Revision history of "J-GGA Promoter Sequence for Scaffold 2.0"

From GcatWiki
Jump to: navigation, search

Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

  • (cur | prev) 17:08, 30 July 2013‎ Spolpitiyaarachchige (talk | contribs)‎ . . (347 bytes) (+347)‎ . . (Created page with "Promoter for scaffold 2.0 P5 highest J119031 BBa_J119031 Part-only sequence (36 bp) TTGACAATTAATCATCCGGCTCGTAATTTATGTGGA Oligos to be Ordered P5_top;GACCTTGACAATTAATCA...")
Retrieved from "https://gcat.davidson.edu/GcatWiki/index.php?title=J-GGA_Promoter_Sequence_for_Scaffold_2.0"