<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Kihuffer</id>
		<title>GcatWiki - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://gcat.davidson.edu/GcatWiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Kihuffer"/>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=Special:Contributions/Kihuffer"/>
		<updated>2026-08-15T22:31:27Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.28.2</generator>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13879</id>
		<title>WEEK FOUR (February 6 - 10)</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13879"/>
				<updated>2012-02-20T19:39:42Z</updated>
		
		<summary type="html">&lt;p&gt;Kihuffer: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We have been given the DNA encoding [http://2011.igem.org/Team:Washington/Magnetosomes/Magnet_Toolkit 18 genes in 10 different clones] and we need to get the DNA into cells, verify the inserts, freeze down glycerol stocks, enter them into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog], and send some cells to our colleagues at MWSU. &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Davidson_Protocols Davidson Protocols]&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
* '''Everyone should register''' for a [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog account (v2.5.4 or higher)]. &lt;br /&gt;
* The plan this week is to do all wet lab stuff. Dr. Heyer will be out of town and we need to get the magnetasome DNA into ''E. coli'' cells (strain JM109). I know none of you can come to all these meetings, but we will be doing each step as outlined over the week. Come to the ones you can attend. Each person should be able to do at least 3 of these. You can choose which three. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 3 9:30 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transform JM109] &amp;amp; plate on appropriate media. ([http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Confirm with UW team])&amp;lt;br&amp;gt;&lt;br /&gt;
take about 45 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Saturday February 4''' I ''need one volunteer''&amp;lt;br&amp;gt;&lt;br /&gt;
take out of incubator put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
take about 15 minutes and must be done before 9 am&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Sunday February 5 mid-afternoon: 3 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
pick colonies from each plate and put into 2 mL appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
take about 30 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Monday February 6 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
Do [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html minipreps] but SAVE THE CELLS on plates&amp;lt;br&amp;gt;&lt;br /&gt;
takes about 1 hour&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tuesday February 7 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
set up [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html digestions], run 30 min to 1 hr and put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
Determine insert sizes from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Wednesday February 8 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html determine the percent agarose] needed for the inserts&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html pour and run gel(s)] then photograph gel(s)&amp;lt;br&amp;gt;&lt;br /&gt;
verify insert sizes (get this from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry])&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/DNA-RNA-Purification-Analysis/Nucleic-Acid-Gel-Electrophoresis/DNA-Ladders/1kb-Plus-Ladders.html?s_kwcid=TC|12123|1kB%20DNA%20ladder||S|b|9891564060 molecular weight marker]&amp;lt;br&amp;gt;&lt;br /&gt;
[[File:IS_gel.jpg]] [[File:lanes.JPG]]&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamE''' = 2253 bp, '''insert looks correct''' based on gel (Ben)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamO''' = 1914 bp or 1975 bp '''insert looks correct''' based on gel (Erich)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamQRB''' = 2029 bp or 2108 bp, '''insert looks correct''' based on gel (Dancho)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamPA''' = 1584 bp, '''insert looks correct''' based on gel (Ellen)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamV''' = 1168 bp, '''insert looks correct''' based on gel (Malcolm)&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamSTU''' = 2030 bp or 2160 bp, '''insert looks correct''' based on gel (Kirsten)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamMN''' = 2323 bp or 2367 bp, ''' insert looks correct''' based on gel (Nishita)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamJ''' = 1521 bp or 1626 bp (Becca)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamKL'''= 1336 or 1439 bp ''' insert looks correct''' base on gel (Alex)&amp;lt;br&amp;gt;&lt;br /&gt;
'''mamHI''' = 1600 bp or 1626 (Duke) -- insert looks incorrect &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;&lt;br /&gt;
[[File:eDigested_mamV.png]]&amp;lt;br&amp;gt;&lt;br /&gt;
ApE digestion of mamV using BamHI (0 sites) and EcoRI (1 site) produces two fragments of 1032 bp and 136 bp. &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;/center&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;center&amp;gt;&lt;br /&gt;
[[File:Digested_mamPA.png]]&amp;lt;br&amp;gt;&lt;br /&gt;
ApE digestion of mamPA using BamHI (0 sites) and EcoRI (0 sites) produces one fragment of 1573 bp.&lt;br /&gt;
&lt;br /&gt;
'''Thursday February 9 11 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
grow overnight cultures of clones with correct inserts sizes&amp;lt;br&amp;gt;&lt;br /&gt;
pick from plate and put into 2 mL of appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
streak out on new plate for shipping to MWSU. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 10 4 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
take cells out of incubator&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Glycerolstocks_How_to_Make_Glycerol_Stocks_of_Bacteria freeze down cells] and enter into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog].&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Primers used for fragment extraction:&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_fwd	GGTACCTTCGTATGAACCCTGTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_rev	CGTCTTCTACGTCACCATTGAAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_fwd	CCGCTTCAGACCCTGACA&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_rev	        CGATCTCGCCGGTTATTC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_fwd    	CAGATTTTGCTGAAGGTCAACC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_rev	        CGTTCGCGTGCTAAATGAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_fwd	CTGGCAGCCGTCAATTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_rev	CCTCATCCTTACTCACTCCAAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_fwd	ATCCCTTCGCTTGGGTTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_rev	AATCATGGCTGAGTTCCAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_fwd	GAGATGACGACAGGAATCCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_rev	CCAATCCCAGCATCATGATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_fwd	TGCTGACCTCGGTGTGATG&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_rev	GAAGGAAACGCCCCACATAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_fwd	CTTGCCGCATTTCAAGAAG&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_rev	GGCTCAACATACGCTCTGG&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_fwd	CGCATCCAGGAGGAAATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_rev	AACCGCACCACCTTGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_fwd	GCTGGTGCCCAAATAATCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_rev	        CAATCGCCAACAGCGTAG&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[media:MamAB_copy.txt]] ApE file for the mamAB operon]] with the primers, genes, native promoter, and terminator sequences annotated. Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)]. &amp;lt;br&amp;gt;&lt;br /&gt;
[[media:pGA1C3_pLac-GFP.txt]] pGA1C3 plasmid map (with pLac GFP insert). Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''mamV''' = 1002 bp or 1168 bp, depending on how we verify the insert. (Malcolm)&lt;br /&gt;
&lt;br /&gt;
'''mamO''' = 1914 bp or 1975 bp (Erich)&lt;br /&gt;
&lt;br /&gt;
'''mamPA''' = 1493 bp or 1584 bp (Ellen)&lt;br /&gt;
&lt;br /&gt;
'''mamSTU''' = 2030 bp or 2160 bp (Kirsten)&lt;br /&gt;
&lt;br /&gt;
'''mamQRB''' = 2029 bp or 2108 bp (Dancho)&lt;br /&gt;
&lt;br /&gt;
'''mamE''' = 2172 bp or 2253 bp (Ben)&lt;br /&gt;
&lt;br /&gt;
'''mamHI''' = 1600 bp or 1626 (Duke)&lt;br /&gt;
&lt;br /&gt;
'''mamKL'''= 1336 or 1439 bp (Alex)&lt;br /&gt;
&lt;br /&gt;
'''mamMN''' = 2323 bp or 2367 bp (Nishita)&lt;br /&gt;
&lt;br /&gt;
'''mamJ''' = 1521 bp or 1626 bp (Becca)&lt;/div&gt;</summary>
		<author><name>Kihuffer</name></author>	</entry>

	<entry>
		<id>https://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13709</id>
		<title>WEEK FOUR (February 6 - 10)</title>
		<link rel="alternate" type="text/html" href="https://gcat.davidson.edu/GcatWiki/index.php?title=WEEK_FOUR_(February_6_-_10)&amp;diff=13709"/>
				<updated>2012-02-05T22:55:13Z</updated>
		
		<summary type="html">&lt;p&gt;Kihuffer: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We have been given the DNA encoding [http://2011.igem.org/Team:Washington/Magnetosomes/Magnet_Toolkit 18 genes in 10 different clones] and we need to get the DNA into cells, verify the inserts, freeze down glycerol stocks, enter them into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog], and send some cells to our colleagues at MWSU. &lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Davidson_Protocols Davidson Protocols]&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
* '''Everyone should register''' for a [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog account (v2.5.4 or higher)]. &lt;br /&gt;
* The plan this week is to do all wet lab stuff. Dr. Heyer will be out of town and we need to get the magnetasome DNA into ''E. coli'' cells (strain JM109). I know none of you can come to all these meetings, but we will be doing each step as outlined over the week. Come to the ones you can attend. Each person should be able to do at least 3 of these. You can choose which three. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 3 9:30 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transform JM109] &amp;amp; plate on appropriate media. ([http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Confirm with UW team])&amp;lt;br&amp;gt;&lt;br /&gt;
take about 45 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Saturday February 4''' I ''need one volunteer''&amp;lt;br&amp;gt;&lt;br /&gt;
take out of incubator put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
take about 15 minutes and must be done before 9 am&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Sunday February 5 mid-afternoon: 3 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
pick colonies from each plate and put into 2 mL appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
take about 30 minutes&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Monday February 6 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
Do [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html minipreps] but SAVE THE CELLS on plates&amp;lt;br&amp;gt;&lt;br /&gt;
takes about 1 hour&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Tuesday February 7 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
set up [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html digestions], run 30 min to 1 hr and put in fridge&amp;lt;br&amp;gt;&lt;br /&gt;
Determine insert sizes from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry]&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Wednesday February 8 4:30 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html determine the percent agarose] needed for the inserts&amp;lt;br&amp;gt;&lt;br /&gt;
[http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html pour and run gel(s)] then photograph gel(s)&amp;lt;br&amp;gt;&lt;br /&gt;
verify insert sizes (get this from [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2011&amp;amp;group=Washington Registry])&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Thursday February 9 11 am'''&amp;lt;br&amp;gt;&lt;br /&gt;
grow overnight cultures of clones with correct inserts sizes&amp;lt;br&amp;gt;&lt;br /&gt;
pick from plate and put into 2 mL of appropriate media&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''Friday February 10 4 pm'''&amp;lt;br&amp;gt;&lt;br /&gt;
take cells out of incubator&amp;lt;br&amp;gt;&lt;br /&gt;
[http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Glycerolstocks_How_to_Make_Glycerol_Stocks_of_Bacteria freeze down cells] and enter into [http://gcat.davidson.edu/gcatalog-r2.5.4/ GCAT-alog].&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Primers used for fragment extraction:&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_fwd	GGTACCTTCGTATGAACCCTGTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamHI_rev	CGTCTTCTACGTCACCATTGAAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_fwd	CCGCTTCAGACCCTGACA&amp;lt;br&amp;gt;&lt;br /&gt;
mamE_rev	        CGATCTCGCCGGTTATTC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_fwd    	CAGATTTTGCTGAAGGTCAACC&amp;lt;br&amp;gt;&lt;br /&gt;
mamJ_rev	        CGTTCGCGTGCTAAATGAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_fwd	CTGGCAGCCGTCAATTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamKL_rev	CCTCATCCTTACTCACTCCAAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_fwd	ATCCCTTCGCTTGGGTTG&amp;lt;br&amp;gt;&lt;br /&gt;
mamMN_rev	AATCATGGCTGAGTTCCAAGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_fwd	GAGATGACGACAGGAATCCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamO_rev	CCAATCCCAGCATCATGATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_fwd	TGCTGACCTCGGTGTGATG&amp;lt;br&amp;gt;&lt;br /&gt;
mamPA_rev	GAAGGAAACGCCCCACATAC&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_fwd	CTTGCCGCATTTCAAGAAG&amp;lt;br&amp;gt;&lt;br /&gt;
mamQRB_rev	GGCTCAACATACGCTCTGG&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_fwd	CGCATCCAGGAGGAAATC&amp;lt;br&amp;gt;&lt;br /&gt;
mamSTU_rev	AACCGCACCACCTTGC&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_fwd	GCTGGTGCCCAAATAATCG&amp;lt;br&amp;gt;&lt;br /&gt;
mamV_rev	        CAATCGCCAACAGCGTAG&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[media:MamAB_copy.txt]] ApE file for the mamAB operon]] with the primers, genes, native promoter, and terminator sequences annotated. Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)]. &amp;lt;br&amp;gt;&lt;br /&gt;
[[media:pGA1C3_pLac-GFP.txt]] pGA1C3 plasmid map (with pLac GFP insert). Right click and save as, then open with [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE (A plasmid Editor)].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''mamV''' = 1002 bp or 1168 bp, depending on how we verify the insert. (Malcolm)&lt;br /&gt;
&lt;br /&gt;
'''mamO''' = 1914 bp or 1975 bp (Erich)&lt;br /&gt;
&lt;br /&gt;
'''mamPA''' = 1493 bp or 1584 bp (Ellen)&lt;br /&gt;
&lt;br /&gt;
'''mamSTU''' = 2030 bp or 2160 bp (Kirsten)&lt;/div&gt;</summary>
		<author><name>Kihuffer</name></author>	</entry>

	</feed>