Sequence DNA for Bio113

From GcatWiki
Revision as of 19:52, 1 December 2020 by Macampbell (talk | contribs)
Jump to: navigation, search

Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence

  1. For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
  2. Add water to your DNA until the combined volume is 8 µL.
  3. To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
  4. Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.



Sequencing Primers to confirm Inserts v2.0
113_pClone_Red_SeqFor (called pClone_Red_Fwd3 in SnapGene file)
GTGCAAATAAATTTAAGGGTAAG Tm = 51°C as per SnapGene; 151bp upstream of first base of the sticky end






113_rClone_Red_SeqRev
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream of first base of new DNA part


113_pClone_mScarlet_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream of first base of new DNA part


113_rClone_mScarlet_SeqRev
CACTTTGAAGCGCATGAATTC Tm = 55° C 118 bp downstream of first base of new DNA part