User contributions
From GcatWiki
- 15:00, 21 June 2018 (diff | hist) . . (+376) . . DNA Sequencing at Eurofins (current)
- 18:25, 18 June 2018 (diff | hist) . . (+22) . . Zymo Research Clean and Concentrate for Plasmid DNA (current)
- 18:23, 18 June 2018 (diff | hist) . . (+2) . . Zymo Research Clean and Concentrate for Plasmid DNA
- 18:23, 18 June 2018 (diff | hist) . . (+104) . . Zymo Research Clean and Concentrate for Plasmid DNA
- 20:10, 14 June 2018 (diff | hist) . . (+14) . . Zymo Research Clean and Concentrate for Plasmid DNA
- 20:09, 14 June 2018 (diff | hist) . . (+1) . . Zymo Research Clean and Concentrate for Plasmid DNA
- 20:09, 14 June 2018 (diff | hist) . . (+8) . . Zymo Research Clean and Concentrate for Plasmid DNA
- 20:08, 14 June 2018 (diff | hist) . . (+710) . . N Zymo Research Clean and Concentrate for Plasmid DNA (Created page with "Clean and Concentrate Protocol When using plasmid DNA that has been through Miniprep Protocol. 1. Combine 2 volumes of DNA Binding Buffer to each volume of plasmid. (Ex. 200...")
- 20:08, 14 June 2018 (diff | hist) . . (+57) . . MWSU protocols (current)
- 15:27, 16 February 2017 (diff | hist) . . (+50) . . MWSU protocols
- 15:24, 16 February 2017 (diff | hist) . . (+449) . . N DNA Sequencing at Eurofins (Created page with "# Prepare template and primer solutions at the concentrations listed at the bottom of this page. # Grab the appropriate number of bar-code tubes to be sent off for sequencing....")
- 21:14, 15 February 2017 (diff | hist) . . (+32) . . MWSU protocols
- 19:57, 15 February 2017 (diff | hist) . . (+2,086) . . N How to make a new Registry page (Created page with "'''Making a Registry Page''' # Go to Registry of Biological Parts then login as the correct username # Hit the tools tab and click add a part # Click add a Basic Part # Allow...") (current)
- 19:05, 15 February 2017 (diff | hist) . . (+37) . . MWSU protocols
- 19:03, 15 February 2017 (diff | hist) . . (+1) . . Pouring an Agarose Gel (current)
- 19:03, 15 February 2017 (diff | hist) . . (-1) . . Pouring an Agarose Gel
- 19:02, 15 February 2017 (diff | hist) . . (-161) . . Pouring an Agarose Gel
- 19:01, 15 February 2017 (diff | hist) . . (+39) . . Pouring an Agarose Gel
- 16:15, 9 February 2017 (diff | hist) . . (+3) . . Golden Gate Assembly Protocol (current)
- 16:12, 9 February 2017 (diff | hist) . . (+45) . . Golden Gate Assembly Protocol
- 15:39, 9 February 2017 (diff | hist) . . (0) . . Golden Gate Assembly Protocol
- 21:39, 2 February 2017 (diff | hist) . . (+208) . . Ligation and Transformation (current)
- 21:33, 2 February 2017 (diff | hist) . . (+288) . . Ligation and Transformation
- 19:44, 1 March 2016 (diff | hist) . . (0) . . Golden Gate Assembly Protocol
- 19:22, 1 March 2016 (diff | hist) . . (+239) . . Golden Gate Assembly Protocol
- 19:08, 1 March 2016 (diff | hist) . . (+11) . . Golden Gate Assembly Protocol
- 19:06, 1 March 2016 (diff | hist) . . (+14) . . Golden Gate Assembly Protocol
- 14:53, 4 June 2015 (diff | hist) . . (-11) . . Ethanol Precipitation of Vector DNA (current)
- 13:39, 2 June 2015 (diff | hist) . . (+893) . . N Gradient/Standard PCR (Created page with " Gradient/ Standard PCR 1. Create standard PCR mix. 10ul 2X GoTaq Green PCR mix 1ul forward primer (10mMl) 1ul reverse primer (10mM) 7ul dH2O 19ul Total Add 1ul of ...") (current)
- 13:33, 2 June 2015 (diff | hist) . . (+9) . . MWSU protocols
- 13:31, 2 June 2015 (diff | hist) . . (+41) . . Standard PCR (current)
- 13:17, 2 June 2015 (diff | hist) . . (+371) . . Standard PCR
- 19:32, 1 June 2015 (diff | hist) . . (+954) . . N Golden Gate Assembly Single Molecule Protocol (Created page with "Golden Gate Assembly Single Molecule Protocol GGA mixture contains: :1 µL (50 ng) Plasmid :1 µL 10X Promega Ligase Buffer :7 µL dH<sub>2</sub>O :0.5 µL Restrictio...") (current)
- 19:28, 1 June 2015 (diff | hist) . . (+51) . . MWSU protocols
- 19:27, 1 June 2015 (diff | hist) . . (+977) . . N Golden Gate Assembly Protocol (Created page with "Golden Gate Assembly Protocol GGA mixture contains: :1 µL (50 ng) Plasmid :1 µL promoter or other insert :1 µL 10X Promega Ligase Buffer :6 µL dH<sub>2</sub>O :0...")
- 19:27, 1 June 2015 (diff | hist) . . (-10) . . MWSU protocols
- 19:26, 1 June 2015 (diff | hist) . . (+6) . . Golden Gate Assembly Protocol for BsmB1
- 19:25, 1 June 2015 (diff | hist) . . (-45) . . Golden Gate Assembly Protocol for BsmB1
- 14:22, 20 May 2015 (diff | hist) . . (-1) . . Measuring Fluorescence in Bacteria (current)
- 14:21, 20 May 2015 (diff | hist) . . (-451) . . Measuring Fluorescence in Bacteria
- 14:13, 19 May 2015 (diff | hist) . . (-355) . . Fragment Purification (current)
- 20:42, 6 February 2015 (diff | hist) . . (-6) . . References 2015 (current)
- 20:40, 6 February 2015 (diff | hist) . . (+65) . . References 2015
- 21:20, 3 February 2015 (diff | hist) . . (-31) . . References 2015 (Blanked the page)
- 21:19, 3 February 2015 (diff | hist) . . (-77) . . References 2015
- 21:18, 3 February 2015 (diff | hist) . . (-6) . . References 2015
- 21:17, 3 February 2015 (diff | hist) . . (+6) . . References 2015
- 21:16, 3 February 2015 (diff | hist) . . (-6) . . References 2015
- 21:15, 3 February 2015 (diff | hist) . . (+39) . . References 2015
- 21:13, 3 February 2015 (diff | hist) . . (+15) . . References 2015
- 21:03, 3 February 2015 (diff | hist) . . (-15) . . File (Blanked the page) (current)
- 21:02, 3 February 2015 (diff | hist) . . (+15) . . N File (Created page with "Media:Alper")
- 20:58, 3 February 2015 (diff | hist) . . (+60) . . References 2015
- 20:56, 3 February 2015 (diff | hist) . . (-220) . . References 2015 (Blanked the page)
- 20:54, 3 February 2015 (diff | hist) . . (+19) . . References 2015
- 16:49, 3 February 2015 (diff | hist) . . (-57) . . References 2015
- 16:41, 3 February 2015 (diff | hist) . . (-7) . . References 2015
- 16:40, 3 February 2015 (diff | hist) . . (+98) . . References 2015
- 16:37, 3 February 2015 (diff | hist) . . (+92) . . References 2015
- 16:31, 3 February 2015 (diff | hist) . . (+17) . . References 2015
- 16:29, 3 February 2015 (diff | hist) . . (+58) . . N References 2015 (Created page with " Tuning Genetic Control through Promoter Engineering File:")
- 15:42, 3 February 2015 (diff | hist) . . (+1) . . Summer 2014 SynBio Project (Davidson and MWSU) (current)
- 15:42, 3 February 2015 (diff | hist) . . (+20) . . Summer 2014 SynBio Project (Davidson and MWSU)
- 20:58, 7 July 2014 (diff | hist) . . (-10) . . Electroporation Transformation
- 18:56, 7 July 2014 (diff | hist) . . (-39) . . Electroporation Transformation
- 15:42, 10 March 2014 (diff | hist) . . (+65) . . Electroporation Transformation
- 14:39, 10 March 2014 (diff | hist) . . (+6) . . Electroporation Transformation
- 14:38, 10 March 2014 (diff | hist) . . (+16) . . Electroporation Transformation
- 14:37, 10 March 2014 (diff | hist) . . (+1) . . Electroporation Transformation
- 14:36, 10 March 2014 (diff | hist) . . (+1,682) . . N Electroporation Transformation (Created page with 'This procedure uses electroporation to achieve transformation of bacteria with plasmid DNA. '''Cell Preparation''' 1. This procedure yields enough bacteria for two transformati…')
- 14:15, 10 March 2014 (diff | hist) . . (+36) . . MWSU protocols
- 15:02, 1 February 2014 (diff | hist) . . (+69) . . Fragment Purification
- 14:42, 1 February 2014 (diff | hist) . . (+95) . . Fragment Purification
- 14:36, 1 February 2014 (diff | hist) . . (+43) . . Fragment Purification
- 14:34, 1 February 2014 (diff | hist) . . (+169) . . Fragment Purification
- 20:25, 16 January 2014 (diff | hist) . . (+1,407) . . N Zymo Research Plasmid Minipreps (Created page with "Zymo Research Zippy Plasmid Minipreps Zymo Research: http://www.zymoresearch.com/ Cat. D4036, D4037 The kit suggests starting with 600 ul of overnight bacterial culture. W...") (current)
- 20:10, 16 January 2014 (diff | hist) . . (+37) . . MWSU protocols
- 19:42, 31 May 2013 (diff | hist) . . (-1) . . J-GGA Scaffold Sequences
- 18:42, 31 May 2013 (diff | hist) . . (+874) . . N J-GGA Scaffold Sequences (Created page with 'J-GGA Scaffold Oligos Prefix: Gaattcgcggccgcttctagag Junction A: Atagtctgttcatggtgc Spacer: acgt Junction B: Tattgatgtagttaaggc Spacer: cgga Junction C: Tttcta…')
- 18:41, 31 May 2013 (diff | hist) . . (+9) . . Biology
- 18:33, 31 May 2013 (diff | hist) . . (+22) . . Biology (Junction Golden Gate Assembly Sequences)
- 19:49, 20 May 2013 (diff | hist) . . (+7) . . IPCR (current)
- 19:48, 20 May 2013 (diff | hist) . . (+14) . . Golden Gate Assembly Protocol for BsmB1
- 19:46, 20 May 2013 (diff | hist) . . (+124) . . GCAT Library of Quality Parts (current)
- 19:44, 20 May 2013 (diff | hist) . . (+114) . . MWSU Freezer Parts (current)
- 19:41, 20 May 2013 (diff | hist) . . (+2,913) . . N MWSU Freezer Parts (MWSU Freezer Parts)
- 19:40, 20 May 2013 (diff | hist) . . (+6,581) . . N GCAT Library of Quality Parts (GCAT Library of Quality Parts)
- 19:40, 20 May 2013 (diff | hist) . . (+35) . . MWSU protocols
- 19:37, 20 May 2013 (diff | hist) . . (+6,581) . . N DNA glycerol stock (GCAT Library of Quality Parts) (current)
- 19:35, 20 May 2013 (diff | hist) . . (0) . . MWSU protocols
- 19:34, 20 May 2013 (diff | hist) . . (+46) . . MWSU protocols
- 19:32, 20 May 2013 (diff | hist) . . (+744) . . N IPCR (Inverted PCR/Biobrick Cloning)
- 19:31, 20 May 2013 (diff | hist) . . (+10) . . MWSU protocols
- 18:26, 27 June 2012 (diff | hist) . . (+129) . . N Philosophy and Ethics of our Project (Created page with 'This page is for the Philosophical and Ethical considerations surrounding our project to optimize a metabolic pathway in E. coli.')
- 18:25, 27 June 2012 (diff | hist) . . (+47) . . Summer 2012 SynBio Project (Davidson and MWSU)
- 14:13, 27 June 2012 (diff | hist) . . (-1) . . m Annealing Oligos for Cloning (Change in boiling time for annealing)
- 18:50, 25 May 2012 (diff | hist) . . (0) . . Ligation and Transformation
- 19:03, 23 May 2012 (diff | hist) . . (+39) . . Summer 2012 SynBio Project (Davidson and MWSU) (→Questions to Consider About Network Pathways)
- 18:34, 23 May 2012 (diff | hist) . . (+239) . . Summer 2012 SynBio Project (Davidson and MWSU)
- 18:23, 23 May 2012 (diff | hist) . . (+69) . . Summer 2012 SynBio Project (Davidson and MWSU) (→Papers)
- 18:19, 23 May 2012 (diff | hist) . . (+23) . . Summer 2012 SynBio Project (Davidson and MWSU) (→Papers)
- 14:35, 22 May 2012 (diff | hist) . . (+3) . . T7RNAp information page. (current)
- 14:35, 22 May 2012 (diff | hist) . . (+7) . . T7RNAp information page.
- 14:34, 22 May 2012 (diff | hist) . . (+22) . . T7RNAp information page.
- 14:34, 22 May 2012 (diff | hist) . . (0) . . N File:T7 May 22, 2012.pptx (current)
- 16:45, 21 May 2012 (diff | hist) . . (-1) . . Summer 2012 SynBio Project (Davidson and MWSU) (→Student Proposals from Ind. Studies)
- 15:19, 28 April 2012 (diff | hist) . . (+19) . . Annealing Oligos for Cloning
- 19:53, 27 April 2012 (diff | hist) . . (+103) . . Annealing Oligos for Cloning
- 19:47, 27 April 2012 (diff | hist) . . (+5) . . Annealing Oligos for Cloning
- 14:51, 21 January 2012 (diff | hist) . . (+61) . . Annealing Oligos for Cloning
- 14:41, 21 January 2012 (diff | hist) . . (+138) . . Davidson Missouri W/colony PCR (current)
- 14:34, 21 January 2012 (diff | hist) . . (0) . . MWSU protocols
- 14:19, 1 October 2011 (diff | hist) . . (+74) . . Annealing Oligos for Cloning
- 14:17, 1 October 2011 (diff | hist) . . (-14) . . What to do with a new clone (current)
- 14:16, 1 October 2011 (diff | hist) . . (+340) . . Annealing Oligos for Cloning
- 13:54, 1 October 2011 (diff | hist) . . (+631) . . N Annealing Oligos for Cloning (Created page with ' A. Reaction Components: 2 ul 10X PCR buffer w/ 15 mM MgCl2 # Design oligos (the Oligator is a useful tool for this) # Order oligos at 100 uM concentration (eg. IDT) # ul …')
- 13:51, 1 October 2011 (diff | hist) . . (+2) . . Standard PCR
- 13:51, 1 October 2011 (diff | hist) . . (+34) . . MWSU protocols
- 16:04, 30 August 2011 (diff | hist) . . (+3) . . HPP Assembly Procedure (current)
- 16:01, 30 August 2011 (diff | hist) . . (+33) . . HPP Assembly Procedure
- 15:46, 30 August 2011 (diff | hist) . . (-28) . . HPP Assembly Procedure
- 15:46, 30 August 2011 (diff | hist) . . (+754) . . HPP Assembly Procedure
- 15:37, 30 August 2011 (diff | hist) . . (+831) . . N HPP Assembly Procedure (Created page with ''''Edge Assembly''' This assembly uses BsmBI to free up the Half Edge Word in the first and second Half Edges. Ligase drives the reaction toward completion. Equimolar amounts …')
- 15:27, 30 August 2011 (diff | hist) . . (+31) . . Missouri Western/Davidson SynBio 2011
- 20:28, 27 July 2011 (diff | hist) . . (+4) . . HPP New Start and Finish
- 20:28, 27 July 2011 (diff | hist) . . (+10) . . HPP New Start and Finish
- 20:26, 27 July 2011 (diff | hist) . . (+31) . . HPP New Start and Finish
- 20:25, 27 July 2011 (diff | hist) . . (+4) . . HPP New Start and Finish
- 20:25, 27 July 2011 (diff | hist) . . (+3) . . HPP New Start and Finish
- 20:25, 27 July 2011 (diff | hist) . . (+5) . . HPP New Start and Finish
- 20:25, 27 July 2011 (diff | hist) . . (0) . . HPP New Start and Finish
- 20:24, 27 July 2011 (diff | hist) . . (+8) . . HPP New Start and Finish
- 20:24, 27 July 2011 (diff | hist) . . (-36) . . HPP New Start and Finish
- 20:23, 27 July 2011 (diff | hist) . . (-1) . . HPP New Start and Finish
- 20:23, 27 July 2011 (diff | hist) . . (+8) . . HPP New Start and Finish
- 20:22, 27 July 2011 (diff | hist) . . (+4) . . HPP New Start and Finish
- 20:22, 27 July 2011 (diff | hist) . . (+41) . . HPP New Start and Finish
- 20:20, 27 July 2011 (diff | hist) . . (-454) . . HPP New Start and Finish
- 20:18, 27 July 2011 (diff | hist) . . (+7) . . HPP New Start and Finish
- 20:16, 27 July 2011 (diff | hist) . . (-169) . . HPP New Start and Finish
- 20:11, 27 July 2011 (diff | hist) . . (-1) . . HPP New Start and Finish
- 20:10, 27 July 2011 (diff | hist) . . (+80) . . HPP New Start and Finish
- 20:08, 27 July 2011 (diff | hist) . . (+2,328) . . N HPP New Start and Finish (Created page with 'July 23, 2011 New Oligos to Order START_TOP (67 nt) AATTCGGTCTCAGACGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCGTGGAGAGACGCTGCA START_Bot (59 nt) GCGTCTCTCCACGCTAGCACTGTACCTAGGACTGAGC…')
- 20:07, 27 July 2011 (diff | hist) . . (+33) . . Missouri Western/Davidson SynBio 2011
- 16:21, 6 July 2011 (diff | hist) . . (0) . . N File:GFP1-1 FORWARD AND REVERSE.doc (current)
- 16:21, 6 July 2011 (diff | hist) . . (0) . . N File:RFP2-1 DNA Checked sequence.jpg (current)
- 16:20, 6 July 2011 (diff | hist) . . (+51) . . HPP Oligos 6-9-11 (current)
- 16:19, 6 July 2011 (diff | hist) . . (0) . . N File:RFP2-1 DNA Checked sequence.doc (current)
- 16:17, 6 July 2011 (diff | hist) . . (0) . . File:GFP1-1 FORWARD AND REVERSE.DOC (uploaded a new version of "File:GFP1-1 FORWARD AND REVERSE.DOC") (current)
- 16:15, 6 July 2011 (diff | hist) . . (+51) . . HPP Oligos 6-9-11
- 16:15, 6 July 2011 (diff | hist) . . (0) . . N File:RFP2-1 Checked sequence.doc (current)
- 16:15, 6 July 2011 (diff | hist) . . (+61) . . N File:GFP1-1 FORWARD AND REVERSE.DOC (GFP-1-1 DNA SEQUENCE MATCHING THE PARENT DNA SEQUENCE FOR GFP)
- 13:29, 30 June 2011 (diff | hist) . . (+159) . . MWSU protocols
- 13:16, 30 June 2011 (diff | hist) . . (+1) . . Davidson Missouri W/colony PCR
- 13:15, 30 June 2011 (diff | hist) . . (+6) . . Ethanol Precipitation of Vector DNA
- 13:13, 30 June 2011 (diff | hist) . . (+2) . . Pouring an Agarose Gel
- 13:12, 30 June 2011 (diff | hist) . . (-2) . . Pouring an Agarose Gel
- 13:12, 30 June 2011 (diff | hist) . . (+208) . . Pouring an Agarose Gel
- 13:06, 30 June 2011 (diff | hist) . . (+1) . . Reducing Background from Double Digested Vector (current)
- 20:50, 29 June 2011 (diff | hist) . . (+8) . . Davidson Missouri W/colony PCR
- 20:49, 29 June 2011 (diff | hist) . . (+89) . . Davidson Missouri W/colony PCR
- 20:44, 29 June 2011 (diff | hist) . . (+86) . . Davidson Missouri W/colony PCR
- 15:34, 29 June 2011 (diff | hist) . . (+12) . . Davidson Missouri W/colony PCR
- 15:29, 29 June 2011 (diff | hist) . . (+133) . . Davidson Missouri W/colony PCR
- 21:00, 9 June 2011 (diff | hist) . . (+14) . . HPP Oligos 6-9-11
- 21:00, 9 June 2011 (diff | hist) . . (0) . . N File:RFP Oligos Design.doc (current)
- 20:59, 9 June 2011 (diff | hist) . . (0) . . N File:LacZ Oligos Design.doc (current)
- 20:59, 9 June 2011 (diff | hist) . . (+87) . . HPP Oligos 6-9-11
- 20:57, 9 June 2011 (diff | hist) . . (0) . . N File:GFP Oligos Design.doc (current)
- 20:57, 9 June 2011 (diff | hist) . . (+112) . . N HPP Oligos 6-9-11 (Created page with 'These documents contain oligo designs for the HPP biological computer. They incorporate the following features:')
- 20:54, 9 June 2011 (diff | hist) . . (+26) . . Missouri Western/Davidson SynBio 2011
- 13:36, 2 June 2011 (diff | hist) . . (+73) . . DNA computing
- 13:35, 2 June 2011 (diff | hist) . . (0) . . N File:HPP DNA computer MWSU 2011.pptx (current)
- 20:04, 1 June 2011 (diff | hist) . . (-1) . . DNA computing
- 20:03, 1 June 2011 (diff | hist) . . (+172) . . DNA computing
- 19:50, 1 June 2011 (diff | hist) . . (-3) . . DNA computing
- 19:49, 1 June 2011 (diff | hist) . . (+441) . . DNA computing
- 13:55, 1 June 2011 (diff | hist) . . (+54) . . DNA computing
- 13:54, 1 June 2011 (diff | hist) . . (+238) . . DNA computing
- 13:51, 1 June 2011 (diff | hist) . . (+153) . . DNA computing
- 13:47, 1 June 2011 (diff | hist) . . (+45) . . DNA computing
- 13:46, 1 June 2011 (diff | hist) . . (0) . . DNA computing
- 13:45, 1 June 2011 (diff | hist) . . (0) . . File:Roweis stickers 1996.pdf (uploaded a new version of "File:Roweis stickers 1996.pdf") (current)
- 13:44, 1 June 2011 (diff | hist) . . (+45) . . DNA computing
- 13:44, 1 June 2011 (diff | hist) . . (0) . . File:ShapiroNature2004.pdf (uploaded a new version of "File:ShapiroNature2004.pdf") (current)
- 13:43, 1 June 2011 (diff | hist) . . (0) . . File:Roweis stickers 1996.pdf (uploaded a new version of "File:Roweis stickers 1996.pdf")
- 13:42, 1 June 2011 (diff | hist) . . (0) . . File:Rothemund 2000.pdf (uploaded a new version of "File:Rothemund 2000.pdf") (current)
- 13:42, 1 June 2011 (diff | hist) . . (0) . . File:Ravinderjit 2000.pdf (uploaded a new version of "File:Ravinderjit 2000.pdf") (current)
- 13:41, 1 June 2011 (diff | hist) . . (0) . . File:Chen 1999.pdf (uploaded a new version of "File:Chen 1999.pdf") (current)
- 13:40, 1 June 2011 (diff | hist) . . (0) . . File:Bonehetal 1996.pdf (uploaded a new version of "File:Bonehetal 1996.pdf") (current)
- 13:39, 1 June 2011 (diff | hist) . . (0) . . File:Benneson 2003.pdf (uploaded a new version of "File:Benneson 2003.pdf") (current)
- 13:39, 1 June 2011 (diff | hist) . . (0) . . File:Adleman SciAm.pdf (uploaded a new version of "File:Adleman SciAm.pdf") (current)
- 13:38, 1 June 2011 (diff | hist) . . (0) . . File:Adleman Data Encryption Standard 1999.pdf (uploaded a new version of "File:Adleman Data Encryption Standard 1999.pdf") (current)
- 13:37, 1 June 2011 (diff | hist) . . (-21) . . DNA computing
- 13:37, 1 June 2011 (diff | hist) . . (+21) . . DNA computing
- 13:36, 1 June 2011 (diff | hist) . . (+6) . . DNA computing
- 13:35, 1 June 2011 (diff | hist) . . (-6) . . DNA computing
- 13:34, 1 June 2011 (diff | hist) . . (+36) . . DNA computing
- 13:33, 1 June 2011 (diff | hist) . . (0) . . DNA computing
- 13:32, 1 June 2011 (diff | hist) . . (0) . . DNA computing
- 13:32, 1 June 2011 (diff | hist) . . (0) . . File:Adelman 1994.pdf (uploaded a new version of "File:Adelman 1994.pdf") (current)
- 12:57, 1 June 2011 (diff | hist) . . (+86) . . DNA computing
- 12:52, 1 June 2011 (diff | hist) . . (+2) . . DNA computing
- 12:51, 1 June 2011 (diff | hist) . . (+964) . . DNA computing
- 12:44, 1 June 2011 (diff | hist) . . (+84) . . DNA computing
- 12:43, 1 June 2011 (diff | hist) . . (0) . . File:Chen 1999.pdf (uploaded a new version of "File:Chen 1999.pdf")
- 12:43, 1 June 2011 (diff | hist) . . (+154) . . DNA computing
- 12:37, 1 June 2011 (diff | hist) . . (+303) . . N DNA computing (Created page with 'Need full text from this paper: DNA-Based Computing of Strategic Assignment Problems, http://prl.aps.org/abstract/PRL/v106/i18/e188702 Criticism of DNA-Based Computing of Strate…')
- 12:35, 1 June 2011 (diff | hist) . . (0) . . N File:ShapiroNature2004.pdf
- 12:35, 1 June 2011 (diff | hist) . . (0) . . N File:Roweis stickers 1996.pdf
- 12:35, 1 June 2011 (diff | hist) . . (0) . . N File:Rothemund 2000.pdf
- 12:35, 1 June 2011 (diff | hist) . . (0) . . N File:Ravinderjit 2000.pdf
- 12:34, 1 June 2011 (diff | hist) . . (0) . . N File:Chen 1999.pdf
- 12:34, 1 June 2011 (diff | hist) . . (0) . . N File:Bonehetal 1996.pdf
- 12:34, 1 June 2011 (diff | hist) . . (0) . . N File:Benneson review 2009.pdf (current)
- 12:34, 1 June 2011 (diff | hist) . . (0) . . File:Benneson 2003.pdf (uploaded a new version of "File:Benneson 2003.pdf")
- 12:33, 1 June 2011 (diff | hist) . . (0) . . N File:Benneson 2003.pdf
- 12:33, 1 June 2011 (diff | hist) . . (0) . . N File:Adleman SciAm.pdf
- 12:33, 1 June 2011 (diff | hist) . . (0) . . N File:Adleman Data Encryption Standard 1999.pdf
- 12:33, 1 June 2011 (diff | hist) . . (0) . . N File:Adelman 1994.pdf
- 20:04, 31 May 2011 (diff | hist) . . (+121) . . N File:DNA Computing on surface.pdf (The principle of the technique has been demonstrated experimentally for a simple example of the hamiltonian path problem.) (current)
- 19:03, 31 May 2011 (diff | hist) . . (+126) . . N File:Aspects of Biomolecular Computing.pdf (An overview of Biomolecular computing including a summary of DNA computing and a section on the limitations of such computing.) (current)
- 17:42, 31 May 2011 (diff | hist) . . (+107) . . N File:Molecular Computation of Solution to Combinatorial Problems-Leonard Adleman.pdf (This is the original paper by Adleman solving the Hamiltonian path problem using genetic computing in 1994.) (current)
- 17:14, 31 May 2011 (diff | hist) . . (+8) . . Missouri Western/Davidson SynBio 2011
- 17:14, 31 May 2011 (diff | hist) . . (+18) . . Missouri Western/Davidson SynBio 2011
- 15:43, 5 October 2010 (diff | hist) . . (+4) . . Bacterial Media
- 15:43, 5 October 2010 (diff | hist) . . (+1) . . Bacterial Media
- 13:25, 5 October 2010 (diff | hist) . . (+105) . . Bacterial Media
- 17:03, 8 September 2010 (diff | hist) . . (+105) . . DNA Sequencing at Iowa State University (current)
- 16:58, 8 September 2010 (diff | hist) . . (+73) . . Measuring Fluorescence in Bacteria
- 16:56, 8 September 2010 (diff | hist) . . (+86) . . Measuring Fluorescence in Bacteria
- 16:52, 8 September 2010 (diff | hist) . . (+66) . . DNA Sequencing at Iowa State University
- 14:40, 8 September 2010 (diff | hist) . . (-41) . . DNA Sequencing at Iowa State University
- 14:40, 8 September 2010 (diff | hist) . . (-27) . . DNA Sequencing at Iowa State University
- 14:39, 8 September 2010 (diff | hist) . . (+990) . . N DNA Sequencing at Iowa State University
- 14:38, 8 September 2010 (diff | hist) . . (+45) . . Davidson Missouri W/MWSU protocols (current)
- 20:21, 15 July 2010 (diff | hist) . . (+1,059) . . N Isolation of Genomic DNA from Bacteria (current)
- 20:01, 15 July 2010 (diff | hist) . . (+44) . . Davidson Missouri W/MWSU protocols
- 17:32, 12 July 2010 (diff | hist) . . (+34) . . BioBrick Digestions for Fragment and Vector Preparation (current)
- 17:30, 12 July 2010 (diff | hist) . . (0) . . N File:BioBrick assembly.JPG (current)
- 16:35, 12 July 2010 (diff | hist) . . (+1,013) . . N BioBrick Digestions for Fragment and Vector Preparation
- 16:19, 12 July 2010 (diff | hist) . . (+1) . . Reducing Background from Double Digested Vector
- 16:18, 12 July 2010 (diff | hist) . . (+858) . . N Reducing Background from Double Digested Vector
- 16:09, 12 July 2010 (diff | hist) . . (+53) . . Davidson Missouri W/MWSU protocols
- 17:32, 21 June 2010 (diff | hist) . . (0) . . BioBrick Ligations (current)
- 17:32, 21 June 2010 (diff | hist) . . (0) . . N File:Biobrick ligations.JPG (current)
- 17:31, 21 June 2010 (diff | hist) . . (+34) . . BioBrick Ligations
- 17:29, 21 June 2010 (diff | hist) . . (+221) . . N BioBrick Ligations
- 17:28, 21 June 2010 (diff | hist) . . (+455) . . N Ethanol Precipitation of Vector DNA
- 17:28, 21 June 2010 (diff | hist) . . (-1) . . Davidson Missouri W/MWSU protocols
- 17:27, 21 June 2010 (diff | hist) . . (+271) . . N Pouring an Agarose Gel
- 17:27, 21 June 2010 (diff | hist) . . (+94) . . Davidson Missouri W/MWSU protocols
- 16:19, 21 June 2010 (diff | hist) . . (-56) . . Diagnostic RP Digestion for Checking Insert Size (current)
- 16:17, 21 June 2010 (diff | hist) . . (+16) . . Diagnostic RP Digestion for Checking Insert Size
- 16:17, 21 June 2010 (diff | hist) . . (+4) . . Diagnostic RP Digestion for Checking Insert Size
- 16:15, 21 June 2010 (diff | hist) . . (+389) . . Diagnostic RP Digestion for Checking Insert Size
- 16:06, 21 June 2010 (diff | hist) . . (+100) . . Diagnostic RP Digestion for Checking Insert Size
- 16:06, 21 June 2010 (diff | hist) . . (+326) . . Diagnostic RP Digestion for Checking Insert Size
- 16:02, 21 June 2010 (diff | hist) . . (+60) . . N Diagnostic RP Digestion for Checking Insert Size
- 16:02, 21 June 2010 (diff | hist) . . (+115) . . Davidson Missouri W/MWSU protocols
- 13:51, 16 June 2010 (diff | hist) . . (+82) . . Ligation and Transformation
- 17:46, 7 June 2010 (diff | hist) . . (+510) . . Fragment Purification
- 17:43, 7 June 2010 (diff | hist) . . (+678) . . N Fragment Purification
- 17:26, 7 June 2010 (diff | hist) . . (+27) . . Davidson Missouri W/MWSU protocols
- 17:03, 7 June 2010 (diff | hist) . . (+119) . . Ligation and Transformation
- 16:52, 7 June 2010 (diff | hist) . . (+884) . . N Ligation and Transformation
- 16:47, 7 June 2010 (diff | hist) . . (+33) . . Davidson Missouri W/MWSU protocols
- 15:02, 4 June 2010 (diff | hist) . . (+1,059) . . N Measuring Fluorescence in Bacteria
- 14:21, 4 June 2010 (diff | hist) . . (+40) . . Davidson Missouri W/MWSU protocols
- 16:26, 1 June 2010 (diff | hist) . . (0) . . What to do with a new clone
- 16:25, 1 June 2010 (diff | hist) . . (-71) . . What to do with a new clone
- 16:23, 1 June 2010 (diff | hist) . . (+1) . . What to do with a new clone
- 16:23, 1 June 2010 (diff | hist) . . (+16) . . What to do with a new clone
- 16:23, 1 June 2010 (diff | hist) . . (+2,565) . . N What to do with a new clone
- 15:27, 1 June 2010 (diff | hist) . . (+33) . . Davidson Missouri W/MWSU protocols
- 14:33, 31 May 2010 (diff | hist) . . (+16) . . Bacterial Media
- 14:32, 31 May 2010 (diff | hist) . . (+6) . . Bacterial Media
- 14:31, 31 May 2010 (diff | hist) . . (+52) . . Bacterial Media
- 14:19, 31 May 2010 (diff | hist) . . (+1,143) . . N Bacterial Media
- 14:17, 31 May 2010 (diff | hist) . . (0) . . N File:Bacterial Media.doc (current)
- 14:16, 31 May 2010 (diff | hist) . . (0) . . Davidson Missouri W/MWSU protocols
- 20:29, 2 April 2010 (diff | hist) . . (+84) . . Bio-Math Connections January - May 2010 (→Idea #9)
- 20:10, 2 April 2010 (diff | hist) . . (-1) . . Bio-Math Connections January - May 2010 (→Idea #4)
- 21:16, 26 March 2010 (diff | hist) . . (+363) . . Bio-Math Connections January - May 2010 (→Idea #5)
- 21:10, 26 March 2010 (diff | hist) . . (0) . . Bio-Math Connections January - May 2010 (→Idea #3)
- 21:09, 26 March 2010 (diff | hist) . . (+437) . . Bio-Math Connections January - May 2010 (→Idea #3)
- 20:55, 26 March 2010 (diff | hist) . . (+406) . . Bio-Math Connections January - May 2010 (→Idea #1)
- 20:48, 26 March 2010 (diff | hist) . . (+124) . . Bio-Math Connections January - May 2010 (→Idea #1)
- 20:11, 26 March 2010 (diff | hist) . . (+26) . . Bio-Math Connections January - May 2010 (→Idea #1)
- 20:36, 29 January 2010 (diff | hist) . . (+54) . . Bio-Math Connections January - May 2010
- 18:53, 29 January 2010 (diff | hist) . . (+54) . . Bio-Math Connections January - May 2010
- 18:05, 29 January 2010 (diff | hist) . . (+58) . . Bio-Math Connections January - May 2010
- 18:44, 14 April 2009 (diff | hist) . . (0) . . N File:SSLA XOR.GIF (current)
- 18:44, 14 April 2009 (diff | hist) . . (0) . . N File:SSLA OR.GIF (current)
- 18:44, 14 April 2009 (diff | hist) . . (0) . . N File:SSLA NXOR.GIF (current)
- 18:43, 14 April 2009 (diff | hist) . . (0) . . N File:SSLA NAND.GIF (current)
- 18:43, 14 April 2009 (diff | hist) . . (0) . . N File:SSLA AND.GIF (current)
- 18:38, 14 April 2009 (diff | hist) . . (0) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)? (→Suppressor Suppressor Logic (SSL)) (current)
- 18:37, 14 April 2009 (diff | hist) . . (0) . . N File:SSLA NOR.GIF (current)
- 18:35, 14 April 2009 (diff | hist) . . (+624) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)?
- 12:51, 14 April 2009 (diff | hist) . . (-92) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 12:50, 14 April 2009 (diff | hist) . . (+553) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 12:45, 14 April 2009 (diff | hist) . . (+214) . . Can we solve a 3-SAT problem with supressor logic? (→How could suppressor logic be used to solve the Sakamoto 3-SAT problem?)
- 20:20, 13 April 2009 (diff | hist) . . (0) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 20:19, 13 April 2009 (diff | hist) . . (+105) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 20:17, 13 April 2009 (diff | hist) . . (+90) . . Can we solve a 3-SAT problem with supressor logic? (→How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem?)
- 18:44, 13 April 2009 (diff | hist) . . (+58) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 18:43, 13 April 2009 (diff | hist) . . (0) . . N File:Table2 Anderson2002.GIF (current)
- 18:38, 13 April 2009 (diff | hist) . . (+225) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 18:03, 13 April 2009 (diff | hist) . . (+143) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 13:49, 13 April 2009 (diff | hist) . . (+166) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 13:10, 13 April 2009 (diff | hist) . . (+7) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 13:10, 13 April 2009 (diff | hist) . . (+34) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 13:09, 13 April 2009 (diff | hist) . . (0) . . N File:MaglierySchultz2001JMB.pdf (current)
- 13:08, 13 April 2009 (diff | hist) . . (0) . . N File:Hohsaka 2009 in vitro tln.pdf (current)
- 13:07, 13 April 2009 (diff | hist) . . (0) . . N File:Dunham 2009 tRNA structure.pdf (current)
- 13:06, 13 April 2009 (diff | hist) . . (-4) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 13:06, 13 April 2009 (diff | hist) . . (+50) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 13:05, 13 April 2009 (diff | hist) . . (+317) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 13:05, 13 April 2009 (diff | hist) . . (0) . . N File:AndersonSchultz2002ChemBiol.pdf (current)
- 18:04, 10 April 2009 (diff | hist) . . (+12) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)? (→Suppressor Suppressor Logic (SSL))
- 18:03, 10 April 2009 (diff | hist) . . (-12) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)? (→Suppressor Suppressor Logic (SSL))
- 18:01, 10 April 2009 (diff | hist) . . (-3) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)? (→Suppressor Suppressor Logic (SSL))
- 18:01, 10 April 2009 (diff | hist) . . (0) . . N File:Suppressor tRNA ANDgate.pdf (current)
- 18:01, 10 April 2009 (diff | hist) . . (+79) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)? (→Suppressor Suppressor Logic (SSL))
- 18:00, 10 April 2009 (diff | hist) . . (+53) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)? (→Suppressor Suppressor Logic (SSL))
- 17:34, 10 April 2009 (diff | hist) . . (+55) . . Can we solve a 3-SAT problem with supressor logic? (→How could suppressor logic be used to solve the Sakamoto 3-SAT problem?)
- 17:33, 10 April 2009 (diff | hist) . . (0) . . N File:Logical expression2.GIF (current)
- 17:33, 10 April 2009 (diff | hist) . . (+1) . . Can we solve a 3-SAT problem with supressor logic? (→How could suppressor logic be used to solve the Sakamoto 3-SAT problem?)
- 17:31, 10 April 2009 (diff | hist) . . (0) . . N File:Logical expression.gif (current)
- 20:58, 9 April 2009 (diff | hist) . . (+257) . . Can we solve a 3-SAT problem with supressor logic? (→How could suppressor logic be used to solve the Sakamoto 3-SAT problem?)
- 20:55, 9 April 2009 (diff | hist) . . (0) . . N File:LE circuit.GIF (current)
- 20:54, 9 April 2009 (diff | hist) . . (+48) . . Can we solve a 3-SAT problem with supressor logic? (→How could suppressor logic be used to solve the Sakamoto 3-SAT problem?)
- 17:55, 9 April 2009 (diff | hist) . . (+310) . . Can we solve a 3-SAT problem with supressor logic? (→How could suppressor logic be used to solve the Sakamoto 3-SAT problem?)
- 17:45, 9 April 2009 (diff | hist) . . (0) . . N File:Suppressor inputs.GIF (current)
- 17:45, 9 April 2009 (diff | hist) . . (+55) . . Can we solve a 3-SAT problem with supressor logic? (→How could suppressor logic be used to solve the Sakamoto 3-SAT problem?)
- 17:20, 9 April 2009 (diff | hist) . . (+23) . . Can we solve a 3-SAT problem with supressor logic? (→What is suppressor logic?)
- 15:24, 8 April 2009 (diff | hist) . . (+4) . . Can we solve a 3-SAT problem with supressor logic? (→What is suppressor logic?)
- 15:23, 8 April 2009 (diff | hist) . . (-12) . . Can we solve a 3-SAT problem with supressor logic? (→What is suppressor logic?)
- 15:22, 8 April 2009 (diff | hist) . . (+160) . . Can we solve a 3-SAT problem with supressor logic? (→What is suppressor logic?)
- 15:20, 8 April 2009 (diff | hist) . . (+115) . . Can we solve a 3-SAT problem with supressor logic? (→What is suppressor logic?)
- 15:16, 8 April 2009 (diff | hist) . . (+344) . . Can we solve a 3-SAT problem with supressor logic? (→What is suppressor logic?)
- 15:07, 8 April 2009 (diff | hist) . . (+320) . . Can we solve a 3-SAT problem with supressor logic? (→What is suppressor logic?)
- 14:52, 8 April 2009 (diff | hist) . . (+6) . . Can we solve a 3-SAT problem with supressor logic? (→What is suppressor logic?)
- 14:51, 8 April 2009 (diff | hist) . . (+31) . . Can we solve a 3-SAT problem with supressor logic? (→What is suppressor logic?)
- 14:50, 8 April 2009 (diff | hist) . . (+121) . . Can we solve a 3-SAT problem with supressor logic? (→What is suppressor logic?)
- 14:43, 8 April 2009 (diff | hist) . . (0) . . Can we solve a 3-SAT problem with supressor logic? (→How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem?)
- 14:41, 8 April 2009 (diff | hist) . . (+40) . . Can we solve a 3-SAT problem with supressor logic? (→How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem?)
- 14:40, 8 April 2009 (diff | hist) . . (+234) . . Can we solve a 3-SAT problem with supressor logic? (→How did Sakamoto et al. use a DNA computer to solve a 3-SAT problem?)
- 14:24, 8 April 2009 (diff | hist) . . (-12) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 13:37, 8 April 2009 (diff | hist) . . (+1) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 13:36, 8 April 2009 (diff | hist) . . (0) . . N File:The final cut.GIF (current)
- 13:35, 8 April 2009 (diff | hist) . . (+51) . . Can we solve a 3-SAT problem with supressor logic?
- 13:30, 8 April 2009 (diff | hist) . . (+18) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 13:29, 8 April 2009 (diff | hist) . . (+191) . . Can we solve a 3-SAT problem with supressor logic? (→Things we need to learn about)
- 13:25, 8 April 2009 (diff | hist) . . (+169) . . Can we solve a 3-SAT problem with supressor logic?
- 15:12, 4 April 2009 (diff | hist) . . (+24) . . Can we solve a 3-SAT problem with supressor logic? (→How could suppressor logic be used to solve the Sakamoto 3-SAT problem?)
- 15:11, 4 April 2009 (diff | hist) . . (+703) . . Can we solve a 3-SAT problem with supressor logic? (→How could suppressor logic be used to solve the Sakamoto 3-SAT problem?)
- 15:00, 4 April 2009 (diff | hist) . . (-20) . . Can we solve a 3-SAT problem with supressor logic? (→What is the 3-SAT problem?)
- 18:03, 3 April 2009 (diff | hist) . . (+894) . . N What role can physical modeling of protein structure play in our project? (current)
- 17:53, 3 April 2009 (diff | hist) . . (+1) . . Can we solve a 3-SAT problem with supressor logic?
- 17:53, 3 April 2009 (diff | hist) . . (+64) . . Can we solve a 3-SAT problem with supressor logic?
- 17:51, 3 April 2009 (diff | hist) . . (-3) . . Can we solve a 3-SAT problem with supressor logic?
- 17:49, 3 April 2009 (diff | hist) . . (+35) . . Can we solve a 3-SAT problem with supressor logic?
- 17:48, 3 April 2009 (diff | hist) . . (0) . . N File:Sakamoto DNA computer 3SAT.pdf (current)
- 17:44, 3 April 2009 (diff | hist) . . (+27) . . Can we solve a 3-SAT problem with supressor logic?
- 17:44, 3 April 2009 (diff | hist) . . (+195) . . N Can we solve a 3-SAT problem with supressor logic?
- 17:35, 3 April 2009 (diff | hist) . . (-24) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)? (→Suppressor Suppressor Logic (SSL))
- 17:34, 3 April 2009 (diff | hist) . . (0) . . N File:SSL XOR.GIF (current)
- 17:34, 3 April 2009 (diff | hist) . . (0) . . N File:SSL NXOR.GIF (current)
- 17:34, 3 April 2009 (diff | hist) . . (0) . . N File:SSL NAND.GIF (current)
- 17:33, 3 April 2009 (diff | hist) . . (0) . . N File:SSL AND.GIF (current)
- 17:29, 3 April 2009 (diff | hist) . . (0) . . N File:SSL NOR.GIF (current)
- 17:28, 3 April 2009 (diff | hist) . . (-43) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)?
- 17:23, 3 April 2009 (diff | hist) . . (+43) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)?
- 17:23, 3 April 2009 (diff | hist) . . (0) . . N File:SSL OR.GIF (current)
- 17:16, 3 April 2009 (diff | hist) . . (0) . . N File:SSL NAND.JPG (current)
- 17:16, 3 April 2009 (diff | hist) . . (-5) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)? (→Suppressor Suppressor Logic (SSL))
- 17:15, 3 April 2009 (diff | hist) . . (+227) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)?
- 17:14, 3 April 2009 (diff | hist) . . (0) . . N File:SSL NXOR.JPG (current)
- 17:14, 3 April 2009 (diff | hist) . . (0) . . N File:SSL XOR.JPG (current)
- 17:12, 3 April 2009 (diff | hist) . . (0) . . N File:SSL AND.JPG (current)
- 17:11, 3 April 2009 (diff | hist) . . (0) . . N File:SSL NOR.JPG (current)
- 17:09, 3 April 2009 (diff | hist) . . (+22) . . Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)? (→Suppressor Suppressor Logic (SSL))
- 17:07, 3 April 2009 (diff | hist) . . (0) . . N File:SSL OR.JPG (current)
- 17:07, 3 April 2009 (diff | hist) . . (+297) . . N Can we use suppressor tRNAs to encode logical operators (suppressor suppressor logic, SSL)?
- 16:48, 3 April 2009 (diff | hist) . . (+375) . . Missouri Western/Davidson iGEM2009
- 16:20, 3 April 2009 (diff | hist) . . (+141) . . Missouri Western/Davidson iGEM2009
- 16:29, 28 October 2008 (diff | hist) . . (-90) . . Modeling of biological hash function (current)
- 16:28, 28 October 2008 (diff | hist) . . (0) . . Modeling of biological hash function
- 16:28, 28 October 2008 (diff | hist) . . (-587) . . Modeling of biological hash function
- 16:27, 28 October 2008 (diff | hist) . . (-96) . . Modeling of biological hash function
- 16:23, 28 October 2008 (diff | hist) . . (+1,749) . . Modeling of biological hash function
- 16:20, 28 October 2008 (diff | hist) . . (+306) . . Modeling of biological hash function
- 01:00, 28 October 2008 (diff | hist) . . (-1,177) . . Experience gained on new Registry parts (current)
- 01:00, 28 October 2008 (diff | hist) . . (+1,166) . . Improvement of pre-existing Registry parts (current)
- 00:56, 28 October 2008 (diff | hist) . . (-183) . . Experience gained on new Registry parts
- 00:55, 28 October 2008 (diff | hist) . . (+310) . . Experience gained on new Registry parts
- 00:51, 28 October 2008 (diff | hist) . . (-1) . . Experience gained on new Registry parts
- 00:51, 28 October 2008 (diff | hist) . . (+14) . . Experience gained on new Registry parts
- 00:50, 28 October 2008 (diff | hist) . . (-62) . . Experience gained on new Registry parts
- 00:46, 28 October 2008 (diff | hist) . . (+168) . . Experience gained on new Registry parts
- 00:42, 28 October 2008 (diff | hist) . . (+392) . . Experience gained on new Registry parts
- 00:42, 28 October 2008 (diff | hist) . . (+425) . . Experience gained on new Registry parts
- 00:36, 28 October 2008 (diff | hist) . . (+19) . . Experience gained on new Registry parts
- 00:34, 28 October 2008 (diff | hist) . . (+715) . . Experience gained on new Registry parts
- 00:21, 28 October 2008 (diff | hist) . . (+48) . . Experience gained on new Registry parts
- 00:20, 28 October 2008 (diff | hist) . . (0) . . N File:24 hr.JPG (current)
- 00:20, 28 October 2008 (diff | hist) . . (0) . . N File:16 hr.JPG (current)
- 00:19, 28 October 2008 (diff | hist) . . (0) . . N File:9100 K82.JPG (current)
- 00:18, 28 October 2008 (diff | hist) . . (-208) . . Experience gained on new Registry parts
- 00:16, 28 October 2008 (diff | hist) . . (+6) . . Experience gained on new Registry parts
- 00:12, 28 October 2008 (diff | hist) . . (-40) . . Experience gained on new Registry parts
- 00:11, 28 October 2008 (diff | hist) . . (0) . . Experience gained on new Registry parts
- 00:10, 28 October 2008 (diff | hist) . . (+68) . . Experience gained on new Registry parts
- 00:08, 28 October 2008 (diff | hist) . . (+122) . . Experience gained on new Registry parts
- 00:01, 28 October 2008 (diff | hist) . . (0) . . N File:9100 Sender.JPG (current)
- 23:59, 27 October 2008 (diff | hist) . . (0) . . N File:9100 K73.JPG (current)
- 23:50, 27 October 2008 (diff | hist) . . (-5) . . New parts contributed to the Registry (current)
- 23:50, 27 October 2008 (diff | hist) . . (-16) . . New parts contributed to the Registry
- 23:49, 27 October 2008 (diff | hist) . . (-84) . . New parts contributed to the Registry
- 23:48, 27 October 2008 (diff | hist) . . (-9) . . New parts contributed to the Registry
- 23:48, 27 October 2008 (diff | hist) . . (-20) . . New parts contributed to the Registry
- 23:42, 27 October 2008 (diff | hist) . . (+53) . . Home Page (current)
- 19:00, 27 October 2008 (diff | hist) . . (+716) . . E. nigma Project
- 18:56, 27 October 2008 (diff | hist) . . (+69) . . E. nigma Project
- 18:54, 27 October 2008 (diff | hist) . . (+184) . . Experience gained on new Registry parts
- 18:49, 27 October 2008 (diff | hist) . . (+4) . . N E. nigma Project
- 18:47, 27 October 2008 (diff | hist) . . (+137) . . Home Page
- 18:43, 27 October 2008 (diff | hist) . . (+104) . . Home Page
- 18:40, 27 October 2008 (diff | hist) . . (+325) . . Home Page
- 18:24, 27 October 2008 (diff | hist) . . (+898) . . Home Page
- 18:20, 27 October 2008 (diff | hist) . . (+278) . . Home Page
- 18:19, 27 October 2008 (diff | hist) . . (+667) . . Home Page
- 18:18, 27 October 2008 (diff | hist) . . (-2) . . Home Page
- 18:17, 27 October 2008 (diff | hist) . . (+311) . . N Home Page
- 18:15, 27 October 2008 (diff | hist) . . (-89) . . IGEM2008 (current)
- 18:15, 27 October 2008 (diff | hist) . . (-92) . . IGEM2008
- 18:14, 27 October 2008 (diff | hist) . . (+492) . . N IGEM2008
- 17:13, 16 July 2007 (diff | hist) . . (-17) . . Davidson Missouri W/Jordan Baumgardner
- 16:46, 16 July 2007 (diff | hist) . . (+24) . . N File:Kkc.jpg (I love krispy kreme!!!!!) (current)
- 16:43, 16 July 2007 (diff | hist) . . (-1) . . Davidson Missouri W/Jordan Baumgardner
- 16:33, 16 July 2007 (diff | hist) . . (-1) . . Davidson Missouri W/Todd Eckdahl
- 15:43, 16 July 2007 (diff | hist) . . (+7) . . Davidson Missouri W/Todd Eckdahl
- 15:40, 16 July 2007 (diff | hist) . . (+225) . . Davidson Missouri W/Todd Eckdahl
- 15:39, 16 July 2007 (diff | hist) . . (0) . . N File:MWSU iGEM06.JPG (current)
- 15:32, 16 July 2007 (diff | hist) . . (+42) . . Davidson Missouri W/Todd Eckdahl
- 15:31, 16 July 2007 (diff | hist) . . (+34) . . Davidson Missouri W/Todd Eckdahl
- 15:29, 16 July 2007 (diff | hist) . . (+50) . . Davidson Missouri W/Todd Eckdahl
- 15:29, 16 July 2007 (diff | hist) . . (0) . . N File:MWSU Todd fish.JPG (current)
- 02:09, 16 July 2007 (diff | hist) . . (-46) . . Davidson Missouri W/Todd Eckdahl
- 02:08, 16 July 2007 (diff | hist) . . (+531) . . Davidson Missouri W/Todd Eckdahl