Revision history of "J-GGA Scaffold Primer"

From GcatWiki
Jump to: navigation, search

Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

  • (cur | prev) 15:43, 11 June 2013Spolpitiyaarachchige (talk | contribs). . (360 bytes) (+360). . (Created page with "PRIMERS TO BE USED FOR INVERTED PCR OF SCAFFOLD J-GGA_A_rev (29 nt) GCATGGTCTCAGCACCATGAACAGACTAT J-GGA_B_for (29 nt) CCAGGGTCTCTGGCTGATGTAGTTAAGGC J-GGA_B_rev (29 nt) ...")