Difference between revisions of "Sequence DNA for Bio113"
From GcatWiki
Macampbell (talk | contribs) (→Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence) |
Macampbell (talk | contribs) |
||
| Line 10: | Line 10: | ||
'''Sequencing Primers to confirm Inserts v2.0'''<br> | '''Sequencing Primers to confirm Inserts v2.0'''<br> | ||
| − | + | 113_pClone_Red_SeqFor<br> | |
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream first base of new DNA part<br> | CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream first base of new DNA part<br> | ||
<br> | <br> | ||
<br> | <br> | ||
| − | + | 113_rClone_Red_SeqFor <br> | |
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream first base of new DNA part<br> | CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream first base of new DNA part<br> | ||
<br> | <br> | ||
<br> | <br> | ||
| − | + | 113_pClone_mScarlet_SeqFor<br> | |
| − | + | ||
| − | |||
| − | |||
<br> | <br> | ||
<br> | <br> | ||
| − | + | 113_rClone_mScarlet_SeqRev<br> | |
| − | + | ||
<br> | <br> | ||
<br> | <br> | ||
Revision as of 13:08, 6 August 2018
Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence
- For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
- Add water to your DNA until the combined volume is 8 µL.
- To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
- Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.
Sequencing Primers to confirm Inserts v2.0
113_pClone_Red_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream first base of new DNA part
113_rClone_Red_SeqFor
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream first base of new DNA part
113_pClone_mScarlet_SeqFor
113_rClone_mScarlet_SeqRev
