<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=KeDavis</id>
		<title>GcatWiki - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=KeDavis"/>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Special:Contributions/KeDavis"/>
		<updated>2026-08-15T16:53:17Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.28.2</generator>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Missouri_W/Davidson_Protocols&amp;diff=5908</id>
		<title>Davidson Missouri W/Davidson Protocols</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Missouri_W/Davidson_Protocols&amp;diff=5908"/>
				<updated>2008-07-10T20:30:48Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]&lt;br /&gt;
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]&lt;br /&gt;
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg&amp;lt;sup&amp;gt;2+&amp;lt;/sup&amp;gt; concentration]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA (after PCR, before digestion)]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]&lt;br /&gt;
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate DNA (short protocol)]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gels2002/1kbladder.pdf 1kb MW markers]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]&lt;br /&gt;
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]&lt;br /&gt;
&lt;br /&gt;
'''Web Tools We Use'''&lt;br /&gt;
#[http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]&lt;br /&gt;
#[http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]&lt;br /&gt;
#[http://gcat.davidson.edu/StudentProjects/womp/testwebsite.html PCR Primers w/ BioBricks]&lt;br /&gt;
# [http://www.promega.com/biomath/calc11.htm Promega T&amp;lt;sub&amp;gt;m&amp;lt;/sub&amp;gt; Calculator]&lt;br /&gt;
# [http://partsregistry.org/AHL List of auto-inducers and their Sigma catalog numbers]&lt;br /&gt;
#[[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]&lt;br /&gt;
#[http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly]&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Missouri_W/Davidson_Protocols&amp;diff=5826</id>
		<title>Davidson Missouri W/Davidson Protocols</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson_Missouri_W/Davidson_Protocols&amp;diff=5826"/>
				<updated>2008-07-03T15:17:20Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]&lt;br /&gt;
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]&lt;br /&gt;
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg&amp;lt;sup&amp;gt;2+&amp;lt;/sup&amp;gt; concentration]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA (after PCR, before digestion)]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]&lt;br /&gt;
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate DNA (short protocol)]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gels2002/1kbladder.pdf 1kb MW markers]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]&lt;br /&gt;
#[http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]&lt;br /&gt;
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]&lt;br /&gt;
&lt;br /&gt;
'''Web Tools We Use'''&lt;br /&gt;
#[http://gcat.davidson.edu/StudentProjects/mwk/gelwebsite/gelwebsite.html Optimize your Gel]&lt;br /&gt;
#[http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]&lt;br /&gt;
#[http://gcat.davidson.edu/StudentProjects/womp/testwebsite.html PCR Primers w/ BioBricks]&lt;br /&gt;
# [http://www.promega.com/biomath/calc11.htm Promega T&amp;lt;sub&amp;gt;m&amp;lt;/sub&amp;gt; Calculator]&lt;br /&gt;
# [http://partsregistry.org/AHL List of auto-inducers and their Sigma catalog numbers]&lt;br /&gt;
#[[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]&lt;br /&gt;
#[http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly]&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:PLasXOR.jpg&amp;diff=5431</id>
		<title>File:PLasXOR.jpg</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:PLasXOR.jpg&amp;diff=5431"/>
				<updated>2008-06-23T20:05:47Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:PLasXOR_Oligos.jpg&amp;diff=5430</id>
		<title>File:PLasXOR Oligos.jpg</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:PLasXOR_Oligos.jpg&amp;diff=5430"/>
				<updated>2008-06-23T20:00:44Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:PLas%27_oligos_diagram.jpg&amp;diff=5429</id>
		<title>File:PLas' oligos diagram.jpg</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:PLas%27_oligos_diagram.jpg&amp;diff=5429"/>
				<updated>2008-06-23T19:56:51Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=File:PLasOligos.jpg&amp;diff=5428</id>
		<title>File:PLasOligos.jpg</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=File:PLasOligos.jpg&amp;diff=5428"/>
				<updated>2008-06-23T19:50:42Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Oligos_to_Build&amp;diff=5424</id>
		<title>Oligos to Build</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Oligos_to_Build&amp;diff=5424"/>
				<updated>2008-06-20T20:32:21Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Lac System''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|luxS|| [[Image:luxS_forward.jpg]] || [[Image:lux_s_rev.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|lacIQ1 Promoter|| [[Image:placiq1_forward.jpg]] || [[Image:lacIq1reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|lacIQ Promoter|| [[Image:lacIqforwardprimer.jpg]] || [[Image:lacIqreversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12||[[Image:LacI_I12forwardprimer.jpg]]  || [[Image:LacI_I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI|| [[Image:LacIforwardprimer.jpg]] || [[Image:LacIreversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_X86 (Primers for step 1 of PCR)|| [[Image:LacIforwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|LacI_I12X86 (Primers for step 1 of PCR)|| [[Image:LacI_I12forwardprimer.jpg]] || [[Image:X86_X86I12reversecomplement.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Lsr System''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|lsrR|| [[Image:lsr_forward.jpg]] || [[Image:lsr_r_rev.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|lsrK|| [[Image:lsrK_forward.jpg]] || [[Image:lsrk_rev.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|plsr||[[Image:plsr_forward.jpg]]|| [[Image:pLsr.jpg]] &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Davidson XOR Promoters''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Oligos&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Oligo Design&lt;br /&gt;
|-&lt;br /&gt;
|lpLas'|| [[Image:pLasOligos.jpg]] || [[Image:pLas' oligos diagram.jpg]]&lt;br /&gt;
|-&lt;br /&gt;
|pLasXOR|| [[Image:pLasXOR Oligos.jpg]] || [[Image:pLasXOR.jpg]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== '''Sequences of Parts to Build''' ==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''LuxS Wildtype from MG1655'''&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
ATGCCGTTGT TAGATAGCTT CACAGTCGAT CATACCCGGA TGGAAGCGCC TGCAGTTCGG&lt;br /&gt;
GTGGCGAAAA CAATGAACAC CCCGCATGGC GACGCAATCA CCGTGTTCGA TCTGCGCTTC&lt;br /&gt;
TGCGTGCCGA ACAAAGAAGT GATGCCAGAA AGAGGGATCC ATACCCTGGA GCACCTGTTT&lt;br /&gt;
GCTGGTTTTA TGCGTAACCA TCTTAACGGT AATGGTGTAG AGATTATCGA TATCTCGCCA&lt;br /&gt;
ATGGGCTGCC GCACCGGTTT TTATATGAGT CTGATTGGTA CGCCAGATGA GCAGCGTGTT&lt;br /&gt;
GCTGATGCCT GGAAAGCGGC AATGGAAGAC GTGCTGAAAG TGCAGGATCA GAATCAGATC&lt;br /&gt;
CCGGAACTGA ACGTCTACCA GTGTGGCACT TACCAGATGC ACTCGTTGCA GGAAGCGCAG&lt;br /&gt;
GATATTGCGC GTAGCATTCT GGAACGTGAC GTACGCATCA ACAGCAACGA AGAACTGGCA&lt;br /&gt;
CTGCCGAAAG AGAAGTTGCA GGAACTGCAC ATCTAG&lt;br /&gt;
&lt;br /&gt;
Map Position: 2,812,240 &amp;lt;- 2,812,755 (nucleotides)&lt;br /&gt;
&lt;br /&gt;
Sequence Length: 516 bp / 171 AAs &lt;br /&gt;
&lt;br /&gt;
'''Mutated LuxS''' &lt;br /&gt;
&lt;br /&gt;
Nucleotide position 54 changed from A to T in order to destroy a PstI site; this is a sense mutation&lt;br /&gt;
&lt;br /&gt;
Also changed stop codon from TAG to TAA (recommended in Registry Help)&lt;br /&gt;
&lt;br /&gt;
ATGCCGTTGT TAGATAGCTT CACAGTCGAT CATACCCGGA TGGAAGCGCC TGC'''T'''GTTCGG&lt;br /&gt;
GTGGCGAAAA CAATGAACAC CCCGCATGGC GACGCAATCA CCGTGTTCGA TCTGCGCTTC&lt;br /&gt;
TGCGTGCCGA ACAAAGAAGT GATGCCAGAA AGAGGGATCC ATACCCTGGA GCACCTGTTT&lt;br /&gt;
GCTGGTTTTA TGCGTAACCA TCTTAACGGT AATGGTGTAG AGATTATCGA TATCTCGCCA&lt;br /&gt;
ATGGGCTGCC GCACCGGTTT TTATATGAGT CTGATTGGTA CGCCAGATGA GCAGCGTGTT&lt;br /&gt;
GCTGATGCCT GGAAAGCGGC AATGGAAGAC GTGCTGAAAG TGCAGGATCA GAATCAGATC&lt;br /&gt;
CCGGAACTGA ACGTCTACCA GTGTGGCACT TACCAGATGC ACTCGTTGCA GGAAGCGCAG&lt;br /&gt;
GATATTGCGC GTAGCATTCT GGAACGTGAC GTACGCATCA ACAGCAACGA AGAACTGGCA&lt;br /&gt;
CTGCCGAAAG AGAAGTTGCA GGAACTGCAC ATCTA'''A'''&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''LsrR Gene'''&lt;br /&gt;
&lt;br /&gt;
ATGACAATCA ACGATTCGGC AATTTCAGAA CAGGGAATGT GTGAAGAAGA ACAGGTCGCG&lt;br /&gt;
CGGATCGCGT GGTTTTACTA TCACGACGGG CTGACCCAGA GCGAGATCAG CGATCGTCTC&lt;br /&gt;
GGCCTGACAC GTTTGAAAGT GTCGCGATTG CTGGAGAAAG GGCATCAGTC CGGCATTATT&lt;br /&gt;
CGCGTACAGA TTAATTCTCG CTTTGAAGGC TGTCTGGAAT ATGAAACTCA ATTACGTCGT&lt;br /&gt;
CAGTTTTCGC TGCAACATGT CCGGGTGATC CCTGGGCTTG CGGATGCTGA TGTCGGTGGG&lt;br /&gt;
CGACTGGGGA TAGGCGCGGC GCATATGTTG ATGAGTTTAC TTCAACCACA ACAGATGCTG&lt;br /&gt;
GCGATTGGTT TTGGCGAGGC AACCATGAAT ACGCTGCAAC GCTTAAGTGG TTTTATTTCG&lt;br /&gt;
TCACAGCAAA TTCGCCTGGT CACGCTCTCC GGTGGCGTCG GTTCTTATAT GACGGGAATC&lt;br /&gt;
GGGCAGCTTA ACGCGGCGTG CAGTGTGAAT ATTATTCCGG CTCCGTTGCG GGCATCCTCC&lt;br /&gt;
GCTGACATTG CCCGTACGCT AAAAAATGAA AATTGCGTCA AAGATGTTCT GTTAGCCGCG&lt;br /&gt;
CAAGCAGCGG ATGTGGCGAT TGTCGGCATT GGTGCTGTGA GTCAACAGGA CGATGCGACA&lt;br /&gt;
ATCATTCGCT CCGGTTATAT CAGCCAGGGC GAACAGTTAA TGATTGGCCG AAAAGGGGCG&lt;br /&gt;
GTTGGCGACA TTTTAGGCTA CTTTTTTGAT GCAAAAGGTG ACGTTGTCAC GAATATCAAA&lt;br /&gt;
ATACATAACG AACTGATTGG CTTACCTTTA AGCGCGCTGA AGACCATACC CGTCCGGGTT&lt;br /&gt;
GGCGTGGCAG GGGGAGAAAA TAAAGCCGAA GCAATTGCCG CTGCAATGAA AGGCGGTTAT&lt;br /&gt;
ATCAACGCAC TGGTTACCGA TCAGGACACA GCAGCGGCGA TTTTACGTAG TTAA&lt;br /&gt;
&lt;br /&gt;
Map Position: 1,598,312 &amp;lt;- 1,599,265 (nucleotides)&lt;br /&gt;
&lt;br /&gt;
Sequence Length: 954bp/317 AAs&lt;br /&gt;
&lt;br /&gt;
'''LsrK Gene'''&lt;br /&gt;
&lt;br /&gt;
atgGCTCGAC TCTTTACCCT TTCAGAATCA AAGTACTACC TGATGGCGCT GGATGCAGGC&lt;br /&gt;
ACCGGAAGTA TTCGGGCTGT GATATTCGAC CTGGAAGGCA ATCAAATAGC AGTGGGACAG&lt;br /&gt;
GCGGAGTGGC GGCATCTGGC AGTACCGGAC GTTCCTGGTT CTATGGAATT TGATCTCAAC&lt;br /&gt;
AAAAACTGGC AACTGGCGTG TGAGTGTATG CGCCAGGCGC TGCACAACGC CGGCATAGCC&lt;br /&gt;
CCGGAGTATA TCGCTGCCGT TTCGGCATGT TCGATGCGTG AAGGCATTGT TTTATATAAT&lt;br /&gt;
AATGAAGGAG CCCCGATCTG GGCCTGCGCC AATGTGGATG CCAGAGCGGC ACGCGAAGTT&lt;br /&gt;
AGCGAACTTA AAGAACTGCA CAACAATACC TTTGAAAACG AAGTTTATCG CGCGACCGGA&lt;br /&gt;
CAAACACTGG CTTTAAGTGC CATCCCCAGA TTACTTTGGC TGGCGCACCA TCGTTCCGAT&lt;br /&gt;
ATTTACCGTC AGGCATCAAC CATCACCATG ATCAGCGACT GGCTGGCCTA TATGCTCAGC&lt;br /&gt;
GGCGAACTGG CGGTGGATCC CTCTAACGCT GGCACCACGG GACTTCTTGA TCTAACCACC&lt;br /&gt;
CGTGACTGGA AACCTGCATT GCTGGATATG GCTGGCCTAC GTGCCGATAT TCTTTCTCCT&lt;br /&gt;
GTCAAAGAAA CCGGCACATT GCTGGGCGTG GTAAGTTCAC AAGCGGCGGA ACTCTGCGGT&lt;br /&gt;
CTGAAGGCGG GCACTCCGGT GGTCGTTGGA GGAGGCGACG TGCAGCTTGG TTGCCTTGGG&lt;br /&gt;
TTAGGCGTTG TGCGTCCGGC ACAAACCGCG GTTCTTGGCG GCACATTCTG GCAGCAAGTT&lt;br /&gt;
GTAAATTTAG CCGCGCCGGT GACAGACCCA GAAATGAACG TGCGCGTTAA TCCTCATGTT&lt;br /&gt;
ATTCCTGGCA TGGTACAAGC TGAATCTATA AGCTTTTTTA CCGGACTCAC CATGCGCTGG&lt;br /&gt;
TTCCGCGATG CTTTCTGTGC CGAAGAAAAA CTGATTGCCG AACGTTTAGG CATCGACACC&lt;br /&gt;
TATACGCTGC TGGAAGAGAT GGCCAGTCGG GTGCCGCCTG GGTCGTGGGG CGTAATGCCG&lt;br /&gt;
ATCTTCTCCG ACAGAATGCG CTTTAAAACC TGGTATCACG CTGCGCCTTC CTTTATTAAC&lt;br /&gt;
TTGTCCATTG ACCCGGATAA ATGTAACAAA GCGACATTGT TCCGTGCGCT GGAAGAAAAT&lt;br /&gt;
GCGGCGATTG TATCAGCGTG TAACTTGCAG CAAATTGCTG ATTTCTCGAA TATTCATCCT&lt;br /&gt;
TCATCGTTAG TCTTTGCAGG CGGAGGTTCA AAAGGGAAAT TATGGAGTCA AATTCTCGCT&lt;br /&gt;
GATGTCTCGG GATTACCCGT CAATATTCCG GTGGTCAAAG AAGCCACTGC ATTAGGATGT&lt;br /&gt;
GCCATTGCAG CTGGCGTCGG TGCCGGAATT TTTTCATCAA TGGCAGAAAC CGGAGAACGC&lt;br /&gt;
CTGGTTCGCT GGGAACGGAC GCACACACCA GACCCGGAAA AGCATGAACT TTATCAGGAT&lt;br /&gt;
TCACGCGATA AGTGGCAGGC AGTTTATCAG GATCAGCTGG GGCTGGTTGA TCATGGACTG&lt;br /&gt;
ACGACGTCGT TATGGAAAGC GCCTGGGTTA TAG&lt;br /&gt;
&lt;br /&gt;
Map Position: 1,596,641 &amp;lt;- 1,598,233 (nucleotides)  	&lt;br /&gt;
&lt;br /&gt;
Sequence Length: 1593 bp / 530 AAs&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''lsr promoter sequence'''&amp;lt;br&amp;gt;&lt;br /&gt;
[[Image:plsr.jpg]] &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''LacI wild-type gene sequence''' (ORF begins at the first amino acid)&amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC &amp;lt;br&amp;gt;GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA &amp;lt;br&amp;gt;ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC &amp;lt;br&amp;gt;AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCATCA&amp;lt;br&amp;gt;ACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCG &amp;lt;br&amp;gt;CGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGC &amp;lt;br&amp;gt;TGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGT&amp;lt;br&amp;gt;GGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAG &amp;lt;br&amp;gt;GGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC &amp;lt;br&amp;gt;AGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''LacI_I12 Mutation''' (amino acid 3 is changed from CCA to TAT) &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&amp;lt;br&amp;gt;GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&amp;lt;br&amp;gt;ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&amp;lt;br&amp;gt;AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&amp;lt;br&amp;gt;ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&amp;lt;br&amp;gt;GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&amp;lt;br&amp;gt;CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&amp;lt;br&amp;gt;TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&amp;lt;br&amp;gt;GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&amp;lt;br&amp;gt;CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''LacI_X86 Mutation''' (amino acid 61 is changed from TCG to CTG) &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGC&amp;lt;br&amp;gt;GGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA&amp;lt;br&amp;gt;ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC&amp;lt;br&amp;gt;AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCC&amp;lt;br&amp;gt;ATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGC&amp;lt;br&amp;gt;GCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATG&amp;lt;br&amp;gt;CTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAG&amp;lt;br&amp;gt;TGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCA&amp;lt;br&amp;gt;GGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATG&amp;lt;br&amp;gt;CAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''LacI_I12_X86 Mutation''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATGAAATATGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAG&amp;lt;br&amp;gt;CTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGCTGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCC&amp;lt;br&amp;gt;GATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC&amp;lt;br&amp;gt;CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATC&amp;lt;br&amp;gt;TGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGG&amp;lt;br&amp;gt;AAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGT&amp;lt;br&amp;gt;CCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACC&amp;lt;br&amp;gt;GCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCAT&amp;lt;br&amp;gt;TAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA&lt;br /&gt;
&lt;br /&gt;
'''LacI Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''LacIQ Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
CGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''LacIQ1 Promoter''' &amp;lt;br&amp;gt;&lt;br /&gt;
AGCGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAGCGCCCGG &amp;lt;br&amp;gt;&lt;br /&gt;
-These promoter sequences are taken from Glascock and Weickert 1998&lt;br /&gt;
&lt;br /&gt;
'''TrpR Operator Sequence Only''' &amp;lt;br&amp;gt;&lt;br /&gt;
ATATGCTATCGTACTCTTTAGCGAGTACAACCGGGGGA&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Oligos_to_Build&amp;diff=5089</id>
		<title>Oligos to Build</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Oligos_to_Build&amp;diff=5089"/>
				<updated>2008-06-09T13:29:51Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''Lac System''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Lsr System''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Forward&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Reverse&lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|-&lt;br /&gt;
|###|| ### || ### &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=5088</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=5088"/>
				<updated>2008-06-09T13:20:41Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
# [[Status Of Building Parts]]&lt;br /&gt;
# [[Divide and Conquer Biological Challenges]]&lt;br /&gt;
# [http://en.wikipedia.org/wiki/Logic_gates#Symbols Logic Gates in Wikipedia]&lt;br /&gt;
# [http://www.bio.davidson.edu/Courses/Synthetic/papers/LuxR.pdf Build a LuxR Repressor '''PDF Reprint''']&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [[Using Amp and Amp^R as communication]]&lt;br /&gt;
# [http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
# [[Oligos to Build]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
'''Things to Do'''&lt;br /&gt;
&lt;br /&gt;
#  Experiment with making lines of media in petri dishes.&lt;br /&gt;
# Determine concentration of HSL needed to turn on our receiver + reporter. Compare with [http://partsregistry.org/wiki/index.php?title=Part:BBa_T9002 BBa_T9002]&lt;br /&gt;
# Determine what percent of a colony need to be sender cells in order for an entire colony to become switched on by HSL.&lt;br /&gt;
# We need to make sender and receiver cells (using existing sub-parts such as [http://partsregistry.org/wiki/index.php?title=Part:BBa_F1610 F1610]), and/or take from registry (''e.g.'', [http://partsregistry.org/wiki/index.php?title=Part:BBa_T9002 BBa_T9002])&lt;br /&gt;
# Design experiments to test the distance HSL and beta lactamase can diffuse in agar and over what time spans. &lt;br /&gt;
# Make a derived pLac promoter that will permit LuxR+HSL to be a repressor to be used in combination with Lux pR promoter. [http://www.bio.davidson.edu/Courses/Synthetic/papers/LuxR.pdf See this paper.]Andrew Gordon, Robert Cool&lt;br /&gt;
# Make an Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; sender device. Look for Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; basic part in Registry. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || 1001 12B pSB1A2 || amp || growth MW  ||no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || 1015 8F pSB3K3 || kan || growth MW || no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| 1002 8E pSB1A2 || amp || growth MW &amp;amp; DC || yes 210ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || 1001 12E pSB1A2 || amp || no growth || no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || 1016 10D pSB1AK3 || amp &amp;amp; kan || growth MW || no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || 1008 5B pSB1A2 || amp || growth MW &amp;amp; DC || yes 210ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || 1008 4F pSB1A2 || amp || growth MW &amp;amp; DC || yes 76.37ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || 1001 5C pSB1A2 || amp || growth MW || yes 129.7ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2620|| Device receives 3OC6HSL outputs PoPS || Robert Cool (MW) || 1001 12D pSB1A2 || amp || growth MW || yes 83ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || 1000 3E pSB1A2 || amp || growth MW || yes 143ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || 1001 8B pSB1A2 || amp ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || 1000 3F pSB1A2 || amp ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || 1000 4H pSB1A2 || amp ||  ||yes 8.86 ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || 1000 4G pSB1A2 || amp ||  ||yes 62.4ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || 1013 3E pSB2K3 || kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || 1013 3F pSB2K3 || kan || no growth ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || MWSU || 1001 6F pSB1A2 || amp || ||no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || 1001 10F pSB1A2 || amp ||  ||yes 117.2ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || 1013 4F pSB2K3 || kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || 1013 4E pSB2K3 || kan ||   ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry|| || || &lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Fluorescent Protein Gradient Testers''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04450 || [http://partsregistry.org/Part:BBa_J04450 Lac-RBS-RFP-T] || Robert Cool (MW) ||1004 4f pSB1A2 || amp ||  ||yes 183ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04451 || [http://partsregistry.org/Part:BBa_J04451 pLac-RBS-RFP w/ LVA tag-T-T] || Erin Feeney  and Kelly Davis (DC) ||1016 9F pSB1AK3 || amp and kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13520 || [http://partsregistry.org/Part:BBa_I13520 pBAD-RBS-mRFP-T-T] || Erin Feeney and Kelly Davis (DC) || 1009 7B pSB1A2 || amp ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J5528 || [http://partsregistry.org/Part:BBa_J5528 pBAD-RBS-GFP-T-T] || Erin Feeney and Kelly Davis (DC)  || 1015 7A pSB2K3 || kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04430 || [http://partsregistry.org/Part:BBa_J04430 pLac-RBS-GFP-T-T] || Erin Feeney and Kelly Davis (DC)  || 1004 4H pSB1A2 || amp ||  ||yes 143ng/ml&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Parts for Sending and Receiving Signals''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || [http://partsregistry.org/Part:BBa_J07019 fec A promoter with fur box]|| James Barron (DC) || Not in Registry-Needs to be amplified || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2622 || [http://partsregistry.org/Part:BBa_F2622 3OC6HSL Receiver Device]|| Pallavi Penumetcha (DC) ||1001 12e pSB1A2 || amp || ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I14032 || [http://partsregistry.org/Part:BBa_I14032 pLac promoter]|| Pallavi Penumetcha (DC) || 1013 8e pSB2K3 || kan || ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_S03632 || [http://partsregistry.org/Part:BBa_S03632 lacI promoter and luxI gene]|| Pallavi Penumetcha (DC) || 1016 7f pSB1AK3 || amp and kan || ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_E0240 || [http://partsregistry.org/Part:BBa_E0240 RBS and GFP]|| Pallavi Penumetcha (DC) || 1001 4B pSB1A2 || amp ||  ||yes 130ng/ml&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=5087</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=5087"/>
				<updated>2008-06-09T13:19:00Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
# [[Status Of Building Parts]]&lt;br /&gt;
# [[Divide and Conquer Biological Challenges]]&lt;br /&gt;
# [http://en.wikipedia.org/wiki/Logic_gates#Symbols Logic Gates in Wikipedia]&lt;br /&gt;
# [http://www.bio.davidson.edu/Courses/Synthetic/papers/LuxR.pdf Build a LuxR Repressor '''PDF Reprint''']&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [[Using Amp and Amp^R as communication]]&lt;br /&gt;
# [http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
'''Things to Do'''&lt;br /&gt;
&lt;br /&gt;
#  Experiment with making lines of media in petri dishes.&lt;br /&gt;
# Determine concentration of HSL needed to turn on our receiver + reporter. Compare with [http://partsregistry.org/wiki/index.php?title=Part:BBa_T9002 BBa_T9002]&lt;br /&gt;
# Determine what percent of a colony need to be sender cells in order for an entire colony to become switched on by HSL.&lt;br /&gt;
# We need to make sender and receiver cells (using existing sub-parts such as [http://partsregistry.org/wiki/index.php?title=Part:BBa_F1610 F1610]), and/or take from registry (''e.g.'', [http://partsregistry.org/wiki/index.php?title=Part:BBa_T9002 BBa_T9002])&lt;br /&gt;
# Design experiments to test the distance HSL and beta lactamase can diffuse in agar and over what time spans. &lt;br /&gt;
# Make a derived pLac promoter that will permit LuxR+HSL to be a repressor to be used in combination with Lux pR promoter. [http://www.bio.davidson.edu/Courses/Synthetic/papers/LuxR.pdf See this paper.]Andrew Gordon, Robert Cool&lt;br /&gt;
# Make an Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; sender device. Look for Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; basic part in Registry. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || 1001 12B pSB1A2 || amp || growth MW  ||no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || 1015 8F pSB3K3 || kan || growth MW || no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| 1002 8E pSB1A2 || amp || growth MW &amp;amp; DC || yes 210ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || 1001 12E pSB1A2 || amp || no growth || no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || 1016 10D pSB1AK3 || amp &amp;amp; kan || growth MW || no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || 1008 5B pSB1A2 || amp || growth MW &amp;amp; DC || yes 210ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || 1008 4F pSB1A2 || amp || growth MW &amp;amp; DC || yes 76.37ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || 1001 5C pSB1A2 || amp || growth MW || yes 129.7ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2620|| Device receives 3OC6HSL outputs PoPS || Robert Cool (MW) || 1001 12D pSB1A2 || amp || growth MW || yes 83ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || 1000 3E pSB1A2 || amp || growth MW || yes 143ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || 1001 8B pSB1A2 || amp ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || 1000 3F pSB1A2 || amp ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || 1000 4H pSB1A2 || amp ||  ||yes 8.86 ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || 1000 4G pSB1A2 || amp ||  ||yes 62.4ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || 1013 3E pSB2K3 || kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || 1013 3F pSB2K3 || kan || no growth ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || MWSU || 1001 6F pSB1A2 || amp || ||no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || 1001 10F pSB1A2 || amp ||  ||yes 117.2ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || 1013 4F pSB2K3 || kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || 1013 4E pSB2K3 || kan ||   ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry|| || || &lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Fluorescent Protein Gradient Testers''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04450 || [http://partsregistry.org/Part:BBa_J04450 Lac-RBS-RFP-T] || Robert Cool (MW) ||1004 4f pSB1A2 || amp ||  ||yes 183ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04451 || [http://partsregistry.org/Part:BBa_J04451 pLac-RBS-RFP w/ LVA tag-T-T] || Erin Feeney  and Kelly Davis (DC) ||1016 9F pSB1AK3 || amp and kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13520 || [http://partsregistry.org/Part:BBa_I13520 pBAD-RBS-mRFP-T-T] || Erin Feeney and Kelly Davis (DC) || 1009 7B pSB1A2 || amp ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J5528 || [http://partsregistry.org/Part:BBa_J5528 pBAD-RBS-GFP-T-T] || Erin Feeney and Kelly Davis (DC)  || 1015 7A pSB2K3 || kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04430 || [http://partsregistry.org/Part:BBa_J04430 pLac-RBS-GFP-T-T] || Erin Feeney and Kelly Davis (DC)  || 1004 4H pSB1A2 || amp ||  ||yes 143ng/ml&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Parts for Sending and Receiving Signals''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || [http://partsregistry.org/Part:BBa_J07019 fec A promoter with fur box]|| James Barron (DC) || Not in Registry-Needs to be amplified || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2622 || [http://partsregistry.org/Part:BBa_F2622 3OC6HSL Receiver Device]|| Pallavi Penumetcha (DC) ||1001 12e pSB1A2 || amp || ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I14032 || [http://partsregistry.org/Part:BBa_I14032 pLac promoter]|| Pallavi Penumetcha (DC) || 1013 8e pSB2K3 || kan || ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_S03632 || [http://partsregistry.org/Part:BBa_S03632 lacI promoter and luxI gene]|| Pallavi Penumetcha (DC) || 1016 7f pSB1AK3 || amp and kan || ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_E0240 || [http://partsregistry.org/Part:BBa_E0240 RBS and GFP]|| Pallavi Penumetcha (DC) || 1001 4B pSB1A2 || amp ||  ||yes 130ng/ml&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=5086</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=5086"/>
				<updated>2008-06-09T13:13:56Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
# [[Status Of Building Parts]]&lt;br /&gt;
# [[Divide and Conquer Biological Challenges]]&lt;br /&gt;
# [http://en.wikipedia.org/wiki/Logic_gates#Symbols Logic Gates in Wikipedia]&lt;br /&gt;
# [http://www.bio.davidson.edu/Courses/Synthetic/papers/LuxR.pdf Build a LuxR Repressor '''PDF Reprint''']&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [[Using Amp and Amp^R as communication]]&lt;br /&gt;
# [http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
# [[Oligos to Build]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
'''Things to Do'''&lt;br /&gt;
&lt;br /&gt;
#  Experiment with making lines of media in petri dishes.&lt;br /&gt;
# Determine concentration of HSL needed to turn on our receiver + reporter. Compare with [http://partsregistry.org/wiki/index.php?title=Part:BBa_T9002 BBa_T9002]&lt;br /&gt;
# Determine what percent of a colony need to be sender cells in order for an entire colony to become switched on by HSL.&lt;br /&gt;
# We need to make sender and receiver cells (using existing sub-parts such as [http://partsregistry.org/wiki/index.php?title=Part:BBa_F1610 F1610]), and/or take from registry (''e.g.'', [http://partsregistry.org/wiki/index.php?title=Part:BBa_T9002 BBa_T9002])&lt;br /&gt;
# Design experiments to test the distance HSL and beta lactamase can diffuse in agar and over what time spans. &lt;br /&gt;
# Make a derived pLac promoter that will permit LuxR+HSL to be a repressor to be used in combination with Lux pR promoter. [http://www.bio.davidson.edu/Courses/Synthetic/papers/LuxR.pdf See this paper.]Andrew Gordon, Robert Cool&lt;br /&gt;
# Make an Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; sender device. Look for Amp&amp;lt;sup&amp;gt;R&amp;lt;/sup&amp;gt; basic part in Registry. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || 1001 12B pSB1A2 || amp || growth MW  ||no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || 1015 8F pSB3K3 || kan || growth MW || no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| 1002 8E pSB1A2 || amp || growth MW &amp;amp; DC || yes 210ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || 1001 12E pSB1A2 || amp || no growth || no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || 1016 10D pSB1AK3 || amp &amp;amp; kan || growth MW || no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || 1008 5B pSB1A2 || amp || growth MW &amp;amp; DC || yes 210ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || 1008 4F pSB1A2 || amp || growth MW &amp;amp; DC || yes 76.37ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || 1001 5C pSB1A2 || amp || growth MW || yes 129.7ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2620|| Device receives 3OC6HSL outputs PoPS || Robert Cool (MW) || 1001 12D pSB1A2 || amp || growth MW || yes 83ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || 1000 3E pSB1A2 || amp || growth MW || yes 143ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || 1001 8B pSB1A2 || amp ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || 1000 3F pSB1A2 || amp ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || 1000 4H pSB1A2 || amp ||  ||yes 8.86 ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || 1000 4G pSB1A2 || amp ||  ||yes 62.4ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || 1013 3E pSB2K3 || kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || 1013 3F pSB2K3 || kan || no growth ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || MWSU || 1001 6F pSB1A2 || amp || ||no &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || 1001 10F pSB1A2 || amp ||  ||yes 117.2ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || 1013 4F pSB2K3 || kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || 1013 4E pSB2K3 || kan ||   ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry|| || || &lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Fluorescent Protein Gradient Testers''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04450 || [http://partsregistry.org/Part:BBa_J04450 Lac-RBS-RFP-T] || Robert Cool (MW) ||1004 4f pSB1A2 || amp ||  ||yes 183ng/ml&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04451 || [http://partsregistry.org/Part:BBa_J04451 pLac-RBS-RFP w/ LVA tag-T-T] || Erin Feeney  and Kelly Davis (DC) ||1016 9F pSB1AK3 || amp and kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13520 || [http://partsregistry.org/Part:BBa_I13520 pBAD-RBS-mRFP-T-T] || Erin Feeney and Kelly Davis (DC) || 1009 7B pSB1A2 || amp ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J5528 || [http://partsregistry.org/Part:BBa_J5528 pBAD-RBS-GFP-T-T] || Erin Feeney and Kelly Davis (DC)  || 1015 7A pSB2K3 || kan ||  ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04430 || [http://partsregistry.org/Part:BBa_J04430 pLac-RBS-GFP-T-T] || Erin Feeney and Kelly Davis (DC)  || 1004 4H pSB1A2 || amp ||  ||yes 143ng/ml&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Parts for Sending and Receiving Signals''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|miniprep&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || [http://partsregistry.org/Part:BBa_J07019 fec A promoter with fur box]|| James Barron (DC) || Not in Registry-Needs to be amplified || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2622 || [http://partsregistry.org/Part:BBa_F2622 3OC6HSL Receiver Device]|| Pallavi Penumetcha (DC) ||1001 12e pSB1A2 || amp || ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I14032 || [http://partsregistry.org/Part:BBa_I14032 pLac promoter]|| Pallavi Penumetcha (DC) || 1013 8e pSB2K3 || kan || ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_S03632 || [http://partsregistry.org/Part:BBa_S03632 lacI promoter and luxI gene]|| Pallavi Penumetcha (DC) || 1016 7f pSB1AK3 || amp and kan || ||no&lt;br /&gt;
|-&lt;br /&gt;
|BBa_E0240 || [http://partsregistry.org/Part:BBa_E0240 RBS and GFP]|| Pallavi Penumetcha (DC) || 1001 4B pSB1A2 || amp ||  ||yes 130ng/ml&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Math_Modeling_Pages&amp;diff=4940</id>
		<title>Math Modeling Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Math_Modeling_Pages&amp;diff=4940"/>
				<updated>2008-05-28T21:29:12Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Papers */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the place for math modelers to post ideas, papers, examples and computer programs.&lt;br /&gt;
&lt;br /&gt;
Presentation on Sudoku  (Aaron and John have seen)&lt;br /&gt;
&lt;br /&gt;
http://www.math-cs.ucmo.edu/~hchen/talks/sudoku.pdf&lt;br /&gt;
&lt;br /&gt;
== Papers ==&lt;br /&gt;
[http://www.rfc-archive.org/getrfc.php?rfc=1319 MD2 Message-Digest Algorithm]&lt;br /&gt;
&lt;br /&gt;
==Logical negation==&lt;br /&gt;
&lt;br /&gt;
[[Logical negation]] is an [[logical operation|operation]] on one [[logical value]], typically the value of a [[proposition]], that produces a value of ''true'' if its operand is false and a value of ''false'' if its operand is true.&lt;br /&gt;
&lt;br /&gt;
The truth table for '''NOT p''' (also written as '''~p''' or '''¬p''') is as follows:&lt;br /&gt;
&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:40%&amp;quot;&lt;br /&gt;
|+ '''Logical Negation'''&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:20%&amp;quot; | p&lt;br /&gt;
! style=&amp;quot;width:20%&amp;quot; | ¬p&lt;br /&gt;
|-&lt;br /&gt;
| F || T&lt;br /&gt;
|-&lt;br /&gt;
| T || F&lt;br /&gt;
|}&lt;br /&gt;
==Logical conjunction==&lt;br /&gt;
&lt;br /&gt;
[[Logical conjunction]] is an [[logical operation|operation]] on two [[logical value]]s, typically the values of two [[proposition]]s, that produces a value of ''true'' if and only if both of its operands are true.&lt;br /&gt;
&lt;br /&gt;
The truth table for '''p AND q''' (also written as '''p ∧ q''', '''p &amp;amp; q''', or '''p&amp;lt;math&amp;gt;\cdot&amp;lt;/math&amp;gt;q''') is as follows:&lt;br /&gt;
&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+ '''Logical Conjunction'''&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | p&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | q&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | p · q&lt;br /&gt;
|-&lt;br /&gt;
| T || T || T&lt;br /&gt;
|-&lt;br /&gt;
| T || F || F&lt;br /&gt;
|-&lt;br /&gt;
| F || T || F&lt;br /&gt;
|-&lt;br /&gt;
| F || F || F&lt;br /&gt;
|-&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
In ordinary language terms, if both ''p'' and ''q'' are true, then the conjunction ''p'' ∧ ''q'' is true.  For all other assignments of logical values to ''p'' and to ''q'' the conjunction ''p'' ∧ ''q'' is false.&lt;br /&gt;
&lt;br /&gt;
It can also be said that if ''p'', then ''p'' ∧ ''q'' is ''q'', otherwise ''p'' ∧ ''q'' is ''p''.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Logical disjunction]] is an [[logical operation|operation]] on two [[logical value]]s, typically the values of two [[proposition]]s, that produces a value of ''false'' [[if and only if]] both of its operands are false.&lt;br /&gt;
&lt;br /&gt;
The truth table for '''p OR q''' (also written as '''p ∨ q''', '''p || q''', or '''p + q''') is as follows:&lt;br /&gt;
&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+ '''Logical Disjunction'''&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | p&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | q&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | p + q&lt;br /&gt;
|-&lt;br /&gt;
| T || T || T&lt;br /&gt;
|-&lt;br /&gt;
| T || F || T&lt;br /&gt;
|-&lt;br /&gt;
| F || T || T&lt;br /&gt;
|-&lt;br /&gt;
| F || F || F&lt;br /&gt;
|}&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Stated in English, if ''p'', then ''p'' ∨ ''q'' is ''p'', otherwise ''p'' ∨ ''q'' is ''q''.&lt;br /&gt;
&lt;br /&gt;
==Exclusive disjunction==&lt;br /&gt;
&lt;br /&gt;
[[Exclusive disjunction]] is an [[logical operation|operation]] on two [[logical value]]s, typically the values of two [[proposition]]s, that produces a value of ''true'' if and only if one but not both of its operands is true.&lt;br /&gt;
&lt;br /&gt;
The truth table for '''p XOR q''' (also written as '''p + q''', '''p ⊕ q''', or '''p ≠ q''') is as follows:&lt;br /&gt;
&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+ '''Exclusive Disjunction'''&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | p&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | q&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | p ⊕ q&lt;br /&gt;
|-&lt;br /&gt;
| T || T || F&lt;br /&gt;
|-&lt;br /&gt;
| T || F || T&lt;br /&gt;
|-&lt;br /&gt;
| F || T || T&lt;br /&gt;
|-&lt;br /&gt;
| F || F || F&lt;br /&gt;
|}&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
For two propositions, '''XOR''' can also be written as (p = 1 ∧ q = 0)∨ (p = 0 ∧ q = 1).&lt;br /&gt;
&lt;br /&gt;
==Logical NAND==&lt;br /&gt;
&lt;br /&gt;
The [[logical NAND]] is an [[logical operation|operation]] on two [[logical value]]s, typically the values of two [[proposition]]s, that produces a value of ''false'' if and only if both of its operands are true.  In other words, it produces a value of ''true'' if and only if at least one of its operands is false.&lt;br /&gt;
&lt;br /&gt;
The truth table for '''p NAND q''' (also written as '''p | q''' or '''p ↑ q''') is as follows:&lt;br /&gt;
&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+ '''Logical NAND'''&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | p&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | q&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | p ↑ q&lt;br /&gt;
|-&lt;br /&gt;
| T || T || F&lt;br /&gt;
|-&lt;br /&gt;
| T || F || T&lt;br /&gt;
|-&lt;br /&gt;
| F || T || T&lt;br /&gt;
|-&lt;br /&gt;
| F || F || T&lt;br /&gt;
|}&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Logical NOR==&lt;br /&gt;
&lt;br /&gt;
The [[logical NOR]] is an [[logical operation|operation]] on two [[logical value]]s, typically the values of two [[proposition]]s, that produces a value of ''true'' if and only if both of its operands are false.  In other words, it produces a value of ''false'' if and only if at least one of its operands is true. ↓ is also known as the [[Peirce arrow]] after its inventor, [[Charles Peirce]], and is a [[Sole sufficient operator]].&lt;br /&gt;
&lt;br /&gt;
The truth table for '''p NOR q''' (also written as '''p ⊥ q''' or '''p ↓ q''') is as follows:&lt;br /&gt;
&lt;br /&gt;
{| align=&amp;quot;center&amp;quot; border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;8&amp;quot; cellspacing=&amp;quot;0&amp;quot; style=&amp;quot;background:lightcyan; font-weight:bold; text-align:center; width:45%&amp;quot;&lt;br /&gt;
|+ '''Logical NOR'''&lt;br /&gt;
|- style=&amp;quot;background:paleturquoise&amp;quot;&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | p&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | q&lt;br /&gt;
! style=&amp;quot;width:15%&amp;quot; | p ↓ q&lt;br /&gt;
|-&lt;br /&gt;
| T || T || F&lt;br /&gt;
|-&lt;br /&gt;
| T || F || F&lt;br /&gt;
|-&lt;br /&gt;
| F || T || F&lt;br /&gt;
|-&lt;br /&gt;
| F || F || T&lt;br /&gt;
|}&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
*[http://www.doc.ic.ac.uk/~nd/surprise_96/journal/vol4/cs11/report.html#Introduction%20to%20neural%20networks Neural Network Models]&lt;br /&gt;
*[http://www.facweb.iitkgp.ernet.in/~niloy/PRESENTATION/ACRI_presentation_97.ppt Cellular Automata Based Authentication]&lt;br /&gt;
*MD5 Paper&lt;br /&gt;
[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1762088 Stochastic model of E. coli AI-2 quorum signal circuit reveals alternative synthesis pathways] Describes a Stochastic Petri Net (SPN) model of AI-2 (Lux), provides XML code and rate constants.&lt;br /&gt;
&lt;br /&gt;
How to break MD5 and other Hash functions.. A paper written by Xiaoyun Wang and her co-authors about how to break MD5 – i.e. how to make collisions occur &lt;br /&gt;
http://www.infosec.sdu.edu.cn/uploadfile/papers/How%20to%20Break%20MD5%20and%20Other%20Hash%20Functions.pdf &lt;br /&gt;
Nostradamus attack – i.e. the bit about predicting who will become president by exploiting MD5&lt;br /&gt;
http://www.win.tue.nl/hashclash/Nostradamus/ &lt;br /&gt;
&lt;br /&gt;
The following was taken from http://www.freesoft.org/CIE/RFC/1321/4.htm &lt;br /&gt;
&lt;br /&gt;
MD5 Algorithm Description&lt;br /&gt;
We begin by supposing that we have a b-bit message as input, and that we wish to find its message digest. Here b is an arbitrary nonnegative integer; b may be zero, it need not be a multiple of eight, and it may be arbitrarily large. We imagine the bits of the message written down as follows: &lt;br /&gt;
          m_0 m_1 ... m_{b-1}&lt;br /&gt;
The following five steps are performed to compute the message digest of the message. &lt;br /&gt;
&lt;br /&gt;
Step 1. Append Padding Bits&lt;br /&gt;
The message is &amp;quot;padded&amp;quot; (extended) so that its length (in bits) is congruent to 448, modulo 512. That is, the message is extended so that it is just 64 bits shy of being a multiple of 512 bits long. Padding is always performed, even if the length of the message is already congruent to 448, modulo 512. &lt;br /&gt;
Padding is performed as follows: a single &amp;quot;1&amp;quot; bit is appended to the message, and then &amp;quot;0&amp;quot; bits are appended so that the length in bits of the padded message becomes congruent to 448, modulo 512. In all, at least one bit and at most 512 bits are appended. &lt;br /&gt;
&lt;br /&gt;
Step 2. Append Length&lt;br /&gt;
A 64-bit representation of b (the length of the message before the padding bits were added) is appended to the result of the previous step. In the unlikely event that b is greater than 2^64, then only the low-order 64 bits of b are used. (These bits are appended as two 32-bit words and appended low-order word first in accordance with the previous conventions.) &lt;br /&gt;
At this point the resulting message (after padding with bits and with b) has a length that is an exact multiple of 512 bits. Equivalently, this message has a length that is an exact multiple of 16 (32-bit) words. Let M[0 ... N-1] denote the words of the resulting message, where N is a multiple of 16. &lt;br /&gt;
&lt;br /&gt;
Step 3. Initialize MD Buffer&lt;br /&gt;
A four-word buffer (A,B,C,D) is used to compute the message digest. Here each of A, B, C, D is a 32-bit register. These registers are initialized to the following values in hexadecimal, low-order bytes first): &lt;br /&gt;
          word A: 01 23 45 67&lt;br /&gt;
          word B: 89 ab cd ef&lt;br /&gt;
          word C: fe dc ba 98&lt;br /&gt;
          word D: 76 54 32 10&lt;br /&gt;
&lt;br /&gt;
3.4 Step 4. Process Message in 16-Word Blocks&lt;br /&gt;
We first define four auxiliary functions that each take as input three 32-bit words and produce as output one 32-bit word. &lt;br /&gt;
          F(X,Y,Z) = XY v not(X) Z&lt;br /&gt;
          G(X,Y,Z) = XZ v Y not(Z)&lt;br /&gt;
          H(X,Y,Z) = X xor Y xor Z&lt;br /&gt;
          I(X,Y,Z) = Y xor (X v not(Z))&lt;br /&gt;
In each bit position F acts as a conditional: if X then Y else Z. The function F could have been defined using + instead of v since XY and not(X)Z will never have 1's in the same bit position.) It is interesting to note that if the bits of X, Y, and Z are independent and unbiased, the each bit of F(X,Y,Z) will be independent and unbiased. &lt;br /&gt;
The functions G, H, and I are similar to the function F, in that they act in &amp;quot;bitwise parallel&amp;quot; to produce their output from the bits of X, Y, and Z, in such a manner that if the corresponding bits of X, Y, and Z are independent and unbiased, then each bit of G(X,Y,Z), H(X,Y,Z), and I(X,Y,Z) will be independent and unbiased. Note that the function H is the bit-wise &amp;quot;xor&amp;quot; or &amp;quot;parity&amp;quot; function of its inputs. &lt;br /&gt;
This step uses a 64-element table T[1 ... 64] constructed from the sine function. Let T[i] denote the i-th element of the table, which is equal to the integer part of 4294967296 times abs(sin(i)), where i is in radians. The elements of the table are given in the appendix. &lt;br /&gt;
Do the following: &lt;br /&gt;
   /* Process each 16-word block. */&lt;br /&gt;
   For i = 0 to N/16-1 do&lt;br /&gt;
     /* Copy block i into X. */&lt;br /&gt;
     For j = 0 to 15 do&lt;br /&gt;
       Set X[j] to M[i*16+j].&lt;br /&gt;
     end /* of loop on j */&lt;br /&gt;
&lt;br /&gt;
     /* Save A as AA, B as BB, C as CC, and D as DD. */&lt;br /&gt;
     AA = A&lt;br /&gt;
     BB = B&lt;br /&gt;
&lt;br /&gt;
     CC = C&lt;br /&gt;
     DD = D&lt;br /&gt;
&lt;br /&gt;
     /* Round 1. */&lt;br /&gt;
     /* Let [abcd k s i] denote the operation&lt;br /&gt;
          a = b + ((a + F(b,c,d) + X[k] + T[i]) &amp;lt;&amp;lt;&amp;lt; s). */&lt;br /&gt;
     /* Do the following 16 operations. */&lt;br /&gt;
     [ABCD  0  7  1]  [DABC  1 12  2]  [CDAB  2 17  3]  [BCDA  3 22  4]&lt;br /&gt;
     [ABCD  4  7  5]  [DABC  5 12  6]  [CDAB  6 17  7]  [BCDA  7 22  8]&lt;br /&gt;
     [ABCD  8  7  9]  [DABC  9 12 10]  [CDAB 10 17 11]  [BCDA 11 22 12]&lt;br /&gt;
     [ABCD 12  7 13]  [DABC 13 12 14]  [CDAB 14 17 15]  [BCDA 15 22 16]&lt;br /&gt;
&lt;br /&gt;
     /* Round 2. */&lt;br /&gt;
     /* Let [abcd k s i] denote the operation&lt;br /&gt;
          a = b + ((a + G(b,c,d) + X[k] + T[i]) &amp;lt;&amp;lt;&amp;lt; s). */&lt;br /&gt;
     /* Do the following 16 operations. */&lt;br /&gt;
     [ABCD  1  5 17]  [DABC  6  9 18]  [CDAB 11 14 19]  [BCDA  0 20 20]&lt;br /&gt;
     [ABCD  5  5 21]  [DABC 10  9 22]  [CDAB 15 14 23]  [BCDA  4 20 24]&lt;br /&gt;
     [ABCD  9  5 25]  [DABC 14  9 26]  [CDAB  3 14 27]  [BCDA  8 20 28]&lt;br /&gt;
     [ABCD 13  5 29]  [DABC  2  9 30]  [CDAB  7 14 31]  [BCDA 12 20 32]&lt;br /&gt;
&lt;br /&gt;
     /* Round 3. */&lt;br /&gt;
     /* Let [abcd k s t] denote the operation&lt;br /&gt;
          a = b + ((a + H(b,c,d) + X[k] + T[i]) &amp;lt;&amp;lt;&amp;lt; s). */&lt;br /&gt;
     /* Do the following 16 operations. */&lt;br /&gt;
     [ABCD  5  4 33]  [DABC  8 11 34]  [CDAB 11 16 35]  [BCDA 14 23 36]&lt;br /&gt;
     [ABCD  1  4 37]  [DABC  4 11 38]  [CDAB  7 16 39]  [BCDA 10 23 40]&lt;br /&gt;
     [ABCD 13  4 41]  [DABC  0 11 42]  [CDAB  3 16 43]  [BCDA  6 23 44]&lt;br /&gt;
     [ABCD  9  4 45]  [DABC 12 11 46]  [CDAB 15 16 47]  [BCDA  2 23 48]&lt;br /&gt;
&lt;br /&gt;
     /* Round 4. */&lt;br /&gt;
     /* Let [abcd k s t] denote the operation&lt;br /&gt;
          a = b + ((a + I(b,c,d) + X[k] + T[i]) &amp;lt;&amp;lt;&amp;lt; s). */&lt;br /&gt;
     /* Do the following 16 operations. */&lt;br /&gt;
     [ABCD  0  6 49]  [DABC  7 10 50]  [CDAB 14 15 51]  [BCDA  5 21 52]&lt;br /&gt;
     [ABCD 12  6 53]  [DABC  3 10 54]  [CDAB 10 15 55]  [BCDA  1 21 56]&lt;br /&gt;
     [ABCD  8  6 57]  [DABC 15 10 58]  [CDAB  6 15 59]  [BCDA 13 21 60]&lt;br /&gt;
     [ABCD  4  6 61]  [DABC 11 10 62]  [CDAB  2 15 63]  [BCDA  9 21 64]&lt;br /&gt;
&lt;br /&gt;
     /* Then perform the following additions. (That is increment each&lt;br /&gt;
        of the four registers by the value it had before this block&lt;br /&gt;
        was started.) */&lt;br /&gt;
     A = A + AA&lt;br /&gt;
     B = B + BB&lt;br /&gt;
     C = C + CC&lt;br /&gt;
     D = D + DD&lt;br /&gt;
&lt;br /&gt;
   end /* of loop on i */&lt;br /&gt;
&lt;br /&gt;
Step 5. Output&lt;br /&gt;
The message digest produced as output is A, B, C, D. That is, we begin with the low-order byte of A, and end with the high-order byte of D. &lt;br /&gt;
This completes the description of MD5. A reference implementation in C is given in the appendix. &lt;br /&gt;
&lt;br /&gt;
Summary&lt;br /&gt;
The MD5 message-digest algorithm is simple to implement, and provides a &amp;quot;fingerprint&amp;quot; or message digest of a message of arbitrary length. It is conjectured that the difficulty of coming up with two messages having the same message digest is on the order of 2^64 operations, and that the difficulty of coming up with any message having a given message digest is on the order of 2^128 operations. The MD5 algorithm has been carefully scrutinized for weaknesses. It is, however, a relatively new algorithm and further security analysis is of course justified, as is the cas Differences Between MD4 and MD5&lt;br /&gt;
The following are the differences between MD4 and MD5: &lt;br /&gt;
1.	A fourth round has been added. &lt;br /&gt;
2.	Each step now has a unique additive constant. &lt;br /&gt;
3.	The function g in round 2 was changed from (XY v XZ v YZ) to (XZ v Y not(Z)) to make g less symmetric. &lt;br /&gt;
4.	Each step now adds in the result of the previous step. This promotes a faster &amp;quot;avalanche effect&amp;quot;. &lt;br /&gt;
5.	The order in which input words are accessed in rounds 2 and 3 is changed, to make these patterns less like each other. &lt;br /&gt;
6.	The shift amounts in each round have been approximately optimized, to yield a faster &amp;quot;avalanche effect.&amp;quot; The shifts in different rounds are distinct.&lt;br /&gt;
&lt;br /&gt;
== Engineering agar ==&lt;br /&gt;
[http://www.biotech.iastate.edu/lab_protocols/EvoAntiResBact.html A lab for showing antibiotic resistance across Amp concentration gradient]&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4828</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4828"/>
				<updated>2008-05-23T17:59:25Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || 1001 12B pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || 1015 8F pSB3K3 || kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| 1002 8E pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || 1001 12E pSB1A2 || amp || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || 1016 10D pSB1AK3 || amp &amp;amp; kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || 1008 5B pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || 1008 4F pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || 1001 5C pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || 1000 3E pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || 1001 8B pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || 1000 3F pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || 1000 4H pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || 1000 4G pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || 1013 3E pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || 1013 3F pSB2K3 || kan || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || MWSU || 1001 6F pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || 1001 10F pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || 1013 4F pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || 1013 4E pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry|| || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Fluorescent Protein Gradient Testers''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04450 || [http://partsregistry.org/Part:BBa_J04450 Lac-RBS-RFP-T] || Robert Cool (MW) ||1004 4f pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04451 || [http://partsregistry.org/Part:BBa_J04451 pLac-RBS-RFP w/ LVA tag-T-T] || Erin Feeney  and Kelly Davis (DC) ||1016 9F pSB1AK3 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13520 || [http://partsregistry.org/Part:BBa_I13520 pBAD-RBS-mRFP-T-T] || Erin Feeney and Kelly Davis (DC) || 1009 7B pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_J5528 || [http://partsregistry.org/Part:BBa_J5528 pBAD-RBS-GFP-T-T] || Erin Feeney and Kelly Davis (DC)  || 1015 7A pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_J5528 || [http://partsregistry.org/Part:BBa_J04430 pLac-RBS-GFP-T-T] || Erin Feeney and Kelly Davis (DC)  || 1004 4H pSB1A2 || amp || &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Parts for Sending and Receiving Signals''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || [http://partsregistry.org/Part:BBa_J07019 fec A promoter with fur box]|| James Barron (DC) || Not in Registry-Needs to be amplified || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2622 || [http://partsregistry.org/Part:BBa_F2622 3OC6HSL Receiver Device]|| Pallavi Penumetcha (DC) ||1001 12e pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I14032 || [http://partsregistry.org/Part:BBa_I14032 pLac promoter]|| Pallavi Penumetcha (DC) || 1013 8e pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Surfer dude (DC) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Surfer dude (DC) || || || &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4825</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4825"/>
				<updated>2008-05-23T17:43:17Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || 1001 12B pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || 1015 8F pSB3K3 || kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| 1002 8E pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || 1001 12E pSB1A2 || amp || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || 1016 10D pSB1AK3 || amp &amp;amp; kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || 1008 5B pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || 1008 4F pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || 1001 5C pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || 1000 3E pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || 1001 8B pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || 1000 3F pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || 1000 4H pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || 1000 4G pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || 1013 3E pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || 1013 3F pSB2K3 || kan || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || MWSU || 1001 6F pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || 1001 10F pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || 1013 4F pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || 1013 4E pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry|| || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Fluorescent Protein Gradient Testers''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04450 || Lac-RBS-RFP-T || Robert Cool (MW) ||1004 4f pSB1A2 ||amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04451 || pLac-RBS-RFP w/ LVA tag-T-T || Erin Feeney (DC) ||1016 9f pSB1AK3 || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13520 || [http://partsregistry.org/Part:BBa_I13520 pBAD-RBS-mRFP-T-T] || Erin Feeney and Kelly Davis (DC) || 1009 7b pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Surfer dude (DC) || || || &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4822</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4822"/>
				<updated>2008-05-23T16:06:36Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || 1001 12B pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || 1015 8F pSB3K3 || kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| 1002 8E pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || 1001 12E pSB1A2 || amp || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || 1016 10D pSB1AK3 || amp &amp;amp; kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || 1008 5B pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || 1008 4F pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || 1001 5C pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || 1000 3E pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || 1001 8B pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || 1000 3F pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || 1000 4H pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || 1000 4G pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || 1013 3E pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || 1013 3F pSB2K3 || kan || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || MWSU || 1001 6F pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || 1001 10F pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || 1013 4F pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || 1013 4E pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry|| || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Fluorescent Protein Gradient Testers''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04450 || Lac-RBS-RFP-T || Robert Cool (MW) ||1004 4f pSB1A2 ||amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_J04451 || pLac-RBS-RFP w/ LVA tag-T-T || Erin Feeney (DC) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Surfer dude (DC) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Surfer dude (DC) || || || &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4818</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4818"/>
				<updated>2008-05-23T13:26:05Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || 1001 12B pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || 1015 8F pSB3K3 || kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| 1002 8E pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || 1001 12E pSB1A2 || amp || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || 1016 10D pSB1AK3 || amp &amp;amp; kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || 1008 5B pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || 1008 4F pSB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || 1001 5C pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || 1000 3E pSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || 1001 8B pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || 1000 3F pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || 1000 4H pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || 1000 4G pSB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || 1013 3E pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || 1013 3F pSB2K3 || kan || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || MWSU || 1001 6F pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || 1001 10F pSB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || 1013 4F pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || 1013 4E pSB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry|| || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW) || || || &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Fluorescent Protein Gradient Testers''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Location and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Surfer dude (DC) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Surfer dude (DC) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Surfer dude (DC) || || || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Surfer dude (DC) || || || &lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4815</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4815"/>
				<updated>2008-05-23T13:17:46Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Part # and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || 1001 12B PSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || 1015 8F pSB3K3 || kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| 1002 8E SB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || 1001 12E SB1A2 || amp || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || 1016 10D SB1AK3 || amp &amp;amp; kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || 1008 5B SB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || 1008 4F SB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || 1001 5C SB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Part # and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || 1000 3E SB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || 1001 8B SB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || 1000 3F SB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || 1000 4H SB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || 1000 4G SB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || 1013 3E SB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || 1013 3F SB2K3 || kan || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || MWSU || 1001 6F SB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || 1001 10F SB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || 1013 4F SB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || 1013 4E SB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4814</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4814"/>
				<updated>2008-05-23T13:16:24Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Part # and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Results from 5/22/08&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || 1001 12B PSB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || 1015 8F pSB3K3 || kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| 1002 8E SB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || 1001 12E SB1A2 || amp || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || 1016 10D SB1AK3 || amp &amp;amp; kan || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || 1008 5B SB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || 1008 4F SB1A2 || amp || growth MW &amp;amp; DC&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || 1001 5C SB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Part # and Vector&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || 1000 3E SB1A2 || amp || growth MW&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || 1001 8B SB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || 1000 3F SB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || 1000 4H SB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || 1000 4G SB1A2 || amp ||&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || 1013 3E SB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || 1013 3F SB2K3 || kan || no growth&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || MWSU || 1001 6F SB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || 1001 10F SB1A2 || amp || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || 1013 4F SB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || 1013 4E SB2K3 || kan || &lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4775</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4775"/>
				<updated>2008-05-21T21:06:21Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || amp &amp;amp; kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || amp &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || Not in Registry&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4774</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4774"/>
				<updated>2008-05-21T20:33:59Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || amp &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || Not in Registry&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4773</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4773"/>
				<updated>2008-05-21T20:31:12Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263 || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha (DC)|| amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_f2622 || 3OC6HSL receiver that outputs PoPS || James Barron (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Malcolm Campbell (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || amp &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || Not in Registry&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || Not in Registry&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4772</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4772"/>
				<updated>2008-05-21T20:17:10Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha  (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F1610 || Device that receives PoPS and outputs LuxI || Pallavi Penumetcha (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
!width=&amp;quot;30&amp;quot;|Resistance&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Not Done (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW) || amp &lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0171|| rhlR gene without LVA || Malcolm Campbell (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW) || amp&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW) || kan&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || James Barron (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson/Missouri_Western_iGEM2008&amp;diff=4764</id>
		<title>Davidson/Missouri Western iGEM2008</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson/Missouri_Western_iGEM2008&amp;diff=4764"/>
				<updated>2008-05-21T18:54:51Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Lsr cell signaling system */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;font size = &amp;quot;6&amp;quot;&amp;gt;&amp;lt;center&amp;gt;&lt;br /&gt;
Davidson College - Missouri Western State University&lt;br /&gt;
&amp;lt;/center&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
iGEM 2008&lt;br /&gt;
&amp;lt;/center&amp;gt;&amp;lt;/font&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Wet Lab Pages]]==&lt;br /&gt;
&lt;br /&gt;
== Las/Rhl cell signaling system ==&lt;br /&gt;
'''Responsible''': Robert Cool, Alicia Allen, and Erin Feeney&lt;br /&gt;
&lt;br /&gt;
'''Las System'''&lt;br /&gt;
&lt;br /&gt;
'''Signal Molecule''': An AHL called PAI-1 (N-3-oxododecanoyl-l-hsl)(3-oxo-C12-hsl)&lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': Pseudomonas aeruginosa gram(-)   possibly E.coli (see article 3)&lt;br /&gt;
&lt;br /&gt;
'''Receiver protein''': LasR&lt;br /&gt;
&lt;br /&gt;
'''Effect of binding''': TXN activation of virulence genes, lasA, lasB, apr, toxR&lt;br /&gt;
&lt;br /&gt;
'''Synthase''': LasI enzyme&lt;br /&gt;
&lt;br /&gt;
'''Target Genes''': lasI, lasA, lasB, apr, toxR&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': unknown&lt;br /&gt;
 &lt;br /&gt;
&lt;br /&gt;
'''References'''&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes&amp;quot; &lt;br /&gt;
&lt;br /&gt;
JP Pearson, EC Pesci and BH Iglewski &lt;br /&gt;
[http://jb.asm.org/cgi/reprint/179/18/5756?maxtoshow=&amp;amp;HITS=10&amp;amp;hits=10&amp;amp;RESULTFORMAT=&amp;amp;titleabstract=las&amp;amp;searchid=1&amp;amp;FIRSTINDEX=0&amp;amp;resourcetype=HWCIT]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Regulation of Pseudomonas Quinolone Signal Synthesis in Pseudomonas aeruginosa&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Dana S. Wade, M. Worth Calfee, Edson R. Rocha, Elizabeth A. Ling, Elana Engstrom, James P. Coleman, and Everett C. Pesci&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/187/13/4372?view=long&amp;amp;pmid=15968046 2]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Posttranscriptional Control of Quorum-Sensing-Dependent Virulence Genes by DksA in Pseudomonas aeruginosa&lt;br /&gt;
&lt;br /&gt;
Florence Jude,Thilo Köhler,Pavel Branny,Karl Perron,Matthias P. Mayer,Rachel Comte, and Christian van Delden&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/185/12/3558?view=long&amp;amp;pmid=12775693 3]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Rhl System''' &lt;br /&gt;
 &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''Signal Molecule''': An AHL called PAI-2, Plasminogen activator inhibitor-2, N-butanoyl-homoserine lactone (C4HSL) &lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': Pseudomonas aeruginosa, gram(-)&lt;br /&gt;
&lt;br /&gt;
'''Receiver Protein''': Rhl R &lt;br /&gt;
&lt;br /&gt;
'''Effect of Binding''': activation of Rhamnosyl Transferase, then making RL (rhamnolipid) &lt;br /&gt;
&lt;br /&gt;
'''Synthase''': RhlA and RhlB &lt;br /&gt;
&lt;br /&gt;
'''Target Genes''': pqsABCDE and phnAB&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': unknown&lt;br /&gt;
&lt;br /&gt;
'''References'''&lt;br /&gt;
&lt;br /&gt;
[http://jb.asm.org/cgi/reprint/189/13/4827 background information on Las and Rhl]&lt;br /&gt;
&lt;br /&gt;
[[Image:Las_rhl.gif]]&lt;br /&gt;
&lt;br /&gt;
'''Parts Needed''':&lt;br /&gt;
&lt;br /&gt;
LasR + pro/term&lt;br /&gt;
&lt;br /&gt;
RhlR + pro/term&lt;br /&gt;
&lt;br /&gt;
RhlI + pro/term&lt;br /&gt;
&lt;br /&gt;
pqsABCDE + pro/term&lt;br /&gt;
&lt;br /&gt;
pqsR&lt;br /&gt;
&lt;br /&gt;
pqsH + pro/term&lt;br /&gt;
&lt;br /&gt;
phnAB&lt;br /&gt;
&lt;br /&gt;
LasI&lt;br /&gt;
&lt;br /&gt;
RBS&lt;br /&gt;
&lt;br /&gt;
== Lux cell signaling system ==&lt;br /&gt;
&lt;br /&gt;
'''Responsible:''' Andrew Gordon and Pallavi Penumetcha&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule:''' ''N''-acyl-homoserine lactone (AHL) Generic term for a variety of species specific hormone-like molecules &lt;br /&gt;
&lt;br /&gt;
'''Bacterial species:''' discovered in ''Vibrio fischeri'' known to work in ''E. coli''&lt;br /&gt;
&lt;br /&gt;
'''Receiver protein:''' LuxR protein receives signal from AHL; also has some control over transciption of luciferase&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule synthase:''' LuxI; also has some control over transciption of luciferase&lt;br /&gt;
&lt;br /&gt;
'''Additional Information:''' &amp;quot;Quorum Quenching&amp;quot; lactonase reduces AHL concentration&lt;br /&gt;
&lt;br /&gt;
[[Image:800px-Luxrreceiverschematic.png]]&lt;br /&gt;
&lt;br /&gt;
'''Resources'''&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/Lux Lux Operon Pathway]&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/AHL AHL signaling molecules by species; some are specific to gram pos but may affect gram negs]&lt;br /&gt;
&lt;br /&gt;
'''References'''&lt;br /&gt;
&lt;br /&gt;
[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=522112 Quorum Quenching to control Lux Pathway]&lt;br /&gt;
&lt;br /&gt;
'''Parts Needed''':&lt;br /&gt;
&lt;br /&gt;
LuxR + pro/term&lt;br /&gt;
&lt;br /&gt;
RBS&lt;br /&gt;
&lt;br /&gt;
LuxI + pro/term&lt;br /&gt;
&lt;br /&gt;
LuxI sender&lt;br /&gt;
&lt;br /&gt;
== Lsr cell signaling system ==&lt;br /&gt;
&lt;br /&gt;
'''Responsible''': Kelly Davis, Xiao Zhu&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule''': AI-2, furanosyl borate diester, derived from the ribosyl part of S-ribosylhomocysteine, [http://www.biomedcentral.com/content/pdf/1471-2148-4-36.pdf]&lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': discovered in Vibrio harveyi, but interspecies signalling occurs, Escherichia coli E24377A (strain: E24377A) (for lsrK), Escherichia coli str. K-12 substr. DH10B (strain: K-12, substrain: DH10B) (for lsrR)&lt;br /&gt;
&lt;br /&gt;
'''Receiver protein''': LsrR protein receives signal from sensor protein&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule synthase''': Pfs enzyme, then LuxS autoinducer synthase&lt;br /&gt;
&lt;br /&gt;
'''Target genes''': lsr operon, including ABC transporter and LsrK kinase&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': LsrR represses the lsr operon, derepression by phospho-AI-2&lt;br /&gt;
&lt;br /&gt;
'''References'''&lt;br /&gt;
&lt;br /&gt;
[http://web.ebscohost.com/ehost/detail?vid=1&amp;amp;hid=116&amp;amp;sid=edfbf2f7-b0c8-40c3-8227-1cc94f134972%40sessionmgr108 Lsr-mediated transport and processing of AI-2 in Salmonella typhimurium]&lt;br /&gt;
&lt;br /&gt;
[http://www.microbialcellfactories.com/content/pdf/1475-2859-1-5.pdf Review of AI-2 and other systems]&lt;br /&gt;
&lt;br /&gt;
[http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=22733&amp;amp;blobtype=pdf E. coli produces a signal that can substitute for AI-2]&lt;br /&gt;
&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/187/1/238?maxtoshow=&amp;amp;HITS=10&amp;amp;hits=10&amp;amp;RESULTFORMAT=&amp;amp;titleabstract=quorum+sensing+AI-2&amp;amp;searchid=1&amp;amp;FIRSTINDEX=0&amp;amp;resourcetype=HWCIT Regulation of Uptake and Processing of the Quorum-Sensing Autoinducer AI-2 in Escherichia coli]&lt;br /&gt;
&lt;br /&gt;
'''Resources'''&lt;br /&gt;
&lt;br /&gt;
[http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&amp;amp;cmd=Retrieve&amp;amp;dopt=full_report&amp;amp;list_uids=5586283 lsrK gene in Entrez] &lt;br /&gt;
&lt;br /&gt;
[http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&amp;amp;Cmd=ShowDetailView&amp;amp;TermToSearch=6062136&amp;amp;ordinalpos=9&amp;amp;itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum#summary lsrR gene in Entrez]&lt;br /&gt;
&lt;br /&gt;
[http://BioCyc.org/ECOLI/substring-search?type=NIL&amp;amp;object=lsr lsr genes in EcoCyc]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''Parts Needed:'''&lt;br /&gt;
&lt;br /&gt;
LsrR pro/term&lt;br /&gt;
&lt;br /&gt;
LsrK&lt;br /&gt;
&lt;br /&gt;
LsrACDB (transport)&lt;br /&gt;
&lt;br /&gt;
LsrFGE (catabolic)&lt;br /&gt;
&lt;br /&gt;
LuxS&lt;br /&gt;
&lt;br /&gt;
Pfs enzyme (?)&lt;br /&gt;
&lt;br /&gt;
'''Note:'''&lt;br /&gt;
lsrB encodes the periplasmic AI-2 binding protein&lt;br /&gt;
&lt;br /&gt;
lsrC &amp;amp; lsrD encode the channel proteins&lt;br /&gt;
&lt;br /&gt;
lsrA encodes the ATPase that provides energy for AI-2 transport &lt;br /&gt;
&lt;br /&gt;
lsrF is similar to genes specifying aldolases&lt;br /&gt;
&lt;br /&gt;
lsrG encodes a protein with an unknown function. &lt;br /&gt;
&lt;br /&gt;
There is no lsrE in the E. coli lsr operon&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&amp;amp;id=55669965 R-THMF]&lt;br /&gt;
&lt;br /&gt;
http://www.nature.com/nrmicro/journal/v3/n5/images/nrmicro1146-f2.gif&lt;br /&gt;
&lt;br /&gt;
== Fec cell signaling system ==&lt;br /&gt;
Responsible: Xiao Zhu&lt;br /&gt;
&lt;br /&gt;
'''Ferric Dicitrate Transport System'''&lt;br /&gt;
The inducer, ferric citrate, binds to an outer membrane transport protein, FecA, and without further transport elicits a signal that is transmitted across the outer membrane (by FecA), the periplasm, and the cytoplasmic membrane (by FecBCDE and FecR) into the cytoplasm. Signal transfer across the three subcellular compartments is mediated by the outer membrane transport protein (FecA) that interacts in the periplasm with a cytoplasmic transmembrane protein (FecR). FecR is required for activation of a sigma factor (FecI) which belongs to the extracytoplasmic function (ECF)sigma factor family.&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
Only iron not iron complex enters the cytoplasm. FecA is the TonB energy transducing system-dependent. &lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Signaling Molecule:''' FeC (ferric dicitrate)&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Bacteria species:''' E.coli, Pseudomonas putida, P. aeruginosa, Serratia marcescens, Klebsiella pneumoniae, Aerobacter aerogenes, Bordetella pertussis, B. bronchseptica, B. avium, and Ralstonia solanacearum.&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Receptor Protein: ''' FecA&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Effect of binding:''' the conformational changes that FecA undergoes when binding to ferric citrate:The alpha helix in loop 7 unravels, and the loop moves by up to 11 angstroms ; Loop 8 moves up to 15 angstroms.&lt;br /&gt;
http://www.rsc.org/ej/CS/2007/b617040b/b617040b-f13.gif&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Sensor Producer:''' N/A&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
Harvard iGEM'07 team worked with Fec system, the results were not favorable. [http://parts.mit.edu/igem07/index.php/Harvard#Quorum_Sensing :We believe that overexpression of the Fec system killed the cells, possibly by disturbing the cell membranes.]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://pathway.gramene.org/ECOLI/NEW-IMAGE?type=REACTION&amp;amp;object=RXN0-2261 More detailed information about Fec]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=215624&amp;amp;blobtype=pdf Exogenous Induction of the Iron Dicitrate Transport System of Escherichia coli K-12]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/183/1/162 Control of the Ferric Citrate Transport System of Escherichia coli:Mutations in Region2.1 of the FecI ECF Sigma Factor Suppress Mutations in the FecR Transmembrane Regulatory Protein]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/189/19/6913 Docking of the Periplasmic FecB Binding Protein to the FecCD Transmembrane Proteins in the Ferric Citrate Transport System of Escherichia coli]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/abstract/185/6/1870 Interactions between the Outer Membrane Ferric Citrate Transporter FecA and TonB: Studies of the FecA TonB Box]&lt;br /&gt;
&lt;br /&gt;
== Signal molecules ==&lt;br /&gt;
&lt;br /&gt;
[[Image:QSsignals.gif|QSsignals.gif]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Gram (-) bacteria use:'''&lt;br /&gt;
&lt;br /&gt;
3-oxo-C6-HSL, N-(3-oxohexanoyl)-L-homoserine lactone, an AHL&lt;br /&gt;
&lt;br /&gt;
DPD, the AI-2 precursor, 4,5 dihydroxy-2,3-pentanedione&lt;br /&gt;
&lt;br /&gt;
HHQ, 2-heptyl-4(1H)-quinolone, an AQ&lt;br /&gt;
&lt;br /&gt;
'''Gram (+) bacteria use:'''&lt;br /&gt;
&lt;br /&gt;
DPD, the AI-2 precursor, 4,5 dihydroxy-2,3-pentanedione&lt;br /&gt;
&lt;br /&gt;
A-Factor, 2-isocapryloyl-3-hydroxymethyl--butyrolactone&lt;br /&gt;
&lt;br /&gt;
PQS, pseudomonas quinolone signal, 2-heptyl-3-hydroxy-4(1H)-quinolone&lt;br /&gt;
&lt;br /&gt;
DSF, ‘diffusible factor’, cis-11-methyl-2-dodecenoic acid&lt;br /&gt;
&lt;br /&gt;
3OH-PAME, hydroxyl-palmitic acid methyl ester; &lt;br /&gt;
&lt;br /&gt;
AIP-1, staphylococcal autoinducing peptide 1&lt;br /&gt;
&lt;br /&gt;
== E. coli Signaling ==&lt;br /&gt;
&lt;br /&gt;
&amp;quot;As yet no AHL-producing Escherichia coli or Salmonella strains have been identified, although both organisms possess an AHL receptor (SdiA) of the LuxR protein class and respond to AHLs produced by other bacteria.&amp;quot; [http://mic.sgmjournals.org/cgi/reprint/153/12/3923 Williams 2007]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Cell signaling resources ==&lt;br /&gt;
[http://partsregistry.org/Featured_Parts:Cell-Cell-Signaling Featured parts in iGEM registry]&lt;br /&gt;
&lt;br /&gt;
[http://en.wikipedia.org/wiki/Cell_signaling Wikipedia entry]&lt;br /&gt;
&lt;br /&gt;
[http://mic.sgmjournals.org/cgi/reprint/153/12/3923 Quorum sensing, communication and cross-kingdom signalling in the bacterial world]&lt;br /&gt;
&lt;br /&gt;
[http://www.molbio.princeton.edu/index.php?option=content&amp;amp;task=view&amp;amp;id=27 Bonnie Bassler lab at Princeton]&lt;br /&gt;
&lt;br /&gt;
[http://www.nottingham.ac.uk/quorum/ One-Stop Shopping for QS from Nottingham]&lt;br /&gt;
&lt;br /&gt;
[http://journals.royalsociety.org/content/w26732234707/?p=c1685368363e450faabedd3ee8fd60dc&amp;amp;pi=3 Special Issue: Bacterial conversations: talking, listening and eavesdropping]&lt;br /&gt;
&lt;br /&gt;
[http://library.albany.edu/science/whatsnew_dialogs.htm Dialogs with Bacteria: Quorum Sensing]&lt;br /&gt;
&lt;br /&gt;
[http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/C/CellSignaling.html General Types of Cell Signaling: Bacteria on Steroids?]&lt;br /&gt;
&lt;br /&gt;
[http://www.samsi.info/200405/compbio/workinggroup/cell/Eungdamrong_Iyengar_Biology_of_the_Cell_96_355_2004.pdf Modeling Cell-Signaling Networks]&lt;br /&gt;
&lt;br /&gt;
[http://journals.royalsociety.org/content/m5hgygq1t6daxy72/fulltext.pdf Quorum Sensing and the Population Control of Virulence]&lt;br /&gt;
&lt;br /&gt;
== Davidson Journal Club ==&lt;br /&gt;
&lt;br /&gt;
[http://www.bio.davidson.edu/courses/synthetic/papers/Stochastic_Cells.pdf Stochasticity and Gene Expression --- Dr. Campbell]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/cryptography_graph.pdf Hash Function --- Dr. Heyer]&lt;br /&gt;
&lt;br /&gt;
== iGEM 2007 Useful Information ==&lt;br /&gt;
'''Virginia Tech''' &lt;br /&gt;
&lt;br /&gt;
''Engineering and Epidemic''&lt;br /&gt;
&lt;br /&gt;
The use of bacteria to model the spread of a disease.  It would appear that cell-to-cell communication is a major part of the design of the project.  It is unclear how successful the team was in building parts useful to us.  Most of the project seems to be on the mathematical modeling side of things.&lt;br /&gt;
&lt;br /&gt;
The use of bacteria to model the spread of a disease. It would appear that cell-to-cell communication is a major part of the design of the project. It is unclear how successful the team was in building parts useful to us. Most of the project seems to be on the mathematical modeling side of things. &lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Virginia_Tech&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''University of Waterloo'''&lt;br /&gt;
&lt;br /&gt;
''Half-Adder Logic Gate''&lt;br /&gt;
&lt;br /&gt;
The goal of this project is to design a basic device for computing. Our idea was to reproduce a circuit element called a half adder with DNA, which takes in two 1-bit inputs, adds them, and outputs a sum and a carry. Our device responds to two inputs: red light and the chemical tetracycline. The input sensors control a set of genetic switches in order to carry out the computation and fluoresces green, red, or neither, depending on the outcome.  Useful for long addition in base-2.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Waterloo&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''UCSF'''&lt;br /&gt;
&lt;br /&gt;
''Project 1: Protein Scaffolds as a Molecular Breadboard''&lt;br /&gt;
&lt;br /&gt;
Using synthetic protein scaffolds to control information flow of a kinase pathway in eukaryotic cells.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/UCSF&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tianjin'''&lt;br /&gt;
&lt;br /&gt;
''Biological diode''&lt;br /&gt;
&lt;br /&gt;
In this project, we try to construct a biological device to imitate the function of the diode, one of the most significant parts in the electric integrate circuit. The flow of molecular signal AHL is considered as the current of electric circuit. The generator, amplifiers, blocks and detector cells are constructed with the parts provided by MIT and then are equipped in series in order to establish the cellular and molecular biological diode. Our device, which is a combination of technologies from the field of computer science, molecular biology and chemical engineering, is a breakthrough for the application of mature techniques of chemical engineering to the field of synthetic biology.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tianjin&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Duke University'''&lt;br /&gt;
&lt;br /&gt;
''Bacterial Communication With Light''&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''University of Cambridge'''&lt;br /&gt;
&lt;br /&gt;
''BOL: Bacteria OnLine''&lt;br /&gt;
&lt;br /&gt;
They talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tokyo Tech'''&lt;br /&gt;
&lt;br /&gt;
''Pareto's Principle: An Ant Society''&lt;br /&gt;
&lt;br /&gt;
The goal of our project is to make a bacterial society that follows Pareto's principle as an ant society does. On the other word, we try to construct a bacterial system which takes &amp;quot;balanced differentiation&amp;quot;. Bistability and cell-cell communication are necessary to realize our model of &amp;quot;Balanced differentiation&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Quorum Sensing'''&lt;br /&gt;
[http://www.nottingham.ac.uk/quorum/index.htm See this quorum sensing web page]&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
&lt;br /&gt;
''Quorum Sensing''&lt;br /&gt;
&lt;br /&gt;
Was developing a luxL luxR quorum sensing system using OHHL. Lux quorum-sensing works like a system of sender and receiver.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Harvard#Quorum_Sensing&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Chiba'''&lt;br /&gt;
&lt;br /&gt;
''Communication Unit''&lt;br /&gt;
&lt;br /&gt;
Something about cell to cell communication involving LuxL, LuxR, and AHL. Hard to understand because they did not translate into English very well.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Chiba/Communication&lt;br /&gt;
&lt;br /&gt;
    &lt;br /&gt;
'''Brown'''&lt;br /&gt;
&lt;br /&gt;
''Cellular Lead Sensor''&lt;br /&gt;
&lt;br /&gt;
-no useful information&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Brown   &lt;br /&gt;
   &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Colombia-Israel (ORT Ebin High School)'''&lt;br /&gt;
&lt;br /&gt;
''A Microbial Biosensor Device'' &lt;br /&gt;
&lt;br /&gt;
No description left...&lt;br /&gt;
&lt;br /&gt;
- http://parts.mit.edu/igem07/index.php/Colombia-Israel%20(ORT%20Ebin%20High%20School) &lt;br /&gt;
&lt;br /&gt;
    &lt;br /&gt;
'''Edinburgh'''&lt;br /&gt;
&lt;br /&gt;
''Division PoPper'' and ''Self Flavouring Yoghurt'' &lt;br /&gt;
&lt;br /&gt;
- This team is working on a project that is looking into a form of cell communication &lt;br /&gt;
&lt;br /&gt;
- &amp;quot;We designed a signal generator device that produces an output in the form of PoPS pulses each time a bacteria undergoes cell division. Therefore it may trigger actions as a function of cell replication.&amp;quot; &lt;br /&gt;
&lt;br /&gt;
- Could not find where on this page this info came from, but it was included with this link:&lt;br /&gt;
''- The goal of this project is to design a basic device for computing. Our idea was to reproduce a circuit element called a half adder with DNA, which takes in two 1-bit inputs, adds them, and outputs a sum and a carry. Our device responds to two inputs: red light and the chemical tetracycline. The input sensors control a set of genetic switches in order to carry out the computation and fluoresces green, red, or neither, depending on the outcome. Useful for long addition in base-2.'' &lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Edinburgh#The_Projects.21&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Imperial'''&lt;br /&gt;
&lt;br /&gt;
''Infector Detector''&lt;br /&gt;
&lt;br /&gt;
-no useful information, but really interesting project...&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Imperial + UCSF (2007)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Middle East Technical University'''&lt;br /&gt;
&lt;br /&gt;
Chase simulator &lt;br /&gt;
&lt;br /&gt;
This project was not completed, but has some interesting information on E. coli cells triggering a response in nearby E. coli cells.&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Chase_Simulator&lt;br /&gt;
&lt;br /&gt;
== iGEM 2006 Useful Information ==&lt;br /&gt;
'''UT Austin 2005/2006'''&lt;br /&gt;
Project : Edge Detector &lt;br /&gt;
Link to parts: http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM&amp;amp;group=iGEM_UTAustin&lt;br /&gt;
&lt;br /&gt;
Useful information: &lt;br /&gt;
They  have &amp;quot;black boxed&amp;quot; the light-system and used it as an input for the of the edge detection circuitry. &lt;br /&gt;
&lt;br /&gt;
Edge Detector Circuit and logic. The light sensing machinery from above has been black-boxed and the edge detection circuitry has been added downstream. Red light represses the expression of 2 genes; a biosynthetic gene for a membrane diffusible quorum sensing activator (AHL), and a dominant transcriptional repressor (cI). (Right) The output of the circuit (Z;Beta-galactosidase) is ON only in the presence of X (AHL) and the absence of Y (cI). This can only occur at the light/dark boundary.&lt;br /&gt;
&lt;br /&gt;
Note: Built on 2005’s work. Pretty much the same as 2005. &lt;br /&gt;
&lt;br /&gt;
 &lt;br /&gt;
&lt;br /&gt;
''' Harvard'''&lt;br /&gt;
“Cell Surface Targeting” &lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Harvard_2006&lt;br /&gt;
&lt;br /&gt;
Project Overview&lt;br /&gt;
“In order to target nanostructures to cells, we developed adaptamers, universal nucleic acid adaptars which can link two substrates.&lt;br /&gt;
•	Such an interface could also be used to link together entire cells for the study of cell-cell interactions and the linkage of two interacting proteins, in effect creating a nucleic acid enzyme.&lt;br /&gt;
•	Adaptamers generally depend on aptamers, short sequences of nucleic acid that bind with high specificity and affinity to particular substrates.&lt;br /&gt;
•	Tahiri-Alaoui et al. created the first aptamer in 2002, consisting of two aptamer sequences linked together by a bulky basepairing region ~100 nucleotides long.&lt;br /&gt;
•	Our goal was to create an adaptamer that could link together streptavidin and thrombin. Delivery of thrombin to a streptavidin-coated magnetic bead would show the potential for delivery of a macromolecule to a cell surface.&lt;br /&gt;
Additionally, we wished to be able to be able to quench adaptamer function through the addition of an adapatamer-disabling oligonucleotide.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''The University of Calgary''' 2006 iGEM team is working on the following project. A petri plate is inhabited by two strains of genetically engineered ''E. coli'' bacteria. The first strain---the Senders---have been engineered to emit two chemical signals into the plate environment: Aspartate and Acyl Homoserine Lactone (AHSL). The senders themselves are activated by light. The second strain---the Receivers---have been designed to respond to each of these signals in a different way.&lt;br /&gt;
The Receivers express Green Fluorescent Protein in the vicinity of AHSL.&lt;br /&gt;
The Receivers also move towards areas of greater Aspartate concentration. The same bacteria also decrease Aspartate levels where they are present, as this is a nutrient and constitutes the reason for why they are attracted to it in the first place.&lt;br /&gt;
Our goal is to make the Senders and Receivers create interesting behaviour dynamics visualized by fluorescent patterns.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM2006&amp;amp;group=iGEM2006_Calgary&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Berkeley''': networks of cells communicating via conjugation; demonstrated the transmission of a coded message&lt;br /&gt;
&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/University_of_California_Berkeley_2006&lt;br /&gt;
&lt;br /&gt;
“We have developed the process of addressable conjugation for communication within a network of E. coli bacteria. Here, bacteria send messages to one another via conjugation of plasmid DNAs, but the message is only meaningful to cells with a matching address sequence. In this way, the Watson Crick base-pairing of addressing sequences replaces the spatial connectivity present in neural systems. To construct this system, we have adapted natural conjugation systems as the communication device. Information contained in the transferred plasmids is only accessable by &amp;quot;unlocking&amp;quot; the message using RNA based 'keys'. The resulting addressable conjugation process is being adapted to construct a network of NAND logic gates in bacterial cultures.”&lt;br /&gt;
&lt;br /&gt;
'''Mexico''': cellular automata&lt;br /&gt;
&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/IPN_UNAM_2006&lt;br /&gt;
&lt;br /&gt;
“We wish contribute to the iGEM project development various protein based bio-components. We will work along three main lines: complex and reversible dynamical systems and formal languages, that support particles and multiple reactions, related to the molecular transformations.”&lt;br /&gt;
&lt;br /&gt;
“We study two-dimensional cellular automaton, where every cell takes states 0 and 1 and updates its state depending on sum of states of its 8 closest neighbors as follows. Cell in state 0 takes state 1 if there are exactly two neighbors in state 1, otherwise the cell remains in state 0. Cell in state 1 remains in state 1 if there are exactly seven neighbors in state 1, otherwise the cell switches to state 0. CA governed by such cell-state transition rule exhibits reaction-diffusion like pattern dynamics, so we call this Diffusion Rule.”&lt;br /&gt;
&lt;br /&gt;
“Using the diffusion rule we can generate a dynamical pattern over a system, like turn on/off ligth with alive o dead cells that shows a luminescence, examples include fluorescence, bioluminescence and phosphorescence.”&lt;br /&gt;
“Starting with any configuration, the cells alive are represented in yellow (the activator) and dead in black (the inhibitor), see figure 4. The system is created defining an inicial state over the base configuration (see figure 3). The luminescence is obtained by the evolution of this initial pattern.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Brown:Bacterial''' Freeze Tag&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Brown:Bacterial_Freeze_Tag#Overview&lt;br /&gt;
2006 igem&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This project involves programming bacteria to be able to play a game of freeze tag. Bacteria will be engineered to swim around a microfluidics device until they reach a certain proximity to the 'IT' cell and then they will lose their ability to move. This loss of motility will be combined with a change in color from Green to Blue. When another bacterium, which is moving (not the 'IT' cell), reaches a certain proximity to the 'frozen' bacteria it will again regain its ability to move and turn from Blue to Yellow.&lt;br /&gt;
&lt;br /&gt;
TetR promoted with LuxI downstream. LuxI is an enzyme that produces AHL and will produce the red fluorescent protein (RFP). The AHL produced is exported from the cell where it then forms a complex with the LuxR protein that is produced by the AHL sensor within the Receiver cell.&lt;br /&gt;
&lt;br /&gt;
The AHL sensor is TetR promoted and forms the LuxR protein which then forms a complex with AHL. This LuxR and AHL complex then activates the pLuxR promoter. Downstream of the pLuxR promoter is the LacI protein. LacI inhibits the pLac promoter on the &amp;quot;Freeze Machine&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
A promoter that is regulated by LacI will promote the production of LasI, MotB, and cI. This will subsequently inhibit the production of CFP and LasR. In the presence of LacI, however, MotB, LasI, and cI will not be produced. CFP will therefore be produced along with LasR and LacI. This results in the &amp;quot;freezing&amp;quot; of the cell.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''McGill University Split YFP'''&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/McGill_University_2006&lt;br /&gt;
&lt;br /&gt;
The idea behind the project is fluorescence complementation, which involves the joining of two leucine zipper proteins, Fos and Jun, each fused to a half terminus of YFP. Originally, the Fos and Jun proteins were fused to a beta gene coding for a membrane protein. The project involved performing a PCR reaction to produce two inserts, the N-terminus and the C-terminus of YFP, and then ligating these inserts into 2 vectors, containing Jun-beta and the Fos-beta respectively. The two fusion proteins (Fos-beta-YFPC and Jun-beta-YFPN) were expressed in the cell membrane of two populations of E. coli. We then allowed these two cell types to combine, resulting—ideally—in the complementary binding of the Jun and Fos proteins when the cells are in close contact. Consequently, the two half YFP fragments bind to form full YFP, and the cells will fluoresce.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Penn State'''&lt;br /&gt;
http://openwetware.org/wiki/IGEM:PennState/2006&lt;br /&gt;
&lt;br /&gt;
The bacterial relay race takes advantage of an ability to control cellular motility using inducible promoters such as those involved in nutrient catabolism or quorum sensing. “Receiver” bacteria move in response to small-molecule signals either added to the system or originating from motile, “sender” strains. The most significant challenges relating to this project stem from difficulties of tightly controlling the target motility gene motB. Low levels of motB expression result in system failure (constitutive motility), and resolving this issue is essential to developing reliable modular systems that are the hallmark of synthetic biology&lt;br /&gt;
&lt;br /&gt;
'''Tokyo'''&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Tokyo_Alliance:_Conclusion&lt;br /&gt;
&lt;br /&gt;
Our project is to make this Noughts-and-Crosses in vivo.&lt;br /&gt;
-1.	Inputs&lt;br /&gt;
-1.	Chemicals&lt;br /&gt;
-1.	To indicate each square&lt;br /&gt;
-1.	To be spreaded into all squares.&lt;br /&gt;
-1.	Outputs&lt;br /&gt;
-1.	Reporter of SYANAC: GFP&lt;br /&gt;
Reporter of Human: RFP&lt;br /&gt;
&lt;br /&gt;
We can say we will expand the number of regulator genes we can use to build logic gates and through this project we made simple constructing method.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''BU 2006''' &lt;br /&gt;
Project: build a functioning &amp;quot;Biological Night-Light&amp;quot; system&lt;br /&gt;
&lt;br /&gt;
Link to parts : http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM2006&amp;amp;group=iGEM2006_BU&lt;br /&gt;
Goal&lt;br /&gt;
Isolate luxCDABE and add the 4 BioBrick restriction sites to the ends of the gene.&lt;br /&gt;
Ideas&lt;br /&gt;
&amp;quot;Proteins that affect the wavelength of the emitted light, lumazine and yellow fluorescent protein, have been isolated from Photobacterium and Vibrio species, respectively. The lumazine proteins shift the color of the light to wavelengths shorter than 490 nm...&amp;quot; (Meighen 1991) Perhaps we could build a circuit to modulate the emitted wavelength by periodically expressing a carefully-chosen fluoresent protein. Think FRET and BRET.&lt;br /&gt;
&lt;br /&gt;
Let's modify the lux operon so our bacteria can play Conway's Game of Life. In the game, discrete &amp;quot;cells&amp;quot; interact with one another according to four extremely simple rules, which essentially boil down to this: if a cell has too many or too few neighbors it turns off, otherwise it turns/stays on. These rules and the initial state of all the cells often produce systems of fascinating and lifelike complexity. Perhaps we could add a circuit such that LuxI would only be activated in response to a narrow &amp;quot;medium&amp;quot; range of concentrations of its autoinducer (3OC6HSL), not too much or too little. In fact, I think such a circuit has already been built by the Weiss lab and demonstrated with their infamous bullseye. &lt;br /&gt;
&lt;br /&gt;
'''Weiss Lab: Game of Life'''&lt;br /&gt;
Link: http://www.princeton.edu/~rweiss/&lt;br /&gt;
Note: Weiss Lab build a system that enables cells to “play” Conway’s Game of Life, where cells live or die based on the density of their neighbors.  This system exhibits complex global emergent behavior that arises from the interaction of cells based on simple local rules.&lt;br /&gt;
&lt;br /&gt;
Another system is a pulse generator where sender cells communicate to nearby receiver cells, which then respond with a transient burst of gene expression whose amplitude and duration depends on the distance from the senders. In another system, receiver cells have been engineered to respond to cell-cell communication signals from senders. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Bangalore NCBS 2006'''&lt;br /&gt;
	Synchronization of bacterial cell cycles. Use a cell cycle-dependent promoter to drive a LuxI-LuxR based cell-cell signal. Use regulation of replication initiator DnaA to modulate cell cycle in receiver cells. Immediate goals: To determine if candidate promoters oscillate; to regulate DnaA levels&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Workshop&lt;br /&gt;
&lt;br /&gt;
'''Rice University 2006'''&lt;br /&gt;
The objective of this project is to engineer Escherichia coli which are able to actively pursue and mark or eliminate another bacterial target. This system can be divided into three components: an input element, a processing element, and a response element. The input element will consist of a quorum sensing circuit which would allow specific detection of the bacterial target. The processing element will facilitate the signaling of this input into controlled responses. A number of different response elements can be conceived, to be used separately or in tandem: 1) integration into the chemotactic pathway of E. coli, allowing for directed mobilization towards the target, 2) reporter response at high pheromone concentrations to allow for visual identification of the target location (e.g., GFP production), and 3) an elimination response to produce molecules which are specifically lethal to the desired target.&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/PROJECT_PROPOSAL&lt;br /&gt;
&lt;br /&gt;
'''Cambridge''': http://parts.mit.edu/wiki/index.php/Cambridge_University_2006&lt;br /&gt;
&lt;br /&gt;
The type 1 cell produces 3O-C6-HSL (represented by the small yellow cannon ball) while type 2 produces 3O-C12-HSL (represented by the blue cannon ball).  The type 1 cell responds to 3O-C12 HSL and type 2 responds to 3O-C6 HSL. The response of type 1 cells can be visualized through the expression of RFP. The response of type 2 cells can be visualized through the expression of GFP.&lt;br /&gt;
&lt;br /&gt;
1.	Parts used for generating patterns (these are parts whose function Cambridge characterized) &lt;br /&gt;
 (a) Constitutively expressed fluorescent proteins:&lt;br /&gt;
ECFP: BBa_I13601&lt;br /&gt;
GFP: BBa_J04430&lt;br /&gt;
EYFP: BBa_I6031&lt;br /&gt;
mRFP1: BBa_J04450 &lt;br /&gt;
(b) Constitutive or auto-induced AHL synthesis:&lt;br /&gt;
Lux-sender (auto-inducing): BBa_I15030&lt;br /&gt;
Las-sender (constitutive): BBa_I0407&lt;br /&gt;
Rhl-sender (constitutive): BBa_I0405&lt;br /&gt;
Cin-sender (constitutive): BBa_I0409  &lt;br /&gt;
(c) AHL-induced fluorescence response:&lt;br /&gt;
Lux-receiver (GFP): BBa_T9002&lt;br /&gt;
Lux-receiver (EYFP): BBa_I13263&lt;br /&gt;
Las-receiver (EYFP): BBa_I0426&lt;br /&gt;
Rhl-receiver (EYFP): BBa_I0424&lt;br /&gt;
Cin-receiver (EYFP): BBa_I0428&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Princeton''': http://parts.mit.edu/wiki/index.php/Princeton:Project_Summary&lt;br /&gt;
&lt;br /&gt;
Mammalian cell-cell signaling using LuxR and LuxI…not applicable&lt;br /&gt;
&lt;br /&gt;
== iGEM 2005 Useful Information ==&lt;br /&gt;
'''Caltech'''&lt;br /&gt;
http://www.cds.caltech.edu/~murray/synbio/wiki/index.php?title=Main_Page&amp;amp;direction=prev&amp;amp;oldid=52 &lt;br /&gt;
AND gates used to build an adder (oligo technology, Winfree lab)&lt;br /&gt;
http://www.cds.caltech.edu/%7Emurray/synbio/wiki/images/5/55/Chen-surf05.pdf&lt;br /&gt;
&lt;br /&gt;
Massive models: http://www.cds.caltech.edu/%7Emurray/synbio/wiki/images/4/44/Ho-surf05.pdf&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Cambridge''' &lt;br /&gt;
http://www.ccbi.cam.ac.uk/iGEM2005/index.php/Main_Page&lt;br /&gt;
Used sender/pulse-generator from Princeton to do something?&lt;br /&gt;
AHL signal and aTc activated promoter&lt;br /&gt;
Important paper in PNAS where this is shown to work:&lt;br /&gt;
http://www.princeton.edu/~rweiss/papers/basu-pulse-2004.pdf&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
http://bio.freelogy.org/wiki/IGEM_2005&lt;br /&gt;
Bacterial wire propogates signal of AHL&lt;br /&gt;
&lt;br /&gt;
'''MIT 2005'''&lt;br /&gt;
The first way we might build such a system involves the direct communication of an antigen, which can be just about anything, with the cell; this is accomplished by attaching an antibody to the cell in such a way that the binding of an antigen to the antibody initiates a signalling cascade that terminates in PoPs. The main benefit of such a system is that it can stand alone, and is thus a viable solution to problems such as &amp;quot;how do we deploy our biosensor into a lake where it can respond to toxin levels?&amp;quot; The main issue to be dealt with is that this system is in some ways less modular; of course, anyone could just follow our steps and hook up their scFv sequence of choice.&lt;br /&gt;
http://openwetware.org/wiki/IGEM:MIT/2005/Direct_communication_of_antigen_and_receiver&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''UC Berkley 2005'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/UC_Berkeley_2005&lt;br /&gt;
&lt;br /&gt;
Conjugation is a process through which cells can exchange genetic material on plasmids. Conjugal plasmids (in our case incF and incP plasmids) carry the machinery necessary to transfer themselves in the form of mating pair formation (mpf) and DNA transfer (dtr) genes. Conjugation is under the control of the TraJ regulatory protein, which when expressed induces a cascade that results in the formation of a pore by mpf genes and then subsequent nicking, rolling circle replication and transfer of one strand of the plasmid by the relaxosome complex and other dtr proteins. The relaxosome nicks the plasmid at the OriT region and then covalently attaches one of its subunits to the 5' end of the plasmid DNA, and by doing so it is able to drag the plasmid across the pore formed by the mpf machinery by means of a coupling protein. Upon reaching its destination, the single strand of plasmid DNA is recircularized and a complement strand is synthesized by transferred primases.&lt;br /&gt;
&lt;br /&gt;
Non-mobile synthetic F plasmid: Begins the conjugation signal, which it sends to plasmid B. Also contains the CFP tag which identifies the host cell as &amp;quot;F-type&amp;quot;, and always produces mRNA 'key 2' which unlocks RNA lock 2&lt;br /&gt;
&lt;br /&gt;
-1.	-B - Non-mobile almost-wild F plasmid: Contains all F-plasmid genes EXCEPT OriTf, TraJf. Plasmid receives and propagates the conjugation signal from TraJf in plasmid 1-A and sends the signal to OriTf in 1-C&lt;br /&gt;
1-C - Mobile F plasmid: Contains the OriTf site which receives signal from plasmid 1-B. This plasmid then leaves the host cell and enters the conjugating recipient cell. Holds encrypted message (produce cI --&amp;gt; turn on GFP to signify &amp;quot;message 1 received&amp;quot;) secured by RNA lock 1.&lt;br /&gt;
&lt;br /&gt;
2-A Non-mobile synthetic R plasmid: Always produces mRNA 'key1'. Thus when it receives 'lock1' (sent by mobile plasmid 1-C) it can open the latter and produce cI, which will activate plasmid 1-C (turn on GFP, &amp;quot;message 1 received&amp;quot;) and simultaneously activate TraJr (start R conjugation cascade)&lt;br /&gt;
&lt;br /&gt;
-1.	2-B Non-mobile almost-wild R plasmid: Just like 1-B, contains all of the wild type R-plasmid EXCEPT OriTr and TraJr. Propagates TraJr signal from 2-A and sends it to OriTr&lt;br /&gt;
2-C Mobile R plasmid: Contains the OriTr site, which receives signal from plasmid 2-B. This plasmid then leaves the host cell and submits its message back into cell #1&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Penn State'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php?title=Penn_StateProjectDes&lt;br /&gt;
&lt;br /&gt;
”The idea for our project grew out of one for a &amp;quot;bacterial maze,&amp;quot; in which bacteria would use logic to make their way through a microfabricated labrynth. This seemed slightly too difficult, so we linearized the the concept and added transfer of a signal; the idea was then dubbed a &amp;quot;bacterial relay race.&amp;quot;&lt;br /&gt;
As in a conventional relay race, the signal is to &amp;quot;go,&amp;quot; or induce motility of a latter stage participant. This is accomplished by passing a baton. In our case, the participants are E. coli, and the baton is a quorum sensing molecule, 3OC6HSL (we have another strategy that utilizes conjugation rather than quorum sensing to mediate the signal).&lt;br /&gt;
In addition to passing the signal, though, the first participant must stop. We explored this option, but settled instead on terminating the first participant. In our design we really do kill the messanger.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Arizona'''  &lt;br /&gt;
“Water Color” &lt;br /&gt;
http://parts.mit.edu/wiki/index.php/University_of_Arizona_2006&lt;br /&gt;
&lt;br /&gt;
Project Details&lt;br /&gt;
“The current name of our project is &amp;quot;Water Color.&amp;quot; It is a system that selectively expresses one of three florescence proteins. Each of the three florescence proteins will be expressed in the presence of a unique inducer. Each florescent protein will be controlled by a unique repressed promoter. Thus we will have the expression of three flourescent proteins activated by the presence of there respective inducers.&lt;br /&gt;
The idea of our project is to have a media with these cells on it so that each cell will be individually activated to shown a certain &amp;quot;color&amp;quot; (in actuallity, express one florescent protein, which may or may not look unique). Thus the media is able to dispaly an image. The spacial resolution with determine how much it will look like an image. A further idea, to be implemented later (time permitting), is to have the ability to &amp;quot;erase&amp;quot; the image. This would be accomplished by repressing all three promoters. Currently, there are no plans to implement this.”&lt;br /&gt;
&lt;br /&gt;
Flowchart of Parts: http://parts.mit.edu/wiki/index.php/University_of_Arizona_2006/Parts_Schedule&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
http://bio.freelogy.org/wiki/IGEM_2005&lt;br /&gt;
&lt;br /&gt;
'''UC Berkley 2005'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/UC_Berkeley_2005&lt;br /&gt;
&lt;br /&gt;
Conjugation is a process through which cells can exchange genetic material on plasmids. Conjugal plasmids (in our case incF and incP plasmids) carry the machinery necessary to transfer themselves in the form of mating pair formation (mpf) and DNA transfer (dtr) genes. Conjugation is under the control of the TraJ regulatory protein, which when expressed induces a cascade that results in the formation of a pore by mpf genes and then subsequent nicking, rolling circle replication and transfer of one strand of the plasmid by the relaxosome complex and other dtr proteins. The relaxosome nicks the plasmid at the OriT region and then covalently attaches one of its subunits to the 5' end of the plasmid DNA, and by doing so it is able to drag the plasmid across the pore formed by the mpf machinery by means of a coupling protein. Upon reaching its destination, the single strand of plasmid DNA is recircularized and a complement strand is synthesized by transferred primases.&lt;br /&gt;
&lt;br /&gt;
Non-mobile synthetic F plasmid: Begins the conjugation signal, which it sends to plasmid B. Also contains the CFP tag which identifies the host cell as &amp;quot;F-type&amp;quot;, and always produces mRNA 'key 2' which unlocks RNA lock 2&lt;br /&gt;
&lt;br /&gt;
-1.	-B - Non-mobile almost-wild F plasmid: Contains all F-plasmid genes EXCEPT OriTf, TraJf. Plasmid receives and propagates the conjugation signal from TraJf in plasmid 1-A and sends the signal to OriTf in 1-C&lt;br /&gt;
1-C - Mobile F plasmid: Contains the OriTf site which receives signal from plasmid 1-B. This plasmid then leaves the host cell and enters the conjugating recipient cell. Holds encrypted message (produce cI --&amp;gt; turn on GFP to signify &amp;quot;message 1 received&amp;quot;) secured by RNA lock 1.&lt;br /&gt;
&lt;br /&gt;
2-A Non-mobile synthetic R plasmid: Always produces mRNA 'key1'. Thus when it receives 'lock1' (sent by mobile plasmid 1-C) it can open the latter and produce cI, which will activate plasmid 1-C (turn on GFP, &amp;quot;message 1 received&amp;quot;) and simultaneously activate TraJr (start R conjugation cascade)&lt;br /&gt;
&lt;br /&gt;
-1.	2-B Non-mobile almost-wild R plasmid: Just like 1-B, contains all of the wild type R-plasmid EXCEPT OriTr and TraJr. Propagates TraJr signal from 2-A and sends it to OriTr&lt;br /&gt;
2-C Mobile R plasmid: Contains the OriTr site, which receives signal from plasmid 2-B. This plasmid then leaves the host cell and submits its message back into cell #1&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4760</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4760"/>
				<updated>2008-05-21T15:31:44Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Karlesha Roland (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallavi Penumetcha  (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Kristi Muscalino (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Laurie Heyer (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || LasR test || Samantha Simpson (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Madeline Parra (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Max Win (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_PA3477|| rhlR gene without LVA || Malcolm Campbell (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || James Barron (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4758</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4758"/>
				<updated>2008-05-21T15:21:49Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallivi Penumetcha  (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || LasR test || Samantha Simpson (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || later&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Jeff Poet     (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Todd Eckdahl (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_PA3477|| rhlR gene without LVA || Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_J07019 || fecA promoter with Fur box || James Barron (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4756</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4756"/>
				<updated>2008-05-21T15:16:21Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallivi Penumetcha  (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0407 || LasI test || Erin Feeney (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || LasR test || Samantha Simpson (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || later&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Andrew Gordon(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Sven     (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Alicia Allen (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_PA3477|| rhlR gene without LVA || Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4753</id>
		<title>Wet Lab Pages</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Wet_Lab_Pages&amp;diff=4753"/>
				<updated>2008-05-21T15:10:14Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Registry parts to clone */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;This is the space for MWSU and DC wet lab students to create content. &lt;br /&gt;
Our part numbers will be in this range only: '''BBa_K091000 to BBa_K091999'''. &lt;br /&gt;
&lt;br /&gt;
# [http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/Davidson_Protocols Davidson Wet Lab Protocols]&lt;br /&gt;
#[http://gcat.davidson.edu/GcatWiki/index.php/Davidson_Missouri_W/MWSU_protocols MWSU Wet Lab Protocols]&lt;br /&gt;
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html Plasmid Compatability]&lt;br /&gt;
# [http://spreadsheets.google.com/pub?key=pw-NamR_FPJOfhl6mDrkZcw Davidson -80 Stocks]&lt;br /&gt;
#[http://tools.wikimedia.de/~tangotango/nubio/ FAQs for Wikis]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
----&lt;br /&gt;
== Registry parts to clone ==&lt;br /&gt;
&lt;br /&gt;
'''Composite Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_F2621|| AHL receiver with lux pR and codes for LuxR || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I15030 || Lux-sender(Autoinducing)Codes for LuxI and LuxR || Kelly Davis (DC)  will this send to part BBa_I13263&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I13263 || Lux Receiver (HSL &amp;amp; R0063 driven)produces YFP || Pallivi Penumetcha  (DC)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0426 || Las-reciver(EYFP) || Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_I0466|| RhlR Protein Generator without LVA || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
'''Basic Parts''':&lt;br /&gt;
&lt;br /&gt;
{| border=&amp;quot;1&amp;quot; cellpadding=&amp;quot;2&amp;quot;&lt;br /&gt;
!width=&amp;quot;50&amp;quot;|Part&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Description&lt;br /&gt;
!width=&amp;quot;225&amp;quot;|Student Responsible (DC or MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0061 || LuxI gene with LVA || Xiao Zhu (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0161 || LuxI gene without LVA || Xiao Zhu (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0062 || LuxR gene without LVA || John Igo (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0063 || lux pL|| Aaron Lewis (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0062|| lux pR|| Alicia Allen (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0070||  rhlI gene  ||  Sven     (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0071|| rhlR gene with LVA|| Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_R0079 || las pR || Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0079 || lasR gene || Robert Cool (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_C0078 || LasI gene || Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_PA3477|| rhlR gene without LVA || Sven (MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|-&lt;br /&gt;
|BBa_#### || Description || Sven(MW)&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson/Missouri_Western_iGEM2008&amp;diff=4666</id>
		<title>Davidson/Missouri Western iGEM2008</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson/Missouri_Western_iGEM2008&amp;diff=4666"/>
				<updated>2008-05-20T19:29:00Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Lsr cell signaling system */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;font size = &amp;quot;6&amp;quot;&amp;gt;&amp;lt;center&amp;gt;&lt;br /&gt;
Davidson College - Missouri Western State University&lt;br /&gt;
&amp;lt;/center&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
iGEM 2008&lt;br /&gt;
&amp;lt;/center&amp;gt;&amp;lt;/font&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Wet Lab Pages]]==&lt;br /&gt;
&lt;br /&gt;
== Temporary section for IM names ==&lt;br /&gt;
&lt;br /&gt;
heyermath &amp;lt;br&amp;gt;&lt;br /&gt;
genomicsguy &amp;lt;br&amp;gt;&lt;br /&gt;
lookinformammoth &amp;lt;br&amp;gt;&lt;br /&gt;
toddeckdahl &amp;lt;br&amp;gt;&lt;br /&gt;
aba767 &amp;lt;br&amp;gt;&lt;br /&gt;
Awake714 &amp;lt;br&amp;gt;&lt;br /&gt;
evelynzx &amp;lt;br&amp;gt;&lt;br /&gt;
johnigo25 &amp;lt;br&amp;gt;&lt;br /&gt;
masterwizard_32@hotmail.com &amp;lt;br&amp;gt;&lt;br /&gt;
rcoolbassman &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Las/Rhl cell signaling system ==&lt;br /&gt;
Responsible: Robert Cool&lt;br /&gt;
&lt;br /&gt;
'''Las System'''&lt;br /&gt;
&lt;br /&gt;
'''Signal Molecule''': An AHL called PAI-1 (N-3-oxododecanoyl-l-hsl)(3-oxo-C12-hsl)&lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': Pseudomonas aeruginosa gram(-)   possibly E.coli (see article 3)&lt;br /&gt;
&lt;br /&gt;
'''Receiver protein''': LasR&lt;br /&gt;
&lt;br /&gt;
'''Effect of binding''': TXN activation of virulence genes, lasA, lasB, apr, toxR&lt;br /&gt;
&lt;br /&gt;
'''Synthase''': LasI enzyme&lt;br /&gt;
&lt;br /&gt;
'''Target Genes''': lasI&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': unknown&lt;br /&gt;
 &lt;br /&gt;
&lt;br /&gt;
'''Articles'''&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes&amp;quot; &lt;br /&gt;
&lt;br /&gt;
JP Pearson, EC Pesci and BH Iglewski &lt;br /&gt;
[http://jb.asm.org/cgi/reprint/179/18/5756?maxtoshow=&amp;amp;HITS=10&amp;amp;hits=10&amp;amp;RESULTFORMAT=&amp;amp;titleabstract=las&amp;amp;searchid=1&amp;amp;FIRSTINDEX=0&amp;amp;resourcetype=HWCIT]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Regulation of Pseudomonas Quinolone Signal Synthesis in Pseudomonas aeruginosa&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Dana S. Wade, M. Worth Calfee, Edson R. Rocha, Elizabeth A. Ling, Elana Engstrom, James P. Coleman, and Everett C. Pesci&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/187/13/4372?view=long&amp;amp;pmid=15968046 2]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Posttranscriptional Control of Quorum-Sensing-Dependent Virulence Genes by DksA in Pseudomonas aeruginosa&lt;br /&gt;
&lt;br /&gt;
Florence Jude,1,2 Thilo Köhler,1 Pavel Branny,1,3 Karl Perron,1 Matthias P. Mayer,4 Rachel Comte,1 and Christian van Delden&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/185/12/3558?view=long&amp;amp;pmid=12775693 3]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Rhl System''' &lt;br /&gt;
 &lt;br /&gt;
'''Signal Molecule''': An AHL called PAI-2, Plasminogen activator inhibitor-2, N-butanoyl-homoserine lactone (C4HSL) &lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': Pseudomonas aeruginosa gram(-)&lt;br /&gt;
&lt;br /&gt;
'''Receiver Protein''': Rhl R &lt;br /&gt;
&lt;br /&gt;
'''Effect of Binding''': activation of Rhamnosyl Transferase, then making RL (rhamnolipid) &lt;br /&gt;
&lt;br /&gt;
'''Synthase''': RhlA and RhlB &lt;br /&gt;
&lt;br /&gt;
'''Target Genes''': pqsABCDE and phnAB&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': unknown&lt;br /&gt;
&lt;br /&gt;
Additional References: [http://jb.asm.org/cgi/reprint/189/13/4827 background information on Las and Rhl]&lt;br /&gt;
&lt;br /&gt;
[[Image:Las_rhl.gif]]&lt;br /&gt;
== Lux cell signaling system ==&lt;br /&gt;
&lt;br /&gt;
'''Responsible:''' Andrew Gordon&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule:''' ''N''-acyl-homoserine lactone (AHL) Generic term for a variety of species specific hormone-like molecules &lt;br /&gt;
&lt;br /&gt;
'''Bacterial species:''' discovered in ''Vibrio fischeri'' known to work in ''E. coli''&lt;br /&gt;
&lt;br /&gt;
'''Receiver protein:''' LuxR protein receives signal from AHL; also has some control over transciption of luciferase&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule synthase:''' LuxI; also has some control over transciption of luciferase&lt;br /&gt;
&lt;br /&gt;
'''Additional Information:''' &amp;quot;Quorum Quenching&amp;quot; lactonase reduces AHL concentration&lt;br /&gt;
&lt;br /&gt;
[[Image:800px-Luxrreceiverschematic.png]]&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/Lux Lux Operon Pathway]&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/AHL AHL signaling molecules by species; some are specific to gram pos but may affect gram negs]&lt;br /&gt;
&lt;br /&gt;
[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=522112 Quorum Quenching to control Lux Pathway]&lt;br /&gt;
&lt;br /&gt;
== Lsr cell signaling system ==&lt;br /&gt;
&lt;br /&gt;
'''Responsible''': Kelly Davis&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule''': AI-2, furanosyl borate diester, derived from the ribosyl part of S-ribosylhomocysteine, [http://www.biomedcentral.com/content/pdf/1471-2148-4-36.pdf]&lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': discovered in Vibrio harveyi, but interspecies signalling occurs, Escherichia coli E24377A (strain: E24377A) (for lsrK), Escherichia coli str. K-12 substr. DH10B (strain: K-12, substrain: DH10B) (for lsrR)&lt;br /&gt;
&lt;br /&gt;
'''Receiver protein''': LsrR protein receives signal from sensor protein&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule synthase''': Pfs enzyme, then LuxS autoinducer synthase&lt;br /&gt;
&lt;br /&gt;
'''Target genes''': lsr operon, including ABC transporter and LsrK kinase&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': LsrR represses the lsr operon, derepression by phospho-AI-2&lt;br /&gt;
&lt;br /&gt;
'''Additional References''': [http://www.microbialcellfactories.com/content/pdf/1475-2859-1-5.pdf Review of AI-2 and other systems], [http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=22733&amp;amp;blobtype=pdf E. coli produces a signal that can substitute for AI-2], [http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&amp;amp;cmd=Retrieve&amp;amp;dopt=full_report&amp;amp;list_uids=5586283] (for information on lsrK), [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&amp;amp;Cmd=ShowDetailView&amp;amp;TermToSearch=6062136&amp;amp;ordinalpos=9&amp;amp;itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum#summary] (for lsrR), [http://BioCyc.org/ECOLI/substring-search?type=NIL&amp;amp;object=lsr], [http://www.ncbi.nlm.nih.gov/pubmed/14622426]&lt;br /&gt;
&lt;br /&gt;
http://www.nature.com/nrmicro/journal/v3/n5/images/nrmicro1146-f2.gif&lt;br /&gt;
&lt;br /&gt;
== Signal molecules ==&lt;br /&gt;
&lt;br /&gt;
[[Image:QSsignals.gif|QSsignals.gif]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Gram (-) bacteria use:'''&lt;br /&gt;
&lt;br /&gt;
3-oxo-C6-HSL, N-(3-oxohexanoyl)-L-homoserine lactone, an AHL&lt;br /&gt;
&lt;br /&gt;
DPD, the AI-2 precursor, 4,5 dihydroxy-2,3-pentanedione&lt;br /&gt;
&lt;br /&gt;
HHQ, 2-heptyl-4(1H)-quinolone, an AQ&lt;br /&gt;
&lt;br /&gt;
'''Gram (+) bacteria use:'''&lt;br /&gt;
&lt;br /&gt;
DPD, the AI-2 precursor, 4,5 dihydroxy-2,3-pentanedione&lt;br /&gt;
&lt;br /&gt;
A-Factor, 2-isocapryloyl-3-hydroxymethyl--butyrolactone&lt;br /&gt;
&lt;br /&gt;
PQS, pseudomonas quinolone signal, 2-heptyl-3-hydroxy-4(1H)-quinolone&lt;br /&gt;
&lt;br /&gt;
DSF, ‘diffusible factor’, cis-11-methyl-2-dodecenoic acid&lt;br /&gt;
&lt;br /&gt;
3OH-PAME, hydroxyl-palmitic acid methyl ester; &lt;br /&gt;
&lt;br /&gt;
AIP-1, staphylococcal autoinducing peptide 1&lt;br /&gt;
&lt;br /&gt;
== E. coli Signaling ==&lt;br /&gt;
&lt;br /&gt;
&amp;quot;As yet no AHL-producing Escherichia coli or Salmonella strains have been identified, although both organisms possess an AHL receptor (SdiA) of the LuxR protein class and respond to AHLs produced by other bacteria.&amp;quot; [http://mic.sgmjournals.org/cgi/reprint/153/12/3923 Williams 2007]&lt;br /&gt;
&lt;br /&gt;
== Fec cell signaling system ==&lt;br /&gt;
Responsible: Xiao Zhu&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
Harvard iGEM'07 team worked with Fec system, the results were not favorable. [http://parts.mit.edu/igem07/index.php/Harvard#Quorum_Sensing :We believe that overexpression of the Fec system killed the cells, possibly by disturbing the cell membranes.]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Ferric Dicitrate Transport System'''&lt;br /&gt;
The inducer, ferric citrate, binds to an outer membrane transport protein, FecA, and without further transport elicits a signal that is transmitted across the outer membrane (by FecA), the periplasm, and the cytoplasmic membrane (by FecBCDE and FecR) into the cytoplasm. Signal transfer across the three subcellular compartments is mediated by the outer membrane transport protein (FecA) that interacts in the periplasm with a cytoplasmic transmembrane protein (FecR). FecR is required for activation of a sigma factor (FecI) which belongs to the extracytoplasmic function (ECF)sigma factor family.&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
Only iron not iron complex enters the cytoplasm. FecA is the TonB energy transducing system-dependent. &lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Signaling Molecule:''' FeC (ferric dicitrate)&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Receptor Protein: ''' FecA&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Effect of binding:''' the conformational changes that FecA undergoes when binding to ferric citrate:The alpha helix in loop 7 unravels, and the loop moves by up to 11 angstroms ; Loop 8 moves up to 15 angstroms.&lt;br /&gt;
http://www.rsc.org/ej/CS/2007/b617040b/b617040b-f13.gif&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Sensor Producer:''' N/A&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Bacteria species:''' E.coli, Pseudomonas putida, P. aeruginosa, Serratia marcescens, Klebsiella pneumoniae, Aerobacter aerogenes, Bordetella pertussis, B. bronchseptica, B. avium, and Ralstonia solanacearum.&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://pathway.gramene.org/ECOLI/NEW-IMAGE?type=REACTION&amp;amp;object=RXN0-2261 More detailed information about Fec]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=215624&amp;amp;blobtype=pdf Exogenous Induction of the Iron Dicitrate Transport System of Escherichia coli K-12]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/183/1/162 Control of the Ferric Citrate Transport System of Escherichia coli:Mutations in Region2.1 of the FecI ECF Sigma Factor Suppress Mutations in the FecR Transmembrane Regulatory Protein]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/189/19/6913 Docking of the Periplasmic FecB Binding Protein to the FecCD Transmembrane Proteins in the Ferric Citrate Transport System of Escherichia coli]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/abstract/185/6/1870 Interactions between the Outer Membrane Ferric Citrate Transporter FecA and TonB: Studies of the FecA TonB Box]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Cell signaling resources ==&lt;br /&gt;
[http://partsregistry.org/Featured_Parts:Cell-Cell-Signaling Featured parts in iGEM registry]&lt;br /&gt;
&lt;br /&gt;
[http://en.wikipedia.org/wiki/Cell_signaling Wikipedia entry]&lt;br /&gt;
&lt;br /&gt;
[http://mic.sgmjournals.org/cgi/reprint/153/12/3923 Quorum sensing, communication and cross-kingdom signalling in the bacterial world]&lt;br /&gt;
&lt;br /&gt;
[http://www.molbio.princeton.edu/index.php?option=content&amp;amp;task=view&amp;amp;id=27 Bonnie Bassler lab at Princeton]&lt;br /&gt;
&lt;br /&gt;
[http://www.nottingham.ac.uk/quorum/ One-Stop Shopping for QS from Nottingham]&lt;br /&gt;
&lt;br /&gt;
[http://journals.royalsociety.org/content/w26732234707/?p=c1685368363e450faabedd3ee8fd60dc&amp;amp;pi=3 Special Issue: Bacterial conversations: talking, listening and eavesdropping]&lt;br /&gt;
&lt;br /&gt;
[http://library.albany.edu/science/whatsnew_dialogs.htm Dialogs with Bacteria: Quorum Sensing]&lt;br /&gt;
&lt;br /&gt;
[http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/C/CellSignaling.html General Types of Cell Signaling: Bacteria on Steroids?]&lt;br /&gt;
&lt;br /&gt;
[http://www.samsi.info/200405/compbio/workinggroup/cell/Eungdamrong_Iyengar_Biology_of_the_Cell_96_355_2004.pdf Modeling Cell-Signaling Networks]&lt;br /&gt;
&lt;br /&gt;
[http://journals.royalsociety.org/content/m5hgygq1t6daxy72/fulltext.pdf Quorum Sensing and the Population Control of Virulence]&lt;br /&gt;
&lt;br /&gt;
== Davidson Journal Club ==&lt;br /&gt;
&lt;br /&gt;
[http://www.bio.davidson.edu/courses/synthetic/papers/Stochastic_Cells.pdf Stochasticity and Gene Expression --- Dr. Campbell]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/cryptography_graph.pdf Hash Function --- Dr. Heyer]&lt;br /&gt;
&lt;br /&gt;
== iGEM 2007 Useful Information ==&lt;br /&gt;
'''Virginia Tech''' &lt;br /&gt;
&lt;br /&gt;
''Engineering and Epidemic''&lt;br /&gt;
&lt;br /&gt;
The use of bacteria to model the spread of a disease.  It would appear that cell-to-cell communication is a major part of the design of the project.  It is unclear how successful the team was in building parts useful to us.  Most of the project seems to be on the mathematical modeling side of things.&lt;br /&gt;
&lt;br /&gt;
The use of bacteria to model the spread of a disease. It would appear that cell-to-cell communication is a major part of the design of the project. It is unclear how successful the team was in building parts useful to us. Most of the project seems to be on the mathematical modeling side of things. &lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Virginia_Tech&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''University of Waterloo'''&lt;br /&gt;
&lt;br /&gt;
''Half-Adder Logic Gate''&lt;br /&gt;
&lt;br /&gt;
The goal of this project is to design a basic device for computing. Our idea was to reproduce a circuit element called a half adder with DNA, which takes in two 1-bit inputs, adds them, and outputs a sum and a carry. Our device responds to two inputs: red light and the chemical tetracycline. The input sensors control a set of genetic switches in order to carry out the computation and fluoresces green, red, or neither, depending on the outcome.  Useful for long addition in base-2.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Waterloo&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''UCSF'''&lt;br /&gt;
&lt;br /&gt;
''Project 1: Protein Scaffolds as a Molecular Breadboard''&lt;br /&gt;
&lt;br /&gt;
Using synthetic protein scaffolds to control information flow of a kinase pathway in eukaryotic cells.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/UCSF&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tianjin'''&lt;br /&gt;
&lt;br /&gt;
''Biological diode''&lt;br /&gt;
&lt;br /&gt;
In this project, we try to construct a biological device to imitate the function of the diode, one of the most significant parts in the electric integrate circuit. The flow of molecular signal AHL is considered as the current of electric circuit. The generator, amplifiers, blocks and detector cells are constructed with the parts provided by MIT and then are equipped in series in order to establish the cellular and molecular biological diode. Our device, which is a combination of technologies from the field of computer science, molecular biology and chemical engineering, is a breakthrough for the application of mature techniques of chemical engineering to the field of synthetic biology.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tianjin&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Duke University'''&lt;br /&gt;
&lt;br /&gt;
''Bacterial Communication With Light''&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''University of Cambridge'''&lt;br /&gt;
&lt;br /&gt;
''BOL: Bacteria OnLine''&lt;br /&gt;
&lt;br /&gt;
They talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tokyo Tech'''&lt;br /&gt;
&lt;br /&gt;
''Pareto's Principle: An Ant Society''&lt;br /&gt;
&lt;br /&gt;
The goal of our project is to make a bacterial society that follows Pareto's principle as an ant society does. On the other word, we try to construct a bacterial system which takes &amp;quot;balanced differentiation&amp;quot;. Bistability and cell-cell communication are necessary to realize our model of &amp;quot;Balanced differentiation&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Quorum Sensing'''&lt;br /&gt;
[http://www.nottingham.ac.uk/quorum/index.htm See this quorum sensing web page]&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
&lt;br /&gt;
''Quorum Sensing''&lt;br /&gt;
&lt;br /&gt;
Was developing a luxL luxR quorum sensing system using OHHL. Lux quorum-sensing works like a system of sender and receiver.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Harvard#Quorum_Sensing&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Chiba'''&lt;br /&gt;
&lt;br /&gt;
''Communication Unit''&lt;br /&gt;
&lt;br /&gt;
Something about cell to cell communication involving LuxL, LuxR, and AHL. Hard to understand because they did not translate into English very well.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Chiba/Communication&lt;br /&gt;
&lt;br /&gt;
    &lt;br /&gt;
'''Brown'''&lt;br /&gt;
&lt;br /&gt;
''Cellular Lead Sensor''&lt;br /&gt;
&lt;br /&gt;
-no useful information&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Brown   &lt;br /&gt;
   &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Colombia-Israel (ORT Ebin High School)'''&lt;br /&gt;
&lt;br /&gt;
''A Microbial Biosensor Device'' &lt;br /&gt;
&lt;br /&gt;
No description left...&lt;br /&gt;
&lt;br /&gt;
- http://parts.mit.edu/igem07/index.php/Colombia-Israel%20(ORT%20Ebin%20High%20School) &lt;br /&gt;
&lt;br /&gt;
    &lt;br /&gt;
'''Edinburgh'''&lt;br /&gt;
&lt;br /&gt;
''Division PoPper'' and ''Self Flavouring Yoghurt'' &lt;br /&gt;
&lt;br /&gt;
- This team is working on a project that is looking into a form of cell communication &lt;br /&gt;
&lt;br /&gt;
- &amp;quot;We designed a signal generator device that produces an output in the form of PoPS pulses each time a bacteria undergoes cell division. Therefore it may trigger actions as a function of cell replication.&amp;quot; &lt;br /&gt;
&lt;br /&gt;
- Could not find where on this page this info came from, but it was included with this link:&lt;br /&gt;
''- The goal of this project is to design a basic device for computing. Our idea was to reproduce a circuit element called a half adder with DNA, which takes in two 1-bit inputs, adds them, and outputs a sum and a carry. Our device responds to two inputs: red light and the chemical tetracycline. The input sensors control a set of genetic switches in order to carry out the computation and fluoresces green, red, or neither, depending on the outcome. Useful for long addition in base-2.'' &lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Edinburgh#The_Projects.21&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Imperial'''&lt;br /&gt;
&lt;br /&gt;
''Infector Detector''&lt;br /&gt;
&lt;br /&gt;
-no useful information, but really interesting project...&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Imperial + UCSF (2007)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Middle East Technical University'''&lt;br /&gt;
&lt;br /&gt;
Chase simulator &lt;br /&gt;
&lt;br /&gt;
This project was not completed, but has some interesting information on E. coli cells triggering a response in nearby E. coli cells.&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Chase_Simulator&lt;br /&gt;
&lt;br /&gt;
== iGEM 2006 Useful Information ==&lt;br /&gt;
'''UT Austin 2005/2006'''&lt;br /&gt;
Project : Edge Detector &lt;br /&gt;
Link to parts: http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM&amp;amp;group=iGEM_UTAustin&lt;br /&gt;
&lt;br /&gt;
Useful information: &lt;br /&gt;
They  have &amp;quot;black boxed&amp;quot; the light-system and used it as an input for the of the edge detection circuitry. &lt;br /&gt;
&lt;br /&gt;
Edge Detector Circuit and logic. The light sensing machinery from above has been black-boxed and the edge detection circuitry has been added downstream. Red light represses the expression of 2 genes; a biosynthetic gene for a membrane diffusible quorum sensing activator (AHL), and a dominant transcriptional repressor (cI). (Right) The output of the circuit (Z;Beta-galactosidase) is ON only in the presence of X (AHL) and the absence of Y (cI). This can only occur at the light/dark boundary.&lt;br /&gt;
&lt;br /&gt;
Note: Built on 2005’s work. Pretty much the same as 2005. &lt;br /&gt;
&lt;br /&gt;
 &lt;br /&gt;
&lt;br /&gt;
''' Harvard'''&lt;br /&gt;
“Cell Surface Targeting” &lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Harvard_2006&lt;br /&gt;
&lt;br /&gt;
Project Overview&lt;br /&gt;
“In order to target nanostructures to cells, we developed adaptamers, universal nucleic acid adaptars which can link two substrates.&lt;br /&gt;
•	Such an interface could also be used to link together entire cells for the study of cell-cell interactions and the linkage of two interacting proteins, in effect creating a nucleic acid enzyme.&lt;br /&gt;
•	Adaptamers generally depend on aptamers, short sequences of nucleic acid that bind with high specificity and affinity to particular substrates.&lt;br /&gt;
•	Tahiri-Alaoui et al. created the first aptamer in 2002, consisting of two aptamer sequences linked together by a bulky basepairing region ~100 nucleotides long.&lt;br /&gt;
•	Our goal was to create an adaptamer that could link together streptavidin and thrombin. Delivery of thrombin to a streptavidin-coated magnetic bead would show the potential for delivery of a macromolecule to a cell surface.&lt;br /&gt;
Additionally, we wished to be able to be able to quench adaptamer function through the addition of an adapatamer-disabling oligonucleotide.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''The University of Calgary''' 2006 iGEM team is working on the following project. A petri plate is inhabited by two strains of genetically engineered ''E. coli'' bacteria. The first strain---the Senders---have been engineered to emit two chemical signals into the plate environment: Aspartate and Acyl Homoserine Lactone (AHSL). The senders themselves are activated by light. The second strain---the Receivers---have been designed to respond to each of these signals in a different way.&lt;br /&gt;
The Receivers express Green Fluorescent Protein in the vicinity of AHSL.&lt;br /&gt;
The Receivers also move towards areas of greater Aspartate concentration. The same bacteria also decrease Aspartate levels where they are present, as this is a nutrient and constitutes the reason for why they are attracted to it in the first place.&lt;br /&gt;
Our goal is to make the Senders and Receivers create interesting behaviour dynamics visualized by fluorescent patterns.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM2006&amp;amp;group=iGEM2006_Calgary&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Berkeley''': networks of cells communicating via conjugation; demonstrated the transmission of a coded message&lt;br /&gt;
&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/University_of_California_Berkeley_2006&lt;br /&gt;
&lt;br /&gt;
“We have developed the process of addressable conjugation for communication within a network of E. coli bacteria. Here, bacteria send messages to one another via conjugation of plasmid DNAs, but the message is only meaningful to cells with a matching address sequence. In this way, the Watson Crick base-pairing of addressing sequences replaces the spatial connectivity present in neural systems. To construct this system, we have adapted natural conjugation systems as the communication device. Information contained in the transferred plasmids is only accessable by &amp;quot;unlocking&amp;quot; the message using RNA based 'keys'. The resulting addressable conjugation process is being adapted to construct a network of NAND logic gates in bacterial cultures.”&lt;br /&gt;
&lt;br /&gt;
'''Mexico''': cellular automata&lt;br /&gt;
&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/IPN_UNAM_2006&lt;br /&gt;
&lt;br /&gt;
“We wish contribute to the iGEM project development various protein based bio-components. We will work along three main lines: complex and reversible dynamical systems and formal languages, that support particles and multiple reactions, related to the molecular transformations.”&lt;br /&gt;
&lt;br /&gt;
“We study two-dimensional cellular automaton, where every cell takes states 0 and 1 and updates its state depending on sum of states of its 8 closest neighbors as follows. Cell in state 0 takes state 1 if there are exactly two neighbors in state 1, otherwise the cell remains in state 0. Cell in state 1 remains in state 1 if there are exactly seven neighbors in state 1, otherwise the cell switches to state 0. CA governed by such cell-state transition rule exhibits reaction-diffusion like pattern dynamics, so we call this Diffusion Rule.”&lt;br /&gt;
&lt;br /&gt;
“Using the diffusion rule we can generate a dynamical pattern over a system, like turn on/off ligth with alive o dead cells that shows a luminescence, examples include fluorescence, bioluminescence and phosphorescence.”&lt;br /&gt;
“Starting with any configuration, the cells alive are represented in yellow (the activator) and dead in black (the inhibitor), see figure 4. The system is created defining an inicial state over the base configuration (see figure 3). The luminescence is obtained by the evolution of this initial pattern.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Brown:Bacterial''' Freeze Tag&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Brown:Bacterial_Freeze_Tag#Overview&lt;br /&gt;
2006 igem&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This project involves programming bacteria to be able to play a game of freeze tag. Bacteria will be engineered to swim around a microfluidics device until they reach a certain proximity to the 'IT' cell and then they will lose their ability to move. This loss of motility will be combined with a change in color from Green to Blue. When another bacterium, which is moving (not the 'IT' cell), reaches a certain proximity to the 'frozen' bacteria it will again regain its ability to move and turn from Blue to Yellow.&lt;br /&gt;
&lt;br /&gt;
TetR promoted with LuxI downstream. LuxI is an enzyme that produces AHL and will produce the red fluorescent protein (RFP). The AHL produced is exported from the cell where it then forms a complex with the LuxR protein that is produced by the AHL sensor within the Receiver cell.&lt;br /&gt;
&lt;br /&gt;
The AHL sensor is TetR promoted and forms the LuxR protein which then forms a complex with AHL. This LuxR and AHL complex then activates the pLuxR promoter. Downstream of the pLuxR promoter is the LacI protein. LacI inhibits the pLac promoter on the &amp;quot;Freeze Machine&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
A promoter that is regulated by LacI will promote the production of LasI, MotB, and cI. This will subsequently inhibit the production of CFP and LasR. In the presence of LacI, however, MotB, LasI, and cI will not be produced. CFP will therefore be produced along with LasR and LacI. This results in the &amp;quot;freezing&amp;quot; of the cell.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''McGill University Split YFP'''&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/McGill_University_2006&lt;br /&gt;
&lt;br /&gt;
The idea behind the project is fluorescence complementation, which involves the joining of two leucine zipper proteins, Fos and Jun, each fused to a half terminus of YFP. Originally, the Fos and Jun proteins were fused to a beta gene coding for a membrane protein. The project involved performing a PCR reaction to produce two inserts, the N-terminus and the C-terminus of YFP, and then ligating these inserts into 2 vectors, containing Jun-beta and the Fos-beta respectively. The two fusion proteins (Fos-beta-YFPC and Jun-beta-YFPN) were expressed in the cell membrane of two populations of E. coli. We then allowed these two cell types to combine, resulting—ideally—in the complementary binding of the Jun and Fos proteins when the cells are in close contact. Consequently, the two half YFP fragments bind to form full YFP, and the cells will fluoresce.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Penn State'''&lt;br /&gt;
http://openwetware.org/wiki/IGEM:PennState/2006&lt;br /&gt;
&lt;br /&gt;
The bacterial relay race takes advantage of an ability to control cellular motility using inducible promoters such as those involved in nutrient catabolism or quorum sensing. “Receiver” bacteria move in response to small-molecule signals either added to the system or originating from motile, “sender” strains. The most significant challenges relating to this project stem from difficulties of tightly controlling the target motility gene motB. Low levels of motB expression result in system failure (constitutive motility), and resolving this issue is essential to developing reliable modular systems that are the hallmark of synthetic biology&lt;br /&gt;
&lt;br /&gt;
'''Tokyo'''&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Tokyo_Alliance:_Conclusion&lt;br /&gt;
&lt;br /&gt;
Our project is to make this Noughts-and-Crosses in vivo.&lt;br /&gt;
-1.	Inputs&lt;br /&gt;
-1.	Chemicals&lt;br /&gt;
-1.	To indicate each square&lt;br /&gt;
-1.	To be spreaded into all squares.&lt;br /&gt;
-1.	Outputs&lt;br /&gt;
-1.	Reporter of SYANAC: GFP&lt;br /&gt;
Reporter of Human: RFP&lt;br /&gt;
&lt;br /&gt;
We can say we will expand the number of regulator genes we can use to build logic gates and through this project we made simple constructing method.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''BU 2006''' &lt;br /&gt;
Project: build a functioning &amp;quot;Biological Night-Light&amp;quot; system&lt;br /&gt;
&lt;br /&gt;
Link to parts : http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM2006&amp;amp;group=iGEM2006_BU&lt;br /&gt;
Goal&lt;br /&gt;
Isolate luxCDABE and add the 4 BioBrick restriction sites to the ends of the gene.&lt;br /&gt;
Ideas&lt;br /&gt;
&amp;quot;Proteins that affect the wavelength of the emitted light, lumazine and yellow fluorescent protein, have been isolated from Photobacterium and Vibrio species, respectively. The lumazine proteins shift the color of the light to wavelengths shorter than 490 nm...&amp;quot; (Meighen 1991) Perhaps we could build a circuit to modulate the emitted wavelength by periodically expressing a carefully-chosen fluoresent protein. Think FRET and BRET.&lt;br /&gt;
&lt;br /&gt;
Let's modify the lux operon so our bacteria can play Conway's Game of Life. In the game, discrete &amp;quot;cells&amp;quot; interact with one another according to four extremely simple rules, which essentially boil down to this: if a cell has too many or too few neighbors it turns off, otherwise it turns/stays on. These rules and the initial state of all the cells often produce systems of fascinating and lifelike complexity. Perhaps we could add a circuit such that LuxI would only be activated in response to a narrow &amp;quot;medium&amp;quot; range of concentrations of its autoinducer (3OC6HSL), not too much or too little. In fact, I think such a circuit has already been built by the Weiss lab and demonstrated with their infamous bullseye. &lt;br /&gt;
&lt;br /&gt;
'''Weiss Lab: Game of Life'''&lt;br /&gt;
Link: http://www.princeton.edu/~rweiss/&lt;br /&gt;
Note: Weiss Lab build a system that enables cells to “play” Conway’s Game of Life, where cells live or die based on the density of their neighbors.  This system exhibits complex global emergent behavior that arises from the interaction of cells based on simple local rules.&lt;br /&gt;
&lt;br /&gt;
Another system is a pulse generator where sender cells communicate to nearby receiver cells, which then respond with a transient burst of gene expression whose amplitude and duration depends on the distance from the senders. In another system, receiver cells have been engineered to respond to cell-cell communication signals from senders. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Bangalore NCBS 2006'''&lt;br /&gt;
	Synchronization of bacterial cell cycles. Use a cell cycle-dependent promoter to drive a LuxI-LuxR based cell-cell signal. Use regulation of replication initiator DnaA to modulate cell cycle in receiver cells. Immediate goals: To determine if candidate promoters oscillate; to regulate DnaA levels&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Workshop&lt;br /&gt;
&lt;br /&gt;
'''Rice University 2006'''&lt;br /&gt;
The objective of this project is to engineer Escherichia coli which are able to actively pursue and mark or eliminate another bacterial target. This system can be divided into three components: an input element, a processing element, and a response element. The input element will consist of a quorum sensing circuit which would allow specific detection of the bacterial target. The processing element will facilitate the signaling of this input into controlled responses. A number of different response elements can be conceived, to be used separately or in tandem: 1) integration into the chemotactic pathway of E. coli, allowing for directed mobilization towards the target, 2) reporter response at high pheromone concentrations to allow for visual identification of the target location (e.g., GFP production), and 3) an elimination response to produce molecules which are specifically lethal to the desired target.&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/PROJECT_PROPOSAL&lt;br /&gt;
&lt;br /&gt;
'''Cambridge''': http://parts.mit.edu/wiki/index.php/Cambridge_University_2006&lt;br /&gt;
&lt;br /&gt;
The type 1 cell produces 3O-C6-HSL (represented by the small yellow cannon ball) while type 2 produces 3O-C12-HSL (represented by the blue cannon ball).  The type 1 cell responds to 3O-C12 HSL and type 2 responds to 3O-C6 HSL. The response of type 1 cells can be visualized through the expression of RFP. The response of type 2 cells can be visualized through the expression of GFP.&lt;br /&gt;
&lt;br /&gt;
1.	Parts used for generating patterns (these are parts whose function Cambridge characterized) &lt;br /&gt;
 (a) Constitutively expressed fluorescent proteins:&lt;br /&gt;
ECFP: BBa_I13601&lt;br /&gt;
GFP: BBa_J04430&lt;br /&gt;
EYFP: BBa_I6031&lt;br /&gt;
mRFP1: BBa_J04450 &lt;br /&gt;
(b) Constitutive or auto-induced AHL synthesis:&lt;br /&gt;
Lux-sender (auto-inducing): BBa_I15030&lt;br /&gt;
Las-sender (constitutive): BBa_I0407&lt;br /&gt;
Rhl-sender (constitutive): BBa_I0405&lt;br /&gt;
Cin-sender (constitutive): BBa_I0409  &lt;br /&gt;
(c) AHL-induced fluorescence response:&lt;br /&gt;
Lux-receiver (GFP): BBa_T9002&lt;br /&gt;
Lux-receiver (EYFP): BBa_I13263&lt;br /&gt;
Las-receiver (EYFP): BBa_I0426&lt;br /&gt;
Rhl-receiver (EYFP): BBa_I0424&lt;br /&gt;
Cin-receiver (EYFP): BBa_I0428&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Princeton''': http://parts.mit.edu/wiki/index.php/Princeton:Project_Summary&lt;br /&gt;
&lt;br /&gt;
Mammalian cell-cell signaling using LuxR and LuxI…not applicable&lt;br /&gt;
&lt;br /&gt;
== iGEM 2005 Useful Information ==&lt;br /&gt;
'''Caltech'''&lt;br /&gt;
http://www.cds.caltech.edu/~murray/synbio/wiki/index.php?title=Main_Page&amp;amp;direction=prev&amp;amp;oldid=52 &lt;br /&gt;
AND gates used to build an adder (oligo technology, Winfree lab)&lt;br /&gt;
http://www.cds.caltech.edu/%7Emurray/synbio/wiki/images/5/55/Chen-surf05.pdf&lt;br /&gt;
&lt;br /&gt;
Massive models: http://www.cds.caltech.edu/%7Emurray/synbio/wiki/images/4/44/Ho-surf05.pdf&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Cambridge''' &lt;br /&gt;
http://www.ccbi.cam.ac.uk/iGEM2005/index.php/Main_Page&lt;br /&gt;
Used sender/pulse-generator from Princeton to do something?&lt;br /&gt;
AHL signal and aTc activated promoter&lt;br /&gt;
Important paper in PNAS where this is shown to work:&lt;br /&gt;
http://www.princeton.edu/~rweiss/papers/basu-pulse-2004.pdf&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
http://bio.freelogy.org/wiki/IGEM_2005&lt;br /&gt;
Bacterial wire propogates signal of AHL&lt;br /&gt;
&lt;br /&gt;
'''MIT 2005'''&lt;br /&gt;
The first way we might build such a system involves the direct communication of an antigen, which can be just about anything, with the cell; this is accomplished by attaching an antibody to the cell in such a way that the binding of an antigen to the antibody initiates a signalling cascade that terminates in PoPs. The main benefit of such a system is that it can stand alone, and is thus a viable solution to problems such as &amp;quot;how do we deploy our biosensor into a lake where it can respond to toxin levels?&amp;quot; The main issue to be dealt with is that this system is in some ways less modular; of course, anyone could just follow our steps and hook up their scFv sequence of choice.&lt;br /&gt;
http://openwetware.org/wiki/IGEM:MIT/2005/Direct_communication_of_antigen_and_receiver&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''UC Berkley 2005'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/UC_Berkeley_2005&lt;br /&gt;
&lt;br /&gt;
Conjugation is a process through which cells can exchange genetic material on plasmids. Conjugal plasmids (in our case incF and incP plasmids) carry the machinery necessary to transfer themselves in the form of mating pair formation (mpf) and DNA transfer (dtr) genes. Conjugation is under the control of the TraJ regulatory protein, which when expressed induces a cascade that results in the formation of a pore by mpf genes and then subsequent nicking, rolling circle replication and transfer of one strand of the plasmid by the relaxosome complex and other dtr proteins. The relaxosome nicks the plasmid at the OriT region and then covalently attaches one of its subunits to the 5' end of the plasmid DNA, and by doing so it is able to drag the plasmid across the pore formed by the mpf machinery by means of a coupling protein. Upon reaching its destination, the single strand of plasmid DNA is recircularized and a complement strand is synthesized by transferred primases.&lt;br /&gt;
&lt;br /&gt;
Non-mobile synthetic F plasmid: Begins the conjugation signal, which it sends to plasmid B. Also contains the CFP tag which identifies the host cell as &amp;quot;F-type&amp;quot;, and always produces mRNA 'key 2' which unlocks RNA lock 2&lt;br /&gt;
&lt;br /&gt;
-1.	-B - Non-mobile almost-wild F plasmid: Contains all F-plasmid genes EXCEPT OriTf, TraJf. Plasmid receives and propagates the conjugation signal from TraJf in plasmid 1-A and sends the signal to OriTf in 1-C&lt;br /&gt;
1-C - Mobile F plasmid: Contains the OriTf site which receives signal from plasmid 1-B. This plasmid then leaves the host cell and enters the conjugating recipient cell. Holds encrypted message (produce cI --&amp;gt; turn on GFP to signify &amp;quot;message 1 received&amp;quot;) secured by RNA lock 1.&lt;br /&gt;
&lt;br /&gt;
2-A Non-mobile synthetic R plasmid: Always produces mRNA 'key1'. Thus when it receives 'lock1' (sent by mobile plasmid 1-C) it can open the latter and produce cI, which will activate plasmid 1-C (turn on GFP, &amp;quot;message 1 received&amp;quot;) and simultaneously activate TraJr (start R conjugation cascade)&lt;br /&gt;
&lt;br /&gt;
-1.	2-B Non-mobile almost-wild R plasmid: Just like 1-B, contains all of the wild type R-plasmid EXCEPT OriTr and TraJr. Propagates TraJr signal from 2-A and sends it to OriTr&lt;br /&gt;
2-C Mobile R plasmid: Contains the OriTr site, which receives signal from plasmid 2-B. This plasmid then leaves the host cell and submits its message back into cell #1&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Penn State'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php?title=Penn_StateProjectDes&lt;br /&gt;
&lt;br /&gt;
”The idea for our project grew out of one for a &amp;quot;bacterial maze,&amp;quot; in which bacteria would use logic to make their way through a microfabricated labrynth. This seemed slightly too difficult, so we linearized the the concept and added transfer of a signal; the idea was then dubbed a &amp;quot;bacterial relay race.&amp;quot;&lt;br /&gt;
As in a conventional relay race, the signal is to &amp;quot;go,&amp;quot; or induce motility of a latter stage participant. This is accomplished by passing a baton. In our case, the participants are E. coli, and the baton is a quorum sensing molecule, 3OC6HSL (we have another strategy that utilizes conjugation rather than quorum sensing to mediate the signal).&lt;br /&gt;
In addition to passing the signal, though, the first participant must stop. We explored this option, but settled instead on terminating the first participant. In our design we really do kill the messanger.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Arizona'''  &lt;br /&gt;
“Water Color” &lt;br /&gt;
http://parts.mit.edu/wiki/index.php/University_of_Arizona_2006&lt;br /&gt;
&lt;br /&gt;
Project Details&lt;br /&gt;
“The current name of our project is &amp;quot;Water Color.&amp;quot; It is a system that selectively expresses one of three florescence proteins. Each of the three florescence proteins will be expressed in the presence of a unique inducer. Each florescent protein will be controlled by a unique repressed promoter. Thus we will have the expression of three flourescent proteins activated by the presence of there respective inducers.&lt;br /&gt;
The idea of our project is to have a media with these cells on it so that each cell will be individually activated to shown a certain &amp;quot;color&amp;quot; (in actuallity, express one florescent protein, which may or may not look unique). Thus the media is able to dispaly an image. The spacial resolution with determine how much it will look like an image. A further idea, to be implemented later (time permitting), is to have the ability to &amp;quot;erase&amp;quot; the image. This would be accomplished by repressing all three promoters. Currently, there are no plans to implement this.”&lt;br /&gt;
&lt;br /&gt;
Flowchart of Parts: http://parts.mit.edu/wiki/index.php/University_of_Arizona_2006/Parts_Schedule&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
http://bio.freelogy.org/wiki/IGEM_2005&lt;br /&gt;
&lt;br /&gt;
'''UC Berkley 2005'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/UC_Berkeley_2005&lt;br /&gt;
&lt;br /&gt;
Conjugation is a process through which cells can exchange genetic material on plasmids. Conjugal plasmids (in our case incF and incP plasmids) carry the machinery necessary to transfer themselves in the form of mating pair formation (mpf) and DNA transfer (dtr) genes. Conjugation is under the control of the TraJ regulatory protein, which when expressed induces a cascade that results in the formation of a pore by mpf genes and then subsequent nicking, rolling circle replication and transfer of one strand of the plasmid by the relaxosome complex and other dtr proteins. The relaxosome nicks the plasmid at the OriT region and then covalently attaches one of its subunits to the 5' end of the plasmid DNA, and by doing so it is able to drag the plasmid across the pore formed by the mpf machinery by means of a coupling protein. Upon reaching its destination, the single strand of plasmid DNA is recircularized and a complement strand is synthesized by transferred primases.&lt;br /&gt;
&lt;br /&gt;
Non-mobile synthetic F plasmid: Begins the conjugation signal, which it sends to plasmid B. Also contains the CFP tag which identifies the host cell as &amp;quot;F-type&amp;quot;, and always produces mRNA 'key 2' which unlocks RNA lock 2&lt;br /&gt;
&lt;br /&gt;
-1.	-B - Non-mobile almost-wild F plasmid: Contains all F-plasmid genes EXCEPT OriTf, TraJf. Plasmid receives and propagates the conjugation signal from TraJf in plasmid 1-A and sends the signal to OriTf in 1-C&lt;br /&gt;
1-C - Mobile F plasmid: Contains the OriTf site which receives signal from plasmid 1-B. This plasmid then leaves the host cell and enters the conjugating recipient cell. Holds encrypted message (produce cI --&amp;gt; turn on GFP to signify &amp;quot;message 1 received&amp;quot;) secured by RNA lock 1.&lt;br /&gt;
&lt;br /&gt;
2-A Non-mobile synthetic R plasmid: Always produces mRNA 'key1'. Thus when it receives 'lock1' (sent by mobile plasmid 1-C) it can open the latter and produce cI, which will activate plasmid 1-C (turn on GFP, &amp;quot;message 1 received&amp;quot;) and simultaneously activate TraJr (start R conjugation cascade)&lt;br /&gt;
&lt;br /&gt;
-1.	2-B Non-mobile almost-wild R plasmid: Just like 1-B, contains all of the wild type R-plasmid EXCEPT OriTr and TraJr. Propagates TraJr signal from 2-A and sends it to OriTr&lt;br /&gt;
2-C Mobile R plasmid: Contains the OriTr site, which receives signal from plasmid 2-B. This plasmid then leaves the host cell and submits its message back into cell #1&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson/Missouri_Western_iGEM2008&amp;diff=4656</id>
		<title>Davidson/Missouri Western iGEM2008</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Davidson/Missouri_Western_iGEM2008&amp;diff=4656"/>
				<updated>2008-05-20T18:44:16Z</updated>
		
		<summary type="html">&lt;p&gt;KeDavis: /* Lsr cell signaling system */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;font size = &amp;quot;6&amp;quot;&amp;gt;&amp;lt;center&amp;gt;&lt;br /&gt;
Davidson College - Missouri Western State University&lt;br /&gt;
&amp;lt;/center&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
iGEM 2008&lt;br /&gt;
&amp;lt;/center&amp;gt;&amp;lt;/font&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==[[Wet Lab Pages]]==&lt;br /&gt;
&lt;br /&gt;
== Temporary section for IM names ==&lt;br /&gt;
&lt;br /&gt;
heyermath &amp;lt;br&amp;gt;&lt;br /&gt;
genomicsguy &amp;lt;br&amp;gt;&lt;br /&gt;
lookinformammoth &amp;lt;br&amp;gt;&lt;br /&gt;
toddeckdahl &amp;lt;br&amp;gt;&lt;br /&gt;
aba767 &amp;lt;br&amp;gt;&lt;br /&gt;
Awake714 &amp;lt;br&amp;gt;&lt;br /&gt;
evelynzx &amp;lt;br&amp;gt;&lt;br /&gt;
johnigo25 &amp;lt;br&amp;gt;&lt;br /&gt;
masterwizard_32@hotmail.com &amp;lt;br&amp;gt;&lt;br /&gt;
rcoolbassman &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Signal molecules ==&lt;br /&gt;
&lt;br /&gt;
[[Image:QSsignals.gif|QSsignals.gif]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Gram (-) bacteria use:'''&lt;br /&gt;
&lt;br /&gt;
3-oxo-C6-HSL, N-(3-oxohexanoyl)-L-homoserine lactone, an AHL&lt;br /&gt;
&lt;br /&gt;
DPD, the AI-2 precursor, 4,5 dihydroxy-2,3-pentanedione&lt;br /&gt;
&lt;br /&gt;
HHQ, 2-heptyl-4(1H)-quinolone, an AQ&lt;br /&gt;
&lt;br /&gt;
'''Gram (+) bacteria use:'''&lt;br /&gt;
&lt;br /&gt;
DPD, the AI-2 precursor, 4,5 dihydroxy-2,3-pentanedione&lt;br /&gt;
&lt;br /&gt;
A-Factor, 2-isocapryloyl-3-hydroxymethyl--butyrolactone&lt;br /&gt;
&lt;br /&gt;
PQS, pseudomonas quinolone signal, 2-heptyl-3-hydroxy-4(1H)-quinolone&lt;br /&gt;
&lt;br /&gt;
DSF, ‘diffusible factor’, cis-11-methyl-2-dodecenoic acid&lt;br /&gt;
&lt;br /&gt;
3OH-PAME, hydroxyl-palmitic acid methyl ester; &lt;br /&gt;
&lt;br /&gt;
AIP-1, staphylococcal autoinducing peptide 1&lt;br /&gt;
&lt;br /&gt;
== E. coli Signaling ==&lt;br /&gt;
&lt;br /&gt;
&amp;quot;As yet no AHL-producing Escherichia coli or Salmonella strains have been identified, although both organisms possess an AHL receptor (SdiA) of the LuxR protein class and respond to AHLs produced by other bacteria.&amp;quot; [http://mic.sgmjournals.org/cgi/reprint/153/12/3923 Williams 2007]&lt;br /&gt;
&lt;br /&gt;
== Las/Rhl cell signaling system ==&lt;br /&gt;
Responsible: Robert Cool&lt;br /&gt;
&lt;br /&gt;
'''Las System'''&lt;br /&gt;
&lt;br /&gt;
'''Signal Molecule''': An AHL called PAI-1 (N-3-oxododecanoyl-l-hsl)(3-oxo-C12-hsl)&lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': Pseudomonas aeruginosa gram(-)   possibly E.coli (see article 3)&lt;br /&gt;
&lt;br /&gt;
'''Receiver protein''': LasR&lt;br /&gt;
&lt;br /&gt;
'''Effect of binding''': TXN activation of virulence genes, lasA, lasB, apr, toxR&lt;br /&gt;
&lt;br /&gt;
'''Synthase''': LasI enzyme&lt;br /&gt;
&lt;br /&gt;
'''Target Genes''': lasI&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': unknown&lt;br /&gt;
 &lt;br /&gt;
&lt;br /&gt;
'''Articles'''&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes&amp;quot; &lt;br /&gt;
&lt;br /&gt;
JP Pearson, EC Pesci and BH Iglewski &lt;br /&gt;
[http://jb.asm.org/cgi/reprint/179/18/5756?maxtoshow=&amp;amp;HITS=10&amp;amp;hits=10&amp;amp;RESULTFORMAT=&amp;amp;titleabstract=las&amp;amp;searchid=1&amp;amp;FIRSTINDEX=0&amp;amp;resourcetype=HWCIT]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Regulation of Pseudomonas Quinolone Signal Synthesis in Pseudomonas aeruginosa&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Dana S. Wade, M. Worth Calfee, Edson R. Rocha, Elizabeth A. Ling, Elana Engstrom, James P. Coleman, and Everett C. Pesci&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/187/13/4372?view=long&amp;amp;pmid=15968046 2]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Posttranscriptional Control of Quorum-Sensing-Dependent Virulence Genes by DksA in Pseudomonas aeruginosa&lt;br /&gt;
&lt;br /&gt;
Florence Jude,1,2 Thilo Köhler,1 Pavel Branny,1,3 Karl Perron,1 Matthias P. Mayer,4 Rachel Comte,1 and Christian van Delden&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/185/12/3558?view=long&amp;amp;pmid=12775693 3]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Rhl System''' &lt;br /&gt;
 &lt;br /&gt;
'''Signal Molecule''': An AHL called PAI-2, Plasminogen activator inhibitor-2, N-butanoyl-homoserine lactone (C4HSL) &lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': Pseudomonas aeruginosa gram(-)&lt;br /&gt;
&lt;br /&gt;
'''Receiver Protein''': Rhl R &lt;br /&gt;
&lt;br /&gt;
'''Effect of Binding''': activation of Rhamnosyl Transferase, then making RL (rhamnolipid) &lt;br /&gt;
&lt;br /&gt;
'''Synthase''': RhlA and RhlB &lt;br /&gt;
&lt;br /&gt;
'''Target Genes''': pqsABCDE and phnAB&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': unknown&lt;br /&gt;
&lt;br /&gt;
Additional References: [http://jb.asm.org/cgi/reprint/189/13/4827 background information on Las and Rhl]&lt;br /&gt;
&lt;br /&gt;
[[Image:Las_rhl.gif]]&lt;br /&gt;
== Lux cell signaling system ==&lt;br /&gt;
&lt;br /&gt;
'''Responsible:''' Andrew Gordon&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule:''' ''N''-acyl-homoserine lactone (AHL) &lt;br /&gt;
&lt;br /&gt;
'''Bacterial species:''' discovered in ''Vibrio fischeri'' &lt;br /&gt;
&lt;br /&gt;
'''Receiver protein:''' LuxR protein receives signal from AHL&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule synthase:''' LuxI&lt;br /&gt;
&lt;br /&gt;
'''Additional Information:''' &amp;quot;Quorum Quenching&amp;quot; lactonase reduces AHL concentration&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/Lux Lux Operon Pathway]&lt;br /&gt;
&lt;br /&gt;
[http://partsregistry.org/AHL AHL signaling molecules by species]&lt;br /&gt;
&lt;br /&gt;
[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=522112 Quorum Quenching to control Lux Pathway]&lt;br /&gt;
&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/189/16/6011 AI-2 Quorum Sensing in e. coli]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Lsr cell signaling system ==&lt;br /&gt;
&lt;br /&gt;
'''Responsible''': Kelly Davis&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule''': AI-2, furanosyl borate diester, derived from the ribosyl part of S-ribosylhomocysteine, [http://www.biomedcentral.com/content/pdf/1471-2148-4-36.pdf]&lt;br /&gt;
&lt;br /&gt;
'''Bacterial species''': discovered in Vibrio harveyi, but interspecies signalling occurs, Escherichia coli E24377A (strain: E24377A) (for lsrK), Escherichia coli str. K-12 substr. DH10B (strain: K-12, substrain: DH10B) (for lsrR)&lt;br /&gt;
&lt;br /&gt;
'''Receiver protein''': LsrR protein receives signal from sensor protein&lt;br /&gt;
&lt;br /&gt;
'''Signal molecule synthase''': Pfs enzyme, then LuxS autoinducer synthase&lt;br /&gt;
&lt;br /&gt;
'''Target genes''': lsr operon, including ABC transporter and LsrK kinase&lt;br /&gt;
&lt;br /&gt;
'''Regulation''': LsrR represses the lsr operon, derepression by phospho-AI-2&lt;br /&gt;
&lt;br /&gt;
'''Additional References''': [http://www.microbialcellfactories.com/content/pdf/1475-2859-1-5.pdf Review of AI-2 and other systems], [http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=22733&amp;amp;blobtype=pdf E. coli produces a signal that can substitute for AI-2], [http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&amp;amp;cmd=Retrieve&amp;amp;dopt=full_report&amp;amp;list_uids=5586283] (for information on lsrK), [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&amp;amp;Cmd=ShowDetailView&amp;amp;TermToSearch=6062136&amp;amp;ordinalpos=9&amp;amp;itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum#summary] (for lsrR), [http://BioCyc.org/ECOLI/substring-search?type=NIL&amp;amp;object=lsr]&lt;br /&gt;
&lt;br /&gt;
== Fec cell signaling system ==&lt;br /&gt;
Responsible: Xiao Zhu&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
Harvard iGEM'07 team worked with Fec system, the results were not favorable. [http://parts.mit.edu/igem07/index.php/Harvard#Quorum_Sensing :We believe that overexpression of the Fec system killed the cells, possibly by disturbing the cell membranes.]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Ferric Dicitrate Transport System'''&lt;br /&gt;
The inducer, ferric citrate, binds to an outer membrane transport protein, FecA, and without further transport elicits a signal that is transmitted across the outer membrane (by FecA), the periplasm, and the cytoplasmic membrane (by FecBCDE and FecR) into the cytoplasm. Signal transfer across the three subcellular compartments is mediated by the outer membrane transport protein (FecA) that interacts in the periplasm with a cytoplasmic transmembrane protein (FecR). FecR is required for activation of a sigma factor (FecI) which belongs to the extracytoplasmic function (ECF)sigma factor family.&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
Only iron not iron complex enters the cytoplasm. FecA is the TonB energy transducing system-dependent. &lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Signaling Molecule:''' FeC (ferric dicitrate)&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Receptor Protein: ''' FecA&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Effect of binding:''' the conformational changes that FecA undergoes when binding to ferric citrate:The alpha helix in loop 7 unravels, and the loop moves by up to 11 angstroms ; Loop 8 moves up to 15 angstroms.&lt;br /&gt;
http://www.rsc.org/ej/CS/2007/b617040b/b617040b-f13.gif&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Sensor Producer:''' N/A&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
'''Bacteria species:''' E.coli, Pseudomonas putida, P. aeruginosa, Serratia marcescens, Klebsiella pneumoniae, Aerobacter aerogenes, Bordetella pertussis, B. bronchseptica, B. avium, and Ralstonia solanacearum.&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://pathway.gramene.org/ECOLI/NEW-IMAGE?type=REACTION&amp;amp;object=RXN0-2261 More detailed information about Fec]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=215624&amp;amp;blobtype=pdf Exogenous Induction of the Iron Dicitrate Transport System of Escherichia coli K-12]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/183/1/162 Control of the Ferric Citrate Transport System of Escherichia coli:Mutations in Region2.1 of the FecI ECF Sigma Factor Suppress Mutations in the FecR Transmembrane Regulatory Protein]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/full/189/19/6913 Docking of the Periplasmic FecB Binding Protein to the FecCD Transmembrane Proteins in the Ferric Citrate Transport System of Escherichia coli]&lt;br /&gt;
&amp;lt;br/&amp;gt;&lt;br /&gt;
[http://jb.asm.org/cgi/content/abstract/185/6/1870 Interactions between the Outer Membrane Ferric Citrate Transporter FecA and TonB: Studies of the FecA TonB Box]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Cell signaling resources ==&lt;br /&gt;
[http://partsregistry.org/Featured_Parts:Cell-Cell-Signaling Featured parts in iGEM registry]&lt;br /&gt;
&lt;br /&gt;
[http://en.wikipedia.org/wiki/Cell_signaling Wikipedia entry]&lt;br /&gt;
&lt;br /&gt;
[http://mic.sgmjournals.org/cgi/reprint/153/12/3923 Quorum sensing, communication and cross-kingdom signalling in the bacterial world]&lt;br /&gt;
&lt;br /&gt;
[http://www.molbio.princeton.edu/index.php?option=content&amp;amp;task=view&amp;amp;id=27 Bonnie Bassler lab at Princeton]&lt;br /&gt;
&lt;br /&gt;
[http://www.nottingham.ac.uk/quorum/ One-Stop Shopping for QS from Nottingham]&lt;br /&gt;
&lt;br /&gt;
[http://journals.royalsociety.org/content/w26732234707/?p=c1685368363e450faabedd3ee8fd60dc&amp;amp;pi=3 Special Issue: Bacterial conversations: talking, listening and eavesdropping]&lt;br /&gt;
&lt;br /&gt;
[http://library.albany.edu/science/whatsnew_dialogs.htm Dialogs with Bacteria: Quorum Sensing]&lt;br /&gt;
&lt;br /&gt;
[http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/C/CellSignaling.html General Types of Cell Signaling: Bacteria on Steroids?]&lt;br /&gt;
&lt;br /&gt;
[http://www.samsi.info/200405/compbio/workinggroup/cell/Eungdamrong_Iyengar_Biology_of_the_Cell_96_355_2004.pdf Modeling Cell-Signaling Networks]&lt;br /&gt;
&lt;br /&gt;
[http://journals.royalsociety.org/content/m5hgygq1t6daxy72/fulltext.pdf Quorum Sensing and the Population Control of Virulence]&lt;br /&gt;
&lt;br /&gt;
== Davidson Journal Club ==&lt;br /&gt;
&lt;br /&gt;
[http://www.bio.davidson.edu/courses/synthetic/papers/Stochastic_Cells.pdf Stochasticity and Gene Expression --- Dr. Campbell]&lt;br /&gt;
&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/cryptography_graph.pdf Hash Function --- Dr. Heyer]&lt;br /&gt;
&lt;br /&gt;
== iGEM 2007 Useful Information ==&lt;br /&gt;
'''Virginia Tech''' &lt;br /&gt;
&lt;br /&gt;
''Engineering and Epidemic''&lt;br /&gt;
&lt;br /&gt;
The use of bacteria to model the spread of a disease.  It would appear that cell-to-cell communication is a major part of the design of the project.  It is unclear how successful the team was in building parts useful to us.  Most of the project seems to be on the mathematical modeling side of things.&lt;br /&gt;
&lt;br /&gt;
The use of bacteria to model the spread of a disease. It would appear that cell-to-cell communication is a major part of the design of the project. It is unclear how successful the team was in building parts useful to us. Most of the project seems to be on the mathematical modeling side of things. &lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Virginia_Tech&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''University of Waterloo'''&lt;br /&gt;
&lt;br /&gt;
''Half-Adder Logic Gate''&lt;br /&gt;
&lt;br /&gt;
The goal of this project is to design a basic device for computing. Our idea was to reproduce a circuit element called a half adder with DNA, which takes in two 1-bit inputs, adds them, and outputs a sum and a carry. Our device responds to two inputs: red light and the chemical tetracycline. The input sensors control a set of genetic switches in order to carry out the computation and fluoresces green, red, or neither, depending on the outcome.  Useful for long addition in base-2.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Waterloo&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''UCSF'''&lt;br /&gt;
&lt;br /&gt;
''Project 1: Protein Scaffolds as a Molecular Breadboard''&lt;br /&gt;
&lt;br /&gt;
Using synthetic protein scaffolds to control information flow of a kinase pathway in eukaryotic cells.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/UCSF&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tianjin'''&lt;br /&gt;
&lt;br /&gt;
''Biological diode''&lt;br /&gt;
&lt;br /&gt;
In this project, we try to construct a biological device to imitate the function of the diode, one of the most significant parts in the electric integrate circuit. The flow of molecular signal AHL is considered as the current of electric circuit. The generator, amplifiers, blocks and detector cells are constructed with the parts provided by MIT and then are equipped in series in order to establish the cellular and molecular biological diode. Our device, which is a combination of technologies from the field of computer science, molecular biology and chemical engineering, is a breakthrough for the application of mature techniques of chemical engineering to the field of synthetic biology.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tianjin&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Duke University'''&lt;br /&gt;
&lt;br /&gt;
''Bacterial Communication With Light''&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Duke/Projects/bc - &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''University of Cambridge'''&lt;br /&gt;
&lt;br /&gt;
''BOL: Bacteria OnLine''&lt;br /&gt;
&lt;br /&gt;
They talk a little about making a bacterial internet, I have no idea what they mean.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Cambridge&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tokyo Tech'''&lt;br /&gt;
&lt;br /&gt;
''Pareto's Principle: An Ant Society''&lt;br /&gt;
&lt;br /&gt;
The goal of our project is to make a bacterial society that follows Pareto's principle as an ant society does. On the other word, we try to construct a bacterial system which takes &amp;quot;balanced differentiation&amp;quot;. Bistability and cell-cell communication are necessary to realize our model of &amp;quot;Balanced differentiation&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Tokyo_Tech&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Quorum Sensing'''&lt;br /&gt;
[http://www.nottingham.ac.uk/quorum/index.htm See this quorum sensing web page]&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
&lt;br /&gt;
''Quorum Sensing''&lt;br /&gt;
&lt;br /&gt;
Was developing a luxL luxR quorum sensing system using OHHL. Lux quorum-sensing works like a system of sender and receiver.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Harvard#Quorum_Sensing&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Chiba'''&lt;br /&gt;
&lt;br /&gt;
''Communication Unit''&lt;br /&gt;
&lt;br /&gt;
Something about cell to cell communication involving LuxL, LuxR, and AHL. Hard to understand because they did not translate into English very well.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Chiba/Communication&lt;br /&gt;
&lt;br /&gt;
    &lt;br /&gt;
'''Brown'''&lt;br /&gt;
&lt;br /&gt;
''Cellular Lead Sensor''&lt;br /&gt;
&lt;br /&gt;
-no useful information&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Brown   &lt;br /&gt;
   &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Colombia-Israel (ORT Ebin High School)'''&lt;br /&gt;
&lt;br /&gt;
''A Microbial Biosensor Device'' &lt;br /&gt;
&lt;br /&gt;
No description left...&lt;br /&gt;
&lt;br /&gt;
- http://parts.mit.edu/igem07/index.php/Colombia-Israel%20(ORT%20Ebin%20High%20School) &lt;br /&gt;
&lt;br /&gt;
    &lt;br /&gt;
'''Edinburgh'''&lt;br /&gt;
&lt;br /&gt;
''Division PoPper'' and ''Self Flavouring Yoghurt'' &lt;br /&gt;
&lt;br /&gt;
- This team is working on a project that is looking into a form of cell communication &lt;br /&gt;
&lt;br /&gt;
- &amp;quot;We designed a signal generator device that produces an output in the form of PoPS pulses each time a bacteria undergoes cell division. Therefore it may trigger actions as a function of cell replication.&amp;quot; &lt;br /&gt;
&lt;br /&gt;
- Could not find where on this page this info came from, but it was included with this link:&lt;br /&gt;
''- The goal of this project is to design a basic device for computing. Our idea was to reproduce a circuit element called a half adder with DNA, which takes in two 1-bit inputs, adds them, and outputs a sum and a carry. Our device responds to two inputs: red light and the chemical tetracycline. The input sensors control a set of genetic switches in order to carry out the computation and fluoresces green, red, or neither, depending on the outcome. Useful for long addition in base-2.'' &lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Edinburgh#The_Projects.21&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Imperial'''&lt;br /&gt;
&lt;br /&gt;
''Infector Detector''&lt;br /&gt;
&lt;br /&gt;
-no useful information, but really interesting project...&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Imperial + UCSF (2007)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Middle East Technical University'''&lt;br /&gt;
&lt;br /&gt;
Chase simulator &lt;br /&gt;
&lt;br /&gt;
This project was not completed, but has some interesting information on E. coli cells triggering a response in nearby E. coli cells.&lt;br /&gt;
http://parts.mit.edu/igem07/index.php/Chase_Simulator&lt;br /&gt;
&lt;br /&gt;
== iGEM 2006 Useful Information ==&lt;br /&gt;
'''UT Austin 2005/2006'''&lt;br /&gt;
Project : Edge Detector &lt;br /&gt;
Link to parts: http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM&amp;amp;group=iGEM_UTAustin&lt;br /&gt;
&lt;br /&gt;
Useful information: &lt;br /&gt;
They  have &amp;quot;black boxed&amp;quot; the light-system and used it as an input for the of the edge detection circuitry. &lt;br /&gt;
&lt;br /&gt;
Edge Detector Circuit and logic. The light sensing machinery from above has been black-boxed and the edge detection circuitry has been added downstream. Red light represses the expression of 2 genes; a biosynthetic gene for a membrane diffusible quorum sensing activator (AHL), and a dominant transcriptional repressor (cI). (Right) The output of the circuit (Z;Beta-galactosidase) is ON only in the presence of X (AHL) and the absence of Y (cI). This can only occur at the light/dark boundary.&lt;br /&gt;
&lt;br /&gt;
Note: Built on 2005’s work. Pretty much the same as 2005. &lt;br /&gt;
&lt;br /&gt;
 &lt;br /&gt;
&lt;br /&gt;
''' Harvard'''&lt;br /&gt;
“Cell Surface Targeting” &lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Harvard_2006&lt;br /&gt;
&lt;br /&gt;
Project Overview&lt;br /&gt;
“In order to target nanostructures to cells, we developed adaptamers, universal nucleic acid adaptars which can link two substrates.&lt;br /&gt;
•	Such an interface could also be used to link together entire cells for the study of cell-cell interactions and the linkage of two interacting proteins, in effect creating a nucleic acid enzyme.&lt;br /&gt;
•	Adaptamers generally depend on aptamers, short sequences of nucleic acid that bind with high specificity and affinity to particular substrates.&lt;br /&gt;
•	Tahiri-Alaoui et al. created the first aptamer in 2002, consisting of two aptamer sequences linked together by a bulky basepairing region ~100 nucleotides long.&lt;br /&gt;
•	Our goal was to create an adaptamer that could link together streptavidin and thrombin. Delivery of thrombin to a streptavidin-coated magnetic bead would show the potential for delivery of a macromolecule to a cell surface.&lt;br /&gt;
Additionally, we wished to be able to be able to quench adaptamer function through the addition of an adapatamer-disabling oligonucleotide.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''The University of Calgary''' 2006 iGEM team is working on the following project. A petri plate is inhabited by two strains of genetically engineered ''E. coli'' bacteria. The first strain---the Senders---have been engineered to emit two chemical signals into the plate environment: Aspartate and Acyl Homoserine Lactone (AHSL). The senders themselves are activated by light. The second strain---the Receivers---have been designed to respond to each of these signals in a different way.&lt;br /&gt;
The Receivers express Green Fluorescent Protein in the vicinity of AHSL.&lt;br /&gt;
The Receivers also move towards areas of greater Aspartate concentration. The same bacteria also decrease Aspartate levels where they are present, as this is a nutrient and constitutes the reason for why they are attracted to it in the first place.&lt;br /&gt;
Our goal is to make the Senders and Receivers create interesting behaviour dynamics visualized by fluorescent patterns.&lt;br /&gt;
&lt;br /&gt;
http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM2006&amp;amp;group=iGEM2006_Calgary&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Berkeley''': networks of cells communicating via conjugation; demonstrated the transmission of a coded message&lt;br /&gt;
&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/University_of_California_Berkeley_2006&lt;br /&gt;
&lt;br /&gt;
“We have developed the process of addressable conjugation for communication within a network of E. coli bacteria. Here, bacteria send messages to one another via conjugation of plasmid DNAs, but the message is only meaningful to cells with a matching address sequence. In this way, the Watson Crick base-pairing of addressing sequences replaces the spatial connectivity present in neural systems. To construct this system, we have adapted natural conjugation systems as the communication device. Information contained in the transferred plasmids is only accessable by &amp;quot;unlocking&amp;quot; the message using RNA based 'keys'. The resulting addressable conjugation process is being adapted to construct a network of NAND logic gates in bacterial cultures.”&lt;br /&gt;
&lt;br /&gt;
'''Mexico''': cellular automata&lt;br /&gt;
&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/IPN_UNAM_2006&lt;br /&gt;
&lt;br /&gt;
“We wish contribute to the iGEM project development various protein based bio-components. We will work along three main lines: complex and reversible dynamical systems and formal languages, that support particles and multiple reactions, related to the molecular transformations.”&lt;br /&gt;
&lt;br /&gt;
“We study two-dimensional cellular automaton, where every cell takes states 0 and 1 and updates its state depending on sum of states of its 8 closest neighbors as follows. Cell in state 0 takes state 1 if there are exactly two neighbors in state 1, otherwise the cell remains in state 0. Cell in state 1 remains in state 1 if there are exactly seven neighbors in state 1, otherwise the cell switches to state 0. CA governed by such cell-state transition rule exhibits reaction-diffusion like pattern dynamics, so we call this Diffusion Rule.”&lt;br /&gt;
&lt;br /&gt;
“Using the diffusion rule we can generate a dynamical pattern over a system, like turn on/off ligth with alive o dead cells that shows a luminescence, examples include fluorescence, bioluminescence and phosphorescence.”&lt;br /&gt;
“Starting with any configuration, the cells alive are represented in yellow (the activator) and dead in black (the inhibitor), see figure 4. The system is created defining an inicial state over the base configuration (see figure 3). The luminescence is obtained by the evolution of this initial pattern.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Brown:Bacterial''' Freeze Tag&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Brown:Bacterial_Freeze_Tag#Overview&lt;br /&gt;
2006 igem&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This project involves programming bacteria to be able to play a game of freeze tag. Bacteria will be engineered to swim around a microfluidics device until they reach a certain proximity to the 'IT' cell and then they will lose their ability to move. This loss of motility will be combined with a change in color from Green to Blue. When another bacterium, which is moving (not the 'IT' cell), reaches a certain proximity to the 'frozen' bacteria it will again regain its ability to move and turn from Blue to Yellow.&lt;br /&gt;
&lt;br /&gt;
TetR promoted with LuxI downstream. LuxI is an enzyme that produces AHL and will produce the red fluorescent protein (RFP). The AHL produced is exported from the cell where it then forms a complex with the LuxR protein that is produced by the AHL sensor within the Receiver cell.&lt;br /&gt;
&lt;br /&gt;
The AHL sensor is TetR promoted and forms the LuxR protein which then forms a complex with AHL. This LuxR and AHL complex then activates the pLuxR promoter. Downstream of the pLuxR promoter is the LacI protein. LacI inhibits the pLac promoter on the &amp;quot;Freeze Machine&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
A promoter that is regulated by LacI will promote the production of LasI, MotB, and cI. This will subsequently inhibit the production of CFP and LasR. In the presence of LacI, however, MotB, LasI, and cI will not be produced. CFP will therefore be produced along with LasR and LacI. This results in the &amp;quot;freezing&amp;quot; of the cell.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''McGill University Split YFP'''&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/McGill_University_2006&lt;br /&gt;
&lt;br /&gt;
The idea behind the project is fluorescence complementation, which involves the joining of two leucine zipper proteins, Fos and Jun, each fused to a half terminus of YFP. Originally, the Fos and Jun proteins were fused to a beta gene coding for a membrane protein. The project involved performing a PCR reaction to produce two inserts, the N-terminus and the C-terminus of YFP, and then ligating these inserts into 2 vectors, containing Jun-beta and the Fos-beta respectively. The two fusion proteins (Fos-beta-YFPC and Jun-beta-YFPN) were expressed in the cell membrane of two populations of E. coli. We then allowed these two cell types to combine, resulting—ideally—in the complementary binding of the Jun and Fos proteins when the cells are in close contact. Consequently, the two half YFP fragments bind to form full YFP, and the cells will fluoresce.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Penn State'''&lt;br /&gt;
http://openwetware.org/wiki/IGEM:PennState/2006&lt;br /&gt;
&lt;br /&gt;
The bacterial relay race takes advantage of an ability to control cellular motility using inducible promoters such as those involved in nutrient catabolism or quorum sensing. “Receiver” bacteria move in response to small-molecule signals either added to the system or originating from motile, “sender” strains. The most significant challenges relating to this project stem from difficulties of tightly controlling the target motility gene motB. Low levels of motB expression result in system failure (constitutive motility), and resolving this issue is essential to developing reliable modular systems that are the hallmark of synthetic biology&lt;br /&gt;
&lt;br /&gt;
'''Tokyo'''&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Tokyo_Alliance:_Conclusion&lt;br /&gt;
&lt;br /&gt;
Our project is to make this Noughts-and-Crosses in vivo.&lt;br /&gt;
-1.	Inputs&lt;br /&gt;
-1.	Chemicals&lt;br /&gt;
-1.	To indicate each square&lt;br /&gt;
-1.	To be spreaded into all squares.&lt;br /&gt;
-1.	Outputs&lt;br /&gt;
-1.	Reporter of SYANAC: GFP&lt;br /&gt;
Reporter of Human: RFP&lt;br /&gt;
&lt;br /&gt;
We can say we will expand the number of regulator genes we can use to build logic gates and through this project we made simple constructing method.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''BU 2006''' &lt;br /&gt;
Project: build a functioning &amp;quot;Biological Night-Light&amp;quot; system&lt;br /&gt;
&lt;br /&gt;
Link to parts : http://parts.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM2006&amp;amp;group=iGEM2006_BU&lt;br /&gt;
Goal&lt;br /&gt;
Isolate luxCDABE and add the 4 BioBrick restriction sites to the ends of the gene.&lt;br /&gt;
Ideas&lt;br /&gt;
&amp;quot;Proteins that affect the wavelength of the emitted light, lumazine and yellow fluorescent protein, have been isolated from Photobacterium and Vibrio species, respectively. The lumazine proteins shift the color of the light to wavelengths shorter than 490 nm...&amp;quot; (Meighen 1991) Perhaps we could build a circuit to modulate the emitted wavelength by periodically expressing a carefully-chosen fluoresent protein. Think FRET and BRET.&lt;br /&gt;
&lt;br /&gt;
Let's modify the lux operon so our bacteria can play Conway's Game of Life. In the game, discrete &amp;quot;cells&amp;quot; interact with one another according to four extremely simple rules, which essentially boil down to this: if a cell has too many or too few neighbors it turns off, otherwise it turns/stays on. These rules and the initial state of all the cells often produce systems of fascinating and lifelike complexity. Perhaps we could add a circuit such that LuxI would only be activated in response to a narrow &amp;quot;medium&amp;quot; range of concentrations of its autoinducer (3OC6HSL), not too much or too little. In fact, I think such a circuit has already been built by the Weiss lab and demonstrated with their infamous bullseye. &lt;br /&gt;
&lt;br /&gt;
'''Weiss Lab: Game of Life'''&lt;br /&gt;
Link: http://www.princeton.edu/~rweiss/&lt;br /&gt;
Note: Weiss Lab build a system that enables cells to “play” Conway’s Game of Life, where cells live or die based on the density of their neighbors.  This system exhibits complex global emergent behavior that arises from the interaction of cells based on simple local rules.&lt;br /&gt;
&lt;br /&gt;
Another system is a pulse generator where sender cells communicate to nearby receiver cells, which then respond with a transient burst of gene expression whose amplitude and duration depends on the distance from the senders. In another system, receiver cells have been engineered to respond to cell-cell communication signals from senders. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Bangalore NCBS 2006'''&lt;br /&gt;
	Synchronization of bacterial cell cycles. Use a cell cycle-dependent promoter to drive a LuxI-LuxR based cell-cell signal. Use regulation of replication initiator DnaA to modulate cell cycle in receiver cells. Immediate goals: To determine if candidate promoters oscillate; to regulate DnaA levels&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/Workshop&lt;br /&gt;
&lt;br /&gt;
'''Rice University 2006'''&lt;br /&gt;
The objective of this project is to engineer Escherichia coli which are able to actively pursue and mark or eliminate another bacterial target. This system can be divided into three components: an input element, a processing element, and a response element. The input element will consist of a quorum sensing circuit which would allow specific detection of the bacterial target. The processing element will facilitate the signaling of this input into controlled responses. A number of different response elements can be conceived, to be used separately or in tandem: 1) integration into the chemotactic pathway of E. coli, allowing for directed mobilization towards the target, 2) reporter response at high pheromone concentrations to allow for visual identification of the target location (e.g., GFP production), and 3) an elimination response to produce molecules which are specifically lethal to the desired target.&lt;br /&gt;
http://parts.mit.edu/wiki/index.php/PROJECT_PROPOSAL&lt;br /&gt;
&lt;br /&gt;
'''Cambridge''': http://parts.mit.edu/wiki/index.php/Cambridge_University_2006&lt;br /&gt;
&lt;br /&gt;
The type 1 cell produces 3O-C6-HSL (represented by the small yellow cannon ball) while type 2 produces 3O-C12-HSL (represented by the blue cannon ball).  The type 1 cell responds to 3O-C12 HSL and type 2 responds to 3O-C6 HSL. The response of type 1 cells can be visualized through the expression of RFP. The response of type 2 cells can be visualized through the expression of GFP.&lt;br /&gt;
&lt;br /&gt;
1.	Parts used for generating patterns (these are parts whose function Cambridge characterized) &lt;br /&gt;
 (a) Constitutively expressed fluorescent proteins:&lt;br /&gt;
ECFP: BBa_I13601&lt;br /&gt;
GFP: BBa_J04430&lt;br /&gt;
EYFP: BBa_I6031&lt;br /&gt;
mRFP1: BBa_J04450 &lt;br /&gt;
(b) Constitutive or auto-induced AHL synthesis:&lt;br /&gt;
Lux-sender (auto-inducing): BBa_I15030&lt;br /&gt;
Las-sender (constitutive): BBa_I0407&lt;br /&gt;
Rhl-sender (constitutive): BBa_I0405&lt;br /&gt;
Cin-sender (constitutive): BBa_I0409  &lt;br /&gt;
(c) AHL-induced fluorescence response:&lt;br /&gt;
Lux-receiver (GFP): BBa_T9002&lt;br /&gt;
Lux-receiver (EYFP): BBa_I13263&lt;br /&gt;
Las-receiver (EYFP): BBa_I0426&lt;br /&gt;
Rhl-receiver (EYFP): BBa_I0424&lt;br /&gt;
Cin-receiver (EYFP): BBa_I0428&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Princeton''': http://parts.mit.edu/wiki/index.php/Princeton:Project_Summary&lt;br /&gt;
&lt;br /&gt;
Mammalian cell-cell signaling using LuxR and LuxI…not applicable&lt;br /&gt;
&lt;br /&gt;
== iGEM 2005 Useful Information ==&lt;br /&gt;
'''Caltech'''&lt;br /&gt;
http://www.cds.caltech.edu/~murray/synbio/wiki/index.php?title=Main_Page&amp;amp;direction=prev&amp;amp;oldid=52 &lt;br /&gt;
AND gates used to build an adder (oligo technology, Winfree lab)&lt;br /&gt;
http://www.cds.caltech.edu/%7Emurray/synbio/wiki/images/5/55/Chen-surf05.pdf&lt;br /&gt;
&lt;br /&gt;
Massive models: http://www.cds.caltech.edu/%7Emurray/synbio/wiki/images/4/44/Ho-surf05.pdf&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Cambridge''' &lt;br /&gt;
http://www.ccbi.cam.ac.uk/iGEM2005/index.php/Main_Page&lt;br /&gt;
Used sender/pulse-generator from Princeton to do something?&lt;br /&gt;
AHL signal and aTc activated promoter&lt;br /&gt;
Important paper in PNAS where this is shown to work:&lt;br /&gt;
http://www.princeton.edu/~rweiss/papers/basu-pulse-2004.pdf&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
http://bio.freelogy.org/wiki/IGEM_2005&lt;br /&gt;
Bacterial wire propogates signal of AHL&lt;br /&gt;
&lt;br /&gt;
'''MIT 2005'''&lt;br /&gt;
The first way we might build such a system involves the direct communication of an antigen, which can be just about anything, with the cell; this is accomplished by attaching an antibody to the cell in such a way that the binding of an antigen to the antibody initiates a signalling cascade that terminates in PoPs. The main benefit of such a system is that it can stand alone, and is thus a viable solution to problems such as &amp;quot;how do we deploy our biosensor into a lake where it can respond to toxin levels?&amp;quot; The main issue to be dealt with is that this system is in some ways less modular; of course, anyone could just follow our steps and hook up their scFv sequence of choice.&lt;br /&gt;
http://openwetware.org/wiki/IGEM:MIT/2005/Direct_communication_of_antigen_and_receiver&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''UC Berkley 2005'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/UC_Berkeley_2005&lt;br /&gt;
&lt;br /&gt;
Conjugation is a process through which cells can exchange genetic material on plasmids. Conjugal plasmids (in our case incF and incP plasmids) carry the machinery necessary to transfer themselves in the form of mating pair formation (mpf) and DNA transfer (dtr) genes. Conjugation is under the control of the TraJ regulatory protein, which when expressed induces a cascade that results in the formation of a pore by mpf genes and then subsequent nicking, rolling circle replication and transfer of one strand of the plasmid by the relaxosome complex and other dtr proteins. The relaxosome nicks the plasmid at the OriT region and then covalently attaches one of its subunits to the 5' end of the plasmid DNA, and by doing so it is able to drag the plasmid across the pore formed by the mpf machinery by means of a coupling protein. Upon reaching its destination, the single strand of plasmid DNA is recircularized and a complement strand is synthesized by transferred primases.&lt;br /&gt;
&lt;br /&gt;
Non-mobile synthetic F plasmid: Begins the conjugation signal, which it sends to plasmid B. Also contains the CFP tag which identifies the host cell as &amp;quot;F-type&amp;quot;, and always produces mRNA 'key 2' which unlocks RNA lock 2&lt;br /&gt;
&lt;br /&gt;
-1.	-B - Non-mobile almost-wild F plasmid: Contains all F-plasmid genes EXCEPT OriTf, TraJf. Plasmid receives and propagates the conjugation signal from TraJf in plasmid 1-A and sends the signal to OriTf in 1-C&lt;br /&gt;
1-C - Mobile F plasmid: Contains the OriTf site which receives signal from plasmid 1-B. This plasmid then leaves the host cell and enters the conjugating recipient cell. Holds encrypted message (produce cI --&amp;gt; turn on GFP to signify &amp;quot;message 1 received&amp;quot;) secured by RNA lock 1.&lt;br /&gt;
&lt;br /&gt;
2-A Non-mobile synthetic R plasmid: Always produces mRNA 'key1'. Thus when it receives 'lock1' (sent by mobile plasmid 1-C) it can open the latter and produce cI, which will activate plasmid 1-C (turn on GFP, &amp;quot;message 1 received&amp;quot;) and simultaneously activate TraJr (start R conjugation cascade)&lt;br /&gt;
&lt;br /&gt;
-1.	2-B Non-mobile almost-wild R plasmid: Just like 1-B, contains all of the wild type R-plasmid EXCEPT OriTr and TraJr. Propagates TraJr signal from 2-A and sends it to OriTr&lt;br /&gt;
2-C Mobile R plasmid: Contains the OriTr site, which receives signal from plasmid 2-B. This plasmid then leaves the host cell and submits its message back into cell #1&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Penn State'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php?title=Penn_StateProjectDes&lt;br /&gt;
&lt;br /&gt;
”The idea for our project grew out of one for a &amp;quot;bacterial maze,&amp;quot; in which bacteria would use logic to make their way through a microfabricated labrynth. This seemed slightly too difficult, so we linearized the the concept and added transfer of a signal; the idea was then dubbed a &amp;quot;bacterial relay race.&amp;quot;&lt;br /&gt;
As in a conventional relay race, the signal is to &amp;quot;go,&amp;quot; or induce motility of a latter stage participant. This is accomplished by passing a baton. In our case, the participants are E. coli, and the baton is a quorum sensing molecule, 3OC6HSL (we have another strategy that utilizes conjugation rather than quorum sensing to mediate the signal).&lt;br /&gt;
In addition to passing the signal, though, the first participant must stop. We explored this option, but settled instead on terminating the first participant. In our design we really do kill the messanger.”&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Arizona'''  &lt;br /&gt;
“Water Color” &lt;br /&gt;
http://parts.mit.edu/wiki/index.php/University_of_Arizona_2006&lt;br /&gt;
&lt;br /&gt;
Project Details&lt;br /&gt;
“The current name of our project is &amp;quot;Water Color.&amp;quot; It is a system that selectively expresses one of three florescence proteins. Each of the three florescence proteins will be expressed in the presence of a unique inducer. Each florescent protein will be controlled by a unique repressed promoter. Thus we will have the expression of three flourescent proteins activated by the presence of there respective inducers.&lt;br /&gt;
The idea of our project is to have a media with these cells on it so that each cell will be individually activated to shown a certain &amp;quot;color&amp;quot; (in actuallity, express one florescent protein, which may or may not look unique). Thus the media is able to dispaly an image. The spacial resolution with determine how much it will look like an image. A further idea, to be implemented later (time permitting), is to have the ability to &amp;quot;erase&amp;quot; the image. This would be accomplished by repressing all three promoters. Currently, there are no plans to implement this.”&lt;br /&gt;
&lt;br /&gt;
Flowchart of Parts: http://parts.mit.edu/wiki/index.php/University_of_Arizona_2006/Parts_Schedule&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Harvard'''&lt;br /&gt;
http://bio.freelogy.org/wiki/IGEM_2005&lt;br /&gt;
&lt;br /&gt;
'''UC Berkley 2005'''&lt;br /&gt;
http://parts2.mit.edu/wiki/index.php/UC_Berkeley_2005&lt;br /&gt;
&lt;br /&gt;
Conjugation is a process through which cells can exchange genetic material on plasmids. Conjugal plasmids (in our case incF and incP plasmids) carry the machinery necessary to transfer themselves in the form of mating pair formation (mpf) and DNA transfer (dtr) genes. Conjugation is under the control of the TraJ regulatory protein, which when expressed induces a cascade that results in the formation of a pore by mpf genes and then subsequent nicking, rolling circle replication and transfer of one strand of the plasmid by the relaxosome complex and other dtr proteins. The relaxosome nicks the plasmid at the OriT region and then covalently attaches one of its subunits to the 5' end of the plasmid DNA, and by doing so it is able to drag the plasmid across the pore formed by the mpf machinery by means of a coupling protein. Upon reaching its destination, the single strand of plasmid DNA is recircularized and a complement strand is synthesized by transferred primases.&lt;br /&gt;
&lt;br /&gt;
Non-mobile synthetic F plasmid: Begins the conjugation signal, which it sends to plasmid B. Also contains the CFP tag which identifies the host cell as &amp;quot;F-type&amp;quot;, and always produces mRNA 'key 2' which unlocks RNA lock 2&lt;br /&gt;
&lt;br /&gt;
-1.	-B - Non-mobile almost-wild F plasmid: Contains all F-plasmid genes EXCEPT OriTf, TraJf. Plasmid receives and propagates the conjugation signal from TraJf in plasmid 1-A and sends the signal to OriTf in 1-C&lt;br /&gt;
1-C - Mobile F plasmid: Contains the OriTf site which receives signal from plasmid 1-B. This plasmid then leaves the host cell and enters the conjugating recipient cell. Holds encrypted message (produce cI --&amp;gt; turn on GFP to signify &amp;quot;message 1 received&amp;quot;) secured by RNA lock 1.&lt;br /&gt;
&lt;br /&gt;
2-A Non-mobile synthetic R plasmid: Always produces mRNA 'key1'. Thus when it receives 'lock1' (sent by mobile plasmid 1-C) it can open the latter and produce cI, which will activate plasmid 1-C (turn on GFP, &amp;quot;message 1 received&amp;quot;) and simultaneously activate TraJr (start R conjugation cascade)&lt;br /&gt;
&lt;br /&gt;
-1.	2-B Non-mobile almost-wild R plasmid: Just like 1-B, contains all of the wild type R-plasmid EXCEPT OriTr and TraJr. Propagates TraJr signal from 2-A and sends it to OriTr&lt;br /&gt;
2-C Mobile R plasmid: Contains the OriTr site, which receives signal from plasmid 2-B. This plasmid then leaves the host cell and submits its message back into cell #1&lt;/div&gt;</summary>
		<author><name>KeDavis</name></author>	</entry>

	</feed>