Revision history of "J-GGA Scaffold 2.0 Primer"

From GcatWiki
Jump to: navigation, search

Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

  • (cur | prev) 17:06, 30 July 2013‎ Spolpitiyaarachchige (talk | contribs)‎ . . (421 bytes) (+421)‎ . . (Created page with "Scaffold 2.0 Primers JunctionA_forward; GCATGGTCTCTCCGTATACACAGAGGACC JunctionA_reverse; GCATGGTCTCTGGTCCTCTGTGTATACGG JunctionB_forward; GCATGGTCTCTTGGGTCTTGAACCAGGAG Ju...")
Retrieved from "https://gcat.davidson.edu/GcatWiki/index.php?title=J-GGA_Scaffold_2.0_Primer"