Difference between revisions of "Sequence DNA for Bio113"

From GcatWiki
Jump to: navigation, search
(Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence)
Line 10: Line 10:
  
 
'''Sequencing Primers to confirm Inserts v2.0'''<br>
 
'''Sequencing Primers to confirm Inserts v2.0'''<br>
113_pClone_SeqFor<br>
+
113_pClone_Red_SeqFor<br>
 
CTAATTCAACAAGAATTGGGAC Tm = 60° C  71bp upstream first base of new DNA part<br>
 
CTAATTCAACAAGAATTGGGAC Tm = 60° C  71bp upstream first base of new DNA part<br>
 
<br>
 
<br>
 
<br>
 
<br>
113_rClone_SeqFor <br>
+
113_rClone_Red_SeqFor <br>
 
CCTTCGTACGGACGACCTTC Tm = 58° C  112bp downstream first base of new DNA part<br>
 
CCTTCGTACGGACGACCTTC Tm = 58° C  112bp downstream first base of new DNA part<br>
 
<br>
 
<br>
 
<br>
 
<br>
113_actClone_SeqFor<br>
+
113_pClone_mScarlet_SeqFor<br>
GCATTAGAAACCGTCCATCG Tm = 64° C 73bp upstream first base of new DNA part<br>
+
 
113_actClone SeqRev<br>
 
CCATTAGAAACCATCCCTCG Tm = 63° C 119bp downstream first base of new DNA part<br>
 
 
<br>
 
<br>
 
<br>
 
<br>
113_repClone_SeqFor<br>
+
113_rClone_mScarlet_SeqRev<br>
CTAATTCAACAAGAATTGGGAC Tm = 60° C 65bp upstream first base of new DNA part<br>
+
 
 
<br>
 
<br>
 
<br>
 
<br>

Revision as of 11:08, 6 August 2018

Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence

  1. For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
  2. Add water to your DNA until the combined volume is 8 µL.
  3. To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
  4. Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.



Sequencing Primers to confirm Inserts v2.0
113_pClone_Red_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream first base of new DNA part


113_rClone_Red_SeqFor
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream first base of new DNA part


113_pClone_mScarlet_SeqFor



113_rClone_mScarlet_SeqRev