<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Bihatfield</id>
		<title>GcatWiki - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Bihatfield"/>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Special:Contributions/Bihatfield"/>
		<updated>2026-08-15T20:48:43Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.28.2</generator>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=19102</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=19102"/>
				<updated>2018-01-20T22:23:01Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Charcot-Marie-Tooth type 2D RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Davidson Bio113 Protocols]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=19101</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=19101"/>
				<updated>2018-01-20T22:22:41Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Charcot-Marie-Tooth type 2D RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Davidson Bio113 Protocols]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=19038</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=19038"/>
				<updated>2017-06-04T17:52:18Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=19037</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=19037"/>
				<updated>2017-06-04T17:51:58Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Protocols&amp;diff=19036</id>
		<title>Davidson Protocols</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Protocols&amp;diff=19036"/>
				<updated>2017-06-04T17:43:59Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''A. General Lab Information'''&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]&lt;br /&gt;
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]&lt;br /&gt;
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]&lt;br /&gt;
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]&lt;br /&gt;
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]] &lt;br /&gt;
# [[Pipet Tip Olympic Records]]&lt;br /&gt;
 &lt;br /&gt;
'''B. Gel Electrophoresis and Purification'''&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]&lt;br /&gt;
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]&lt;br /&gt;
&lt;br /&gt;
'''C. Digestion, Ligation, Transformation'''&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]&lt;br /&gt;
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]&lt;br /&gt;
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]&lt;br /&gt;
# [[TSS Competent Cells|TSS Competent Cell Transformation]]&lt;br /&gt;
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)''' &lt;br /&gt;
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU&lt;br /&gt;
# [[GGA for BsmBI]] modified to do everything in one tube&lt;br /&gt;
# [https://goldengate.neb.com/editor NEB GGA Assembler]&lt;br /&gt;
# [[Electroporation_Transformation]] written by collaborators at MWSU&lt;br /&gt;
# [[Electroporation - Campbell Old School Method]]&lt;br /&gt;
&lt;br /&gt;
'''D. Minipreps'''&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]&lt;br /&gt;
&lt;br /&gt;
'''E. Making New Parts and PCR'''&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]&lt;br /&gt;
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.''' &lt;br /&gt;
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio12/ The Loligator]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]&lt;br /&gt;
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''&lt;br /&gt;
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg&amp;lt;sup&amp;gt;2+&amp;lt;/sup&amp;gt; concentration]&lt;br /&gt;
# [[isolate genomic DNA from a single hair follicle]]&lt;br /&gt;
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)&lt;br /&gt;
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]&lt;br /&gt;
# PCR Primers '''VF2 = tgccacctgacgtctaagaa'''   '''VR primer = attaccgcctttgagtgagc'''&lt;br /&gt;
# [[Golden Gate Assembly protocol]]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]&lt;br /&gt;
# [[TAS2R38 PCR amplification]]&lt;br /&gt;
&lt;br /&gt;
'''F. Expression of Phenotypes'''&lt;br /&gt;
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]&lt;br /&gt;
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]&lt;br /&gt;
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO&amp;lt;sub&amp;gt;4&amp;lt;/sub&amp;gt;''' (2mL/L of 1 M MgSO&amp;lt;sub&amp;gt;4&amp;lt;/sub&amp;gt;) + '''0.1 mM CaCl&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;''' (0.1 mL/L 1 M CaCl&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;) and optional 0.2% glucose (10 mL/L 20% stock solution).&lt;br /&gt;
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.''' &lt;br /&gt;
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid. &lt;br /&gt;
# When inducing with Arabinose, use &amp;quot;2 µL of stock&amp;quot; (10% w/v L-Arabinose) &amp;quot;to every 1 mL&amp;quot; of LB or other liquid.&lt;br /&gt;
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold. &lt;br /&gt;
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a Kan&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved. &lt;br /&gt;
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]&lt;br /&gt;
# [[Synergy Machine Protocol]]&lt;br /&gt;
# [[M13 Bacteriophage Production Protocol]]&lt;br /&gt;
&lt;br /&gt;
'''G. Golden Gate Shuffling'''&lt;br /&gt;
# [[Media:DNAShuffling.docx]]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''H. Computer Tools We Use'''&lt;br /&gt;
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]&lt;br /&gt;
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]&lt;br /&gt;
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]&lt;br /&gt;
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]&lt;br /&gt;
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega T&amp;lt;sub&amp;gt;m&amp;lt;/sub&amp;gt; Calculator]&lt;br /&gt;
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion T&amp;lt;sub&amp;gt;m&amp;lt;/sub&amp;gt; Calculator]&lt;br /&gt;
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio12/ The Loligator]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]&lt;br /&gt;
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now&lt;br /&gt;
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]&lt;br /&gt;
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]&lt;br /&gt;
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]&lt;br /&gt;
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]&lt;br /&gt;
# [[Using Apes (A Plasmid Editor)]]&lt;br /&gt;
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]&lt;br /&gt;
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]&lt;br /&gt;
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]&lt;br /&gt;
&lt;br /&gt;
'''I. Making Selective Media'''&lt;br /&gt;
#[[Selecting for Tetracycline Sensitive E. coli]]&lt;br /&gt;
&lt;br /&gt;
==Bio113 Lab Protocols==&lt;br /&gt;
'''General Lab Resources'''&amp;lt;br&amp;gt;&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]&lt;br /&gt;
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Discovering New Promoters with Synthetic Biology'''&amp;lt;br&amp;gt;&lt;br /&gt;
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]&lt;br /&gt;
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA] &lt;br /&gt;
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]&lt;br /&gt;
# [[Golden Gate Assembly for Bio113]]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]&lt;br /&gt;
# [http://www.promega.com/biomath/calc11.htm Promega T&amp;lt;sub&amp;gt;m&amp;lt;/sub&amp;gt; Calculator]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio12/ The Loligator]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]&lt;br /&gt;
# [[Synergy Machine Protocol]]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]&lt;br /&gt;
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]&lt;br /&gt;
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]&lt;br /&gt;
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]&lt;br /&gt;
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''TAS2R38 Allele Testing'''&amp;lt;br&amp;gt;&lt;br /&gt;
# [[isolate genomic DNA from a single hair follicle]]&lt;br /&gt;
# [[TAS2R38 PCR amplification]]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]&lt;br /&gt;
# [http://www.promega.com/biomath/calc11.htm Promega T&amp;lt;sub&amp;gt;m&amp;lt;/sub&amp;gt; Calculator]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg&amp;lt;sup&amp;gt;2+&amp;lt;/sup&amp;gt; concentration]&lt;br /&gt;
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)&lt;br /&gt;
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]&lt;br /&gt;
# [[Using Apes (A Plasmid Editor)]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Evolution of Antibiotic Resistance'''&amp;lt;br&amp;gt;&lt;br /&gt;
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Protocols&amp;diff=19035</id>
		<title>Davidson Protocols</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Protocols&amp;diff=19035"/>
				<updated>2017-06-04T17:43:41Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''A. General Lab Information'''&lt;br /&gt;
test&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]&lt;br /&gt;
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]&lt;br /&gt;
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]&lt;br /&gt;
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]&lt;br /&gt;
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]] &lt;br /&gt;
# [[Pipet Tip Olympic Records]]&lt;br /&gt;
 &lt;br /&gt;
'''B. Gel Electrophoresis and Purification'''&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]&lt;br /&gt;
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]&lt;br /&gt;
&lt;br /&gt;
'''C. Digestion, Ligation, Transformation'''&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]&lt;br /&gt;
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]&lt;br /&gt;
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]&lt;br /&gt;
# [[TSS Competent Cells|TSS Competent Cell Transformation]]&lt;br /&gt;
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)''' &lt;br /&gt;
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU&lt;br /&gt;
# [[GGA for BsmBI]] modified to do everything in one tube&lt;br /&gt;
# [https://goldengate.neb.com/editor NEB GGA Assembler]&lt;br /&gt;
# [[Electroporation_Transformation]] written by collaborators at MWSU&lt;br /&gt;
# [[Electroporation - Campbell Old School Method]]&lt;br /&gt;
&lt;br /&gt;
'''D. Minipreps'''&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]&lt;br /&gt;
&lt;br /&gt;
'''E. Making New Parts and PCR'''&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]&lt;br /&gt;
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.''' &lt;br /&gt;
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio12/ The Loligator]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]&lt;br /&gt;
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''&lt;br /&gt;
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg&amp;lt;sup&amp;gt;2+&amp;lt;/sup&amp;gt; concentration]&lt;br /&gt;
# [[isolate genomic DNA from a single hair follicle]]&lt;br /&gt;
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)&lt;br /&gt;
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]&lt;br /&gt;
# PCR Primers '''VF2 = tgccacctgacgtctaagaa'''   '''VR primer = attaccgcctttgagtgagc'''&lt;br /&gt;
# [[Golden Gate Assembly protocol]]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]&lt;br /&gt;
# [[TAS2R38 PCR amplification]]&lt;br /&gt;
&lt;br /&gt;
'''F. Expression of Phenotypes'''&lt;br /&gt;
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]&lt;br /&gt;
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]&lt;br /&gt;
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO&amp;lt;sub&amp;gt;4&amp;lt;/sub&amp;gt;''' (2mL/L of 1 M MgSO&amp;lt;sub&amp;gt;4&amp;lt;/sub&amp;gt;) + '''0.1 mM CaCl&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;''' (0.1 mL/L 1 M CaCl&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;) and optional 0.2% glucose (10 mL/L 20% stock solution).&lt;br /&gt;
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.''' &lt;br /&gt;
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid. &lt;br /&gt;
# When inducing with Arabinose, use &amp;quot;2 µL of stock&amp;quot; (10% w/v L-Arabinose) &amp;quot;to every 1 mL&amp;quot; of LB or other liquid.&lt;br /&gt;
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold. &lt;br /&gt;
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a Kan&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved. &lt;br /&gt;
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]&lt;br /&gt;
# [[Synergy Machine Protocol]]&lt;br /&gt;
# [[M13 Bacteriophage Production Protocol]]&lt;br /&gt;
&lt;br /&gt;
'''G. Golden Gate Shuffling'''&lt;br /&gt;
# [[Media:DNAShuffling.docx]]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''H. Computer Tools We Use'''&lt;br /&gt;
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]&lt;br /&gt;
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]&lt;br /&gt;
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]&lt;br /&gt;
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]&lt;br /&gt;
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega T&amp;lt;sub&amp;gt;m&amp;lt;/sub&amp;gt; Calculator]&lt;br /&gt;
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion T&amp;lt;sub&amp;gt;m&amp;lt;/sub&amp;gt; Calculator]&lt;br /&gt;
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio12/ The Loligator]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]&lt;br /&gt;
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now&lt;br /&gt;
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]&lt;br /&gt;
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]&lt;br /&gt;
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]&lt;br /&gt;
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]&lt;br /&gt;
# [[Using Apes (A Plasmid Editor)]]&lt;br /&gt;
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]&lt;br /&gt;
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]&lt;br /&gt;
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]&lt;br /&gt;
&lt;br /&gt;
'''I. Making Selective Media'''&lt;br /&gt;
#[[Selecting for Tetracycline Sensitive E. coli]]&lt;br /&gt;
&lt;br /&gt;
==Bio113 Lab Protocols==&lt;br /&gt;
'''General Lab Resources'''&amp;lt;br&amp;gt;&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]&lt;br /&gt;
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Discovering New Promoters with Synthetic Biology'''&amp;lt;br&amp;gt;&lt;br /&gt;
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]&lt;br /&gt;
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA] &lt;br /&gt;
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]&lt;br /&gt;
# [[Golden Gate Assembly for Bio113]]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]&lt;br /&gt;
# [http://www.promega.com/biomath/calc11.htm Promega T&amp;lt;sub&amp;gt;m&amp;lt;/sub&amp;gt; Calculator]&lt;br /&gt;
# [http://gcat.davidson.edu/SynBio12/ The Loligator]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]&lt;br /&gt;
# [[Synergy Machine Protocol]]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]&lt;br /&gt;
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]&lt;br /&gt;
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]&lt;br /&gt;
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]&lt;br /&gt;
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''TAS2R38 Allele Testing'''&amp;lt;br&amp;gt;&lt;br /&gt;
# [[isolate genomic DNA from a single hair follicle]]&lt;br /&gt;
# [[TAS2R38 PCR amplification]]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]&lt;br /&gt;
# [http://www.promega.com/biomath/calc11.htm Promega T&amp;lt;sub&amp;gt;m&amp;lt;/sub&amp;gt; Calculator]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg&amp;lt;sup&amp;gt;2+&amp;lt;/sup&amp;gt; concentration]&lt;br /&gt;
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)&lt;br /&gt;
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]&lt;br /&gt;
# [[Using Apes (A Plasmid Editor)]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Evolution of Antibiotic Resistance'''&amp;lt;br&amp;gt;&lt;br /&gt;
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18845</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18845"/>
				<updated>2017-02-12T20:34:15Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18844</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18844"/>
				<updated>2017-02-12T20:34:03Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18843</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18843"/>
				<updated>2017-02-12T14:17:21Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18842</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18842"/>
				<updated>2017-02-12T14:17:07Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18841</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18841"/>
				<updated>2017-02-11T00:57:03Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18840</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18840"/>
				<updated>2017-02-11T00:56:43Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:ScreenshotOptIn.gif&amp;diff=18781</id>
		<title>File:ScreenshotOptIn.gif</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:ScreenshotOptIn.gif&amp;diff=18781"/>
				<updated>2017-01-25T20:49:29Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1030032.JPG&amp;diff=18757</id>
		<title>File:P1030032.JPG</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1030032.JPG&amp;diff=18757"/>
				<updated>2017-01-22T12:49:42Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1030012.JPG&amp;diff=18756</id>
		<title>File:P1030012.JPG</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1030012.JPG&amp;diff=18756"/>
				<updated>2017-01-22T10:28:16Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: Bihatfield uploaded a new version of File:P1030012.JPG&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1030012.JPG&amp;diff=18755</id>
		<title>File:P1030012.JPG</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1030012.JPG&amp;diff=18755"/>
				<updated>2017-01-22T09:56:58Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: Bihatfield uploaded a new version of File:P1030012.JPG&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1030011.JPG&amp;diff=18754</id>
		<title>File:P1030011.JPG</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1030011.JPG&amp;diff=18754"/>
				<updated>2017-01-22T07:13:43Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1030012.JPG&amp;diff=18753</id>
		<title>File:P1030012.JPG</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1030012.JPG&amp;diff=18753"/>
				<updated>2017-01-21T11:37:45Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1020996.JPG&amp;diff=18742</id>
		<title>File:P1020996.JPG</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1020996.JPG&amp;diff=18742"/>
				<updated>2017-01-19T21:17:28Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: Bihatfield uploaded a new version of File:P1020996.JPG&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1020996.JPG&amp;diff=18741</id>
		<title>File:P1020996.JPG</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:P1020996.JPG&amp;diff=18741"/>
				<updated>2017-01-19T21:02:04Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18677</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18677"/>
				<updated>2017-01-15T19:09:25Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18676</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18676"/>
				<updated>2017-01-15T19:09:00Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18675</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18675"/>
				<updated>2017-01-12T10:40:25Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18674</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18674"/>
				<updated>2017-01-12T10:39:20Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18673</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18673"/>
				<updated>2017-01-12T10:36:06Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18672</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18672"/>
				<updated>2017-01-12T10:35:05Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18671</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18671"/>
				<updated>2017-01-12T10:30:21Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18670</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18670"/>
				<updated>2017-01-12T10:29:46Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18669</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18669"/>
				<updated>2017-01-11T17:37:12Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18668</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18668"/>
				<updated>2017-01-11T17:36:47Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18667</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18667"/>
				<updated>2017-01-10T16:29:47Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18666</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18666"/>
				<updated>2017-01-10T16:29:03Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Mouse Down Syndrome ES RNAseq Project]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18646</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18646"/>
				<updated>2016-12-26T17:48:27Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18645</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18645"/>
				<updated>2016-12-26T17:44:15Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18644</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18644"/>
				<updated>2016-12-19T00:40:50Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18643</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18643"/>
				<updated>2016-12-19T00:40:25Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18642</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18642"/>
				<updated>2016-12-15T01:30:39Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18641</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18641"/>
				<updated>2016-12-15T01:30:16Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18640</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18640"/>
				<updated>2016-12-15T00:29:12Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18639</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18639"/>
				<updated>2016-12-15T00:28:51Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
This is a test&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18637</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18637"/>
				<updated>2016-07-31T01:09:41Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18636</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18636"/>
				<updated>2016-07-31T01:09:20Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
this is a test&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18635</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18635"/>
				<updated>2016-06-28T22:27:13Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18634</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18634"/>
				<updated>2016-06-28T22:26:52Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
this is a test&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=MWSU_protocols&amp;diff=18625</id>
		<title>MWSU protocols</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=MWSU_protocols&amp;diff=18625"/>
				<updated>2016-06-19T02:14:48Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Purification of DNA'''&lt;br /&gt;
&lt;br /&gt;
[[Isolation of Genomic DNA from Bacteria]]&lt;br /&gt;
&lt;br /&gt;
'''PCR'''&lt;br /&gt;
&lt;br /&gt;
[[iPCR]]&lt;br /&gt;
&lt;br /&gt;
[[Gradient/Standard PCR]]&lt;br /&gt;
&lt;br /&gt;
[[Resuspending Oligos]]&lt;br /&gt;
&lt;br /&gt;
[[Davidson_Missouri_W/colony_PCR | Colony PCR]]&lt;br /&gt;
&lt;br /&gt;
[[Template Preparation for RT-qPCR]]&lt;br /&gt;
&lt;br /&gt;
[[New Chaperone PCR]]&lt;br /&gt;
&lt;br /&gt;
[[LongAmp PCR]]&lt;br /&gt;
&lt;br /&gt;
'''Recombinant DNA Production'''&lt;br /&gt;
&lt;br /&gt;
[[Zymo Research Plasmid Minipreps]]&lt;br /&gt;
&lt;br /&gt;
[[Golden Gate Assembly Protocol]]&lt;br /&gt;
&lt;br /&gt;
[[Golden Gate Assembly Single Molecule Protocol]]&lt;br /&gt;
&lt;br /&gt;
[[Pouring an Agarose Gel]]&lt;br /&gt;
&lt;br /&gt;
[[BioBrick Digestions for Fragment and Vector Preparation]]&lt;br /&gt;
&lt;br /&gt;
[[Fragment Purification]]&lt;br /&gt;
&lt;br /&gt;
[[Gibson Assembly]]&lt;br /&gt;
&lt;br /&gt;
[[Direct Synthesis with Overlapping Oligos]]&lt;br /&gt;
&lt;br /&gt;
[[Annealing Oligos for Cloning]]&lt;br /&gt;
&lt;br /&gt;
[[Ethanol Precipitation of Vector DNA]]&lt;br /&gt;
&lt;br /&gt;
[[Reducing Background from Double Digested Vector]]&lt;br /&gt;
&lt;br /&gt;
[[File: PClone_Procedure_for_GCAT_SB_Workshop_2014_new_version.pptx]]&lt;br /&gt;
&lt;br /&gt;
'''Ligation and Transformation'''&lt;br /&gt;
&lt;br /&gt;
[[BioBrick Ligations]]&lt;br /&gt;
&lt;br /&gt;
[[Ligation and Transformation]]&lt;br /&gt;
&lt;br /&gt;
[[Electroporation Transformation]]&lt;br /&gt;
&lt;br /&gt;
[[SOC Protocol for Transformations]]&lt;br /&gt;
&lt;br /&gt;
'''Screening Clones'''&lt;br /&gt;
&lt;br /&gt;
[[Diagnostic RP Digestion for Checking Insert Size]]&lt;br /&gt;
&lt;br /&gt;
[[DNA Sequencing at Iowa State University]]&lt;br /&gt;
&lt;br /&gt;
[[What to do with a new clone]]&lt;br /&gt;
&lt;br /&gt;
'''Measuring Phenotypes'''&lt;br /&gt;
&lt;br /&gt;
[[Measuring Fluorescence in Bacteria]]&lt;br /&gt;
&lt;br /&gt;
[[Camera Settings for Taking Pictures of Plates]]&lt;br /&gt;
&lt;br /&gt;
'''DNA and E coli'''&lt;br /&gt;
&lt;br /&gt;
[[GCAT Library of Quality Parts]]&lt;br /&gt;
&lt;br /&gt;
[[MWSU Freezer Parts]]&lt;br /&gt;
&lt;br /&gt;
'''Working With Bacteria'''&lt;br /&gt;
&lt;br /&gt;
[[Bacterial Media]]&lt;br /&gt;
&lt;br /&gt;
[[Washing Beads]]&lt;br /&gt;
&lt;br /&gt;
[[Cleaning Plate Replication Pads]]&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=MWSU_protocols&amp;diff=18624</id>
		<title>MWSU protocols</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=MWSU_protocols&amp;diff=18624"/>
				<updated>2016-06-19T02:12:30Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
== WTH TEST ==&lt;br /&gt;
&lt;br /&gt;
'''Purification of DNA'''&lt;br /&gt;
&lt;br /&gt;
[[Isolation of Genomic DNA from Bacteria]]&lt;br /&gt;
&lt;br /&gt;
'''PCR'''&lt;br /&gt;
&lt;br /&gt;
[[iPCR]]&lt;br /&gt;
&lt;br /&gt;
[[Gradient/Standard PCR]]&lt;br /&gt;
&lt;br /&gt;
[[Resuspending Oligos]]&lt;br /&gt;
&lt;br /&gt;
[[Davidson_Missouri_W/colony_PCR | Colony PCR]]&lt;br /&gt;
&lt;br /&gt;
[[Template Preparation for RT-qPCR]]&lt;br /&gt;
&lt;br /&gt;
[[New Chaperone PCR]]&lt;br /&gt;
&lt;br /&gt;
[[LongAmp PCR]]&lt;br /&gt;
&lt;br /&gt;
'''Recombinant DNA Production'''&lt;br /&gt;
&lt;br /&gt;
[[Zymo Research Plasmid Minipreps]]&lt;br /&gt;
&lt;br /&gt;
[[Golden Gate Assembly Protocol]]&lt;br /&gt;
&lt;br /&gt;
[[Golden Gate Assembly Single Molecule Protocol]]&lt;br /&gt;
&lt;br /&gt;
[[Pouring an Agarose Gel]]&lt;br /&gt;
&lt;br /&gt;
[[BioBrick Digestions for Fragment and Vector Preparation]]&lt;br /&gt;
&lt;br /&gt;
[[Fragment Purification]]&lt;br /&gt;
&lt;br /&gt;
[[Gibson Assembly]]&lt;br /&gt;
&lt;br /&gt;
[[Direct Synthesis with Overlapping Oligos]]&lt;br /&gt;
&lt;br /&gt;
[[Annealing Oligos for Cloning]]&lt;br /&gt;
&lt;br /&gt;
[[Ethanol Precipitation of Vector DNA]]&lt;br /&gt;
&lt;br /&gt;
[[Reducing Background from Double Digested Vector]]&lt;br /&gt;
&lt;br /&gt;
[[File: PClone_Procedure_for_GCAT_SB_Workshop_2014_new_version.pptx]]&lt;br /&gt;
&lt;br /&gt;
'''Ligation and Transformation'''&lt;br /&gt;
&lt;br /&gt;
[[BioBrick Ligations]]&lt;br /&gt;
&lt;br /&gt;
[[Ligation and Transformation]]&lt;br /&gt;
&lt;br /&gt;
[[Electroporation Transformation]]&lt;br /&gt;
&lt;br /&gt;
[[SOC Protocol for Transformations]]&lt;br /&gt;
&lt;br /&gt;
'''Screening Clones'''&lt;br /&gt;
&lt;br /&gt;
[[Diagnostic RP Digestion for Checking Insert Size]]&lt;br /&gt;
&lt;br /&gt;
[[DNA Sequencing at Iowa State University]]&lt;br /&gt;
&lt;br /&gt;
[[What to do with a new clone]]&lt;br /&gt;
&lt;br /&gt;
'''Measuring Phenotypes'''&lt;br /&gt;
&lt;br /&gt;
[[Measuring Fluorescence in Bacteria]]&lt;br /&gt;
&lt;br /&gt;
[[Camera Settings for Taking Pictures of Plates]]&lt;br /&gt;
&lt;br /&gt;
'''DNA and E coli'''&lt;br /&gt;
&lt;br /&gt;
[[GCAT Library of Quality Parts]]&lt;br /&gt;
&lt;br /&gt;
[[MWSU Freezer Parts]]&lt;br /&gt;
&lt;br /&gt;
'''Working With Bacteria'''&lt;br /&gt;
&lt;br /&gt;
[[Bacterial Media]]&lt;br /&gt;
&lt;br /&gt;
[[Washing Beads]]&lt;br /&gt;
&lt;br /&gt;
[[Cleaning Plate Replication Pads]]&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18623</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Main_Page&amp;diff=18623"/>
				<updated>2016-06-18T17:56:52Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;br&amp;gt;&lt;br /&gt;
To request GcatWiki write Access to the Wiki, Contact [http://gcat.davidson.edu/WikiAccess/GcatWikiAccessRequest.php Dr Malcolm Campbell]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/Davidson_Protocols Davidson Protocols]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[http://gcat.davidson.edu/Gcatwiki/index.php/MWSU_protocols MWSU Protocols]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2014 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Ethics and Philosophy of SynBio]]== &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2013 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==[[Education Research by Caylyn Harvey]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Burmese Python RNAseq Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[iRobot Energy Saver Project]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Summer 2012 SynBio Project (Davidson and MWSU)]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Synthetic Biology Network Research]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Genome Assembly Project: Leland Taylor '12]]==&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Blueberry Genome Project for Bio343]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Halomicrobium mukohataei Genome Fall 2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Halorhabdus utahensis Genome]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
==[[Network Research with Synthetic Biology]]==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson SynBio 2011]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2010]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Missouri Western/Davidson iGEM2009]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Davidson/Missouri Western iGEM2008]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[MAGIC Tool Development]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
== [[Nova Southeastern University]] ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== [[Davidson College]]==  Small liberal arts college near Charlotte, NC. &lt;br /&gt;
A. Malcolm Campbell and Laurie J. Heyer GCAT faculty&lt;br /&gt;
&lt;br /&gt;
* [http://gcat.davidson.edu/GcatWiki/index.php/User:Kahaynes Karmella A. Haynes], Visiting Assitant Professor of Biology&lt;br /&gt;
&lt;br /&gt;
* [[A_Review_of_Synthetic_Biology |A Review of Synthetic Biology]] - Davidson College Synthetic Biology Seminar (Fall 2007)&lt;br /&gt;
&lt;br /&gt;
* [[Laboratory Notebooks]]&lt;br /&gt;
&lt;br /&gt;
* [[2009-2010 Biology Curriculum Wiki]]&lt;br /&gt;
&lt;br /&gt;
* [[Team 5: Information Technology Initiatives]]&lt;br /&gt;
&lt;br /&gt;
* [[Biological Noise and Possible Uses]]&lt;br /&gt;
&lt;br /&gt;
* [[New Intro Bio Approach]]&lt;br /&gt;
&lt;br /&gt;
== [[Swarthmore College]]==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
----&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
Please see [http://meta.wikipedia.org/wiki/MediaWiki_i18n documentation on customizing the interface]&lt;br /&gt;
and the [http://meta.wikipedia.org/wiki/MediaWiki_User%27s_Guide User's Guide] for usage and configuration help.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/GCAT GCAT Main Page]&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - bacterial communication with light.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge  - they talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech - They say, “Bistability and cell-cell communication are necessary to realize our model of ‘Balanced differentiation’.”&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:Kids.JPG&amp;diff=15631</id>
		<title>File:Kids.JPG</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:Kids.JPG&amp;diff=15631"/>
				<updated>2013-02-12T20:58:52Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Missouri_Western/Davidson_iGEM2010&amp;diff=12770</id>
		<title>Missouri Western/Davidson iGEM2010</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Missouri_Western/Davidson_iGEM2010&amp;diff=12770"/>
				<updated>2011-03-30T02:23:00Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This space will be used starting January, 2010 for brainstorming and a shared whiteboard space.&lt;br /&gt;
&lt;br /&gt;
[[Davidson_Missouri_W/Davidson_Protocols]] &amp;lt;br&amp;gt;&lt;br /&gt;
[[Davidson_Missouri_W/MWSU_protocols]] &amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/sybr-u/bmc.html BioMath Connections Page] &amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/GCATalog GCAT-alog Freezer Stocks]&amp;lt;br&amp;gt;&lt;br /&gt;
[[Laboratory_Notebooks]]&amp;lt;br&amp;gt;&lt;br /&gt;
[[Data Folder 2010]]&lt;br /&gt;
[[Bio-Math Connections January - May 2010]]&lt;br /&gt;
&lt;br /&gt;
[[iGEM 2010 Project]]&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:Test.zip&amp;diff=12719</id>
		<title>File:Test.zip</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:Test.zip&amp;diff=12719"/>
				<updated>2011-03-16T01:26:49Z</updated>
		
		<summary type="html">&lt;p&gt;Bihatfield: test zip file&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;test zip file&lt;/div&gt;</summary>
		<author><name>Bihatfield</name></author>	</entry>

	</feed>