Difference between revisions of "Missing tRNA-trp gene found"
(5 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
'''tRNA-trp-CCA:'''<br> | '''tRNA-trp-CCA:'''<br> | ||
+ | <br> | ||
DNA Coordinates: 465601..465777 (-)<br> | DNA Coordinates: 465601..465777 (-)<br> | ||
<br> | <br> | ||
− | + | '''GGGGTCGTGGCCAAGTCCGGCATGGCGACTGACTCCAG'''AGGCACCGCGCCCGGGACGACACTCCAG<br> | |
ACTGATATACTGAGCGACCGGCTGATCACCGGACGCCTTGATGACCCTCTGGAGTTCCGAGGCGCA<br> | ACTGATATACTGAGCGACCGGCTGATCACCGGACGCCTTGATGACCCTCTGGAGTTCCGAGGCGCA<br> | ||
− | + | ACCGGAGAT'''ATCAGTCGATCGGGAGTTCAAATCTCTCCGACCCCA'''<br> | |
+ | <br> | ||
+ | 5' exon: 38 bp, position 1-38<br> | ||
+ | intron: 102 bp, position 39-140<br> | ||
+ | 3' exon: 36 bp, position 141-176<br> | ||
<br> | <br> | ||
Evidence:<br> | Evidence:<br> | ||
Line 23: | Line 28: | ||
Score = 163 bits (82), Expect = 4e-41<br> | Score = 163 bits (82), Expect = 4e-41<br> | ||
Identities = 159/181 (87%), Gaps = 4/181 (2%)<br> | Identities = 159/181 (87%), Gaps = 4/181 (2%)<br> | ||
+ | <br> | ||
+ | [http://www.jbc.org/cgi/content/abstract/263/34/17951]: "A tRNA-trp Intron Endonuclease from ''Halobacterium volcanii''"<br> | ||
+ | (I was unable to upload the .pdf for this paper, you can download it at this site) |
Latest revision as of 00:37, 14 October 2008
tRNA-trp-CCA:
DNA Coordinates: 465601..465777 (-)
GGGGTCGTGGCCAAGTCCGGCATGGCGACTGACTCCAGAGGCACCGCGCCCGGGACGACACTCCAG
ACTGATATACTGAGCGACCGGCTGATCACCGGACGCCTTGATGACCCTCTGGAGTTCCGAGGCGCA
ACCGGAGATATCAGTCGATCGGGAGTTCAAATCTCTCCGACCCCA
5' exon: 38 bp, position 1-38
intron: 102 bp, position 39-140
3' exon: 36 bp, position 141-176
Evidence:
Similarity with Haloferax volcanii tRNA-trp
Score = 190 bits (96), Expect = 2e-49
Identities = 155/172 (90%), Gaps = 2/172 (1%)
Similarity with Halobacterium salinarum R1 tRNA-trp
Score = 174 bits (88), Expect = 1e-44
Identities = 154/172 (89%), Gaps = 3/172 (1%)
Similarity with Haloarcula marismortui tRNA-trp
Score = 163 bits (82), Expect = 4e-41
Identities = 159/181 (87%), Gaps = 4/181 (2%)
Similarity with Natronomonas pharaonis tRNA-trp
Score = 163 bits (82), Expect = 4e-41
Identities = 159/181 (87%), Gaps = 4/181 (2%)
[1]: "A tRNA-trp Intron Endonuclease from Halobacterium volcanii"
(I was unable to upload the .pdf for this paper, you can download it at this site)