 Karicheson (Talk | contribs) ← Previous diff |
Revision as of 17:38, 3 November 2009 Karicheson (Talk | contribs) Blasting Spacers Next diff → |
||
| Line 2: | Line 2: | ||
| CRISPR one results from CRISPR finder are shown below. I blasted all of the spacers using the nr/nb database and the results are shown below. | CRISPR one results from CRISPR finder are shown below. I blasted all of the spacers using the nr/nb database and the results are shown below. | ||
| + | |||
| [[Image:crisperOne.jpg]] | [[Image:crisperOne.jpg]] | ||
| + | |||
| + | |||
| + | Spacer One: TGCGTCGTCCGGTGGCCGTCAATAAATGTCGCAAGGG | ||
| + | [[Image:spacerOne.jpg]] | ||
Revision as of 17:38, 3 November 2009
Blasting Spacers
CRISPR one results from CRISPR finder are shown below. I blasted all of the spacers using the nr/nb database and the results are shown below.



