Difference between revisions of "PCR for Bio113"

From GcatWiki
Jump to: navigation, search
(PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega))
Line 21: Line 21:
  
 
'''J119137; pClone Red  (remove 70 bp, insert <61 bp)'''<br>
 
'''J119137; pClone Red  (remove 70 bp, insert <61 bp)'''<br>
113_pClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C<br>
+
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C<br>
 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C<br>
 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C<br>
 
210 bp amplicon for J119137<br>
 
210 bp amplicon for J119137<br>

Revision as of 18:28, 6 February 2018

PCR Verification of Successful GGA

If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel).

  1. For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template.
  2. Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred.
  3. Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid.
  4. The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells.
  5. Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:

  1. 95° C for 5 minutes, 1 time
  2. 95° C for 30 seconds
  3. 54° C for 30 seconds
  4. 72° C for 1 minute
  5. return to step #2 29 more times
  6. store at 22° C indefinitely
  • When the PCR is completed, they will be stored until next week when you will load 10 µL of each into the wells of a 2% agarose gel.

PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega)

J119137; pClone Red (remove 70 bp, insert <61 bp)
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C
210 bp amplicon for J119137


J119384; rClone Red (remove 815 bp, insert <61 bp)
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC TM = 61 C
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C
856 bp amplicon for J119384


J100204; actClone Red (remove 119 bp, insert <61 bp)
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG Tm = 61 C
250 bp amplicon for J100204


J100205; repClone Red (remove 129 bp, insert <61 bp)
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C
424 bp amplicon for J100205