How do you build the tRNA construct?

From GcatWiki
Jump to: navigation, search

New Oligo Plan


Below is a diagram for the oligos that will make a supD suppressor tRNA. The four constant oligos called FS_tRNA… will be used repeatedly to make all the different suppressor tRNA genes. What will change is the two variable oligos in the middle (in this case Pro1_tRNA… which is one of MWSU’s supp. tRNAs). Also, the top strand will have the BioBrick prefix and suffix and sticky ends for EcoRI and PstI on the 5’ and 3’ ends.


SupD Diagram pic2.GIF

Below are the DNA sequences for the four constant oligos.

FS_tRNA_5’top

5’ AATTCGCGGCCGCTTCTAGAGGGATCCAATTCGGAGAGATGCCG 3’


FS_tRNA_3’top

5’ GCCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC CACTGCATATCCTTAGCGAAAGCTAAGGATTTTTTTTAAGCTTACTAGTAGCGGCCGCTGCA 3’


FS_tRNA_5’bottom

5’CGGCCGCTACTAGTAAGCTTAAAAAAAATCCTTAGCTTTCGCTAAGGA TATGCAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGG 3’


FS_tRNA_3’bottom

5’ACCGGTCCGTTCAGCCGCTCCGGCATCTCTCCGAATTGGATCCCTCTA GAAGCGGCCGC 3’


Below is an example for the two variable oligos in the middle. This particular sequence is for the Pro1 suppressor. The red letters on the top strand are the anticodon loop. The red letters on the bottom strand are the complementary bases to this anticodon loop. The red bases are the only ones that will be different depending on the supp. being used.

Pro1_tRNA_Top

5’ GAGCGGCTGAACGGACCGGTCTATTGGACA 3’

Pro1_tRNA_Bottom

5’ TAGAGTTGCCCCTACTCCGGTGTCCAATAG 3’