GcatWiki - User contributions [en]

Synergy Machine Protocol for Bio113

2022-10-20T12:27:45Z

Macampbell:

== Synergy Machine Protocol ==

# All wells should contain exactly 200 µL of liquid. Be sure to include wells containing broth with no cells for your blank.
# We use the wavelengths of 460 nm (excitation) and 490 nm(emission) for GFP, and 585 nm(excitation) and 615 nm (emission) for RFP, to minimize noise/interference. However, some of the GFP reading will be from bleeding over of RFP.
# If you are measuring GFP and RFP, measure GFP before RFP.
# You will want to measure cell density using the spectrophotometer with a wavelength of light set for 600 nm.
# Choose the protocol called '''Bio113 Synthetic Biology Research'''
# Place the 96-well plate inside the machine, and be sure to put well A1 near the marker for A1.
# After the machine has run, you can export the data to Excel using the Excel button on the banner of the window that pops up.
 
 
Note- if only a few wells give a value of OVRFLW, try lowering the gain from 100 to 95 or 90 (or lower if necessary). Enter the value on the page with the wavelengths for fluorescence.

APe Sequence Analysis

2022-09-28T13:12:03Z

Macampbell:

== ApE Software for DNA Sequence Analysis ==

* Download the free [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE software] if you want it on your own computer. All college-owned computers already have ApE installed so you can use those computers if you prefer. This tool is used by researchers all over the world.
* Access your sequence files. Click once on a file with the .seq suffix. For Macintosh computers, hold down the command button and type i. A window will open. About halfway down the window under the heading "Open With", choose ApE as the application. Then click on the "Change All" button so that all .seq files will automatically open with ApE.
* Repeat the previous directions but use one of your .ab1 file instead of .seq file.
* Download the [http://www.bio.davidson.edu/people/macampbell/113/weekly_Labs/plasmids.zip 4 receiving plasmids] and identify which plasmid you used. Open the correct .seq that was your receiving plasmid.
* Open the appropriate .seq file for your eXperimental samples.
* When open your .seq files, you will see some N bases. The software inserts an N whenever it cannot tell for sure which base should go there. The software that “calls” each base uses three criteria: phred score of quality; width of the peak; and spacing between peaks. Phred scores can be seen as the light bar graphs behind the colored lines. Good scores result in a bar graph about half way up the sequence box. Each base is associated with a different color line.
* Under the “Tools” menu, choose “Align Sequences…”. Choose your receiving plasmid.seq as the reference, using the drop down menu. In the “Align to Windows” field, select any comparison .seq files by clicking on the file names. Click on the button “Show Alignment Parameters and set them as shown. This will cause your sequence to not be split into small fragments. Click OK. 
<center>
[[File:align_options.png]]
</center>
* In the resulting window, you should be able to find the newly cloned DNA if GGA was successful.
* Now you want to open the matching chromat file .ab1. Adjust the X and Y sliders so that the peak heights nearly reach the letters and the spacing between peaks is big enough to clearly see each peek (see below). You can use this to confirm or clarify any bases that do not match your expectations. You can see the Phred scores for each base in the screen shot below.
<center>
[[File:2chromats.png|800px]]
</center>
* You can use the "Find" function to locate the bases that flank the questionable nucleotides. Look at the chromatogram and determine what the base should be.

PCR for Bio113

2022-09-15T12:02:12Z

Macampbell: /* PCR Verification of Successful GGA */

==PCR Verification of Successful GGA==
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel).
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template.
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred.
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid.
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells.
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:

----

# 95° C for 5 minutes, 1 time
# 95° C for 30 seconds
# 54° C for 30 seconds
#72° C for 30 seconds
# return to step #2 29 more times
# store at 22° C indefinitely

* When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.

== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==
'''J119137; pClone Red (remove 70 bp, insert <61 bp)''' 
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C 
177 bp amplicon for J119137 
167 bp amplicon for 60 bp insertion 
 
 
'''J100384; pClone mScarlet (remove 70 bp, insert <61 bp)''' 
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C 
228 bp amplicon for J100384 
220 bp amplicon for 60 bp insertion 
 
 
'''J119384; rClone Red (remove 819 bp, insert <61 bp)''' 
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C 
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C 
856 bp amplicon for J119384 
58 bp amplicon for 15 bp insertion 
 
 
'''J100419; rClone mScarlet (remove 819 bp, insert <61 bp)''' 
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C 
113_mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C 
914 bp amplicon for J100419 
95 bp amplicon for 15 bp insertion 
 
 
 
 
 
 

'''Previous plasmids used in 113''' 
'''J100204; actClone Red (remove 119 bp, insert <61 bp)''' 
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C 
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG Tm = 61 C 
250 bp amplicon for J100204 
 
 
'''J100205; repClone Red (remove 129 bp, insert <61 bp)''' 
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C 
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C 
424 bp amplicon for J100205

Bacterial Transformation for Bio113

2022-09-02T17:49:12Z

Macampbell: /* Transforming DNA after GGA Ligation */

== Transforming DNA after GGA Ligation ==

# Thaw the competent cells on ice for 6 minutes. Each tube contains 50 µL of ''E. coli'', JM109 cells.
# Add all 50 µL of your ''E. coli'' cells to the GGA ligation mixture. Very gently mix the DNA and cells and return the cells to ice ASAP.
# Incubate on ice for 5 minutes.
# Spread cells onto LB plates containing ampicillin.
You're done already!!

Freeze glycerol stocks of E. coli

2022-08-09T20:41:55Z

Macampbell: Created page with "To preserve all stocks of each strain derived from a unique colony, we will freeze glycerol stock at -80 C. # Put 37.5 µL of warmed glycerol in a pre-labeled sterile 1.5 mL..."

To preserve all stocks of each strain derived from a unique colony, we will freeze glycerol stock at -80 C.

# Put 37.5 µL of warmed glycerol in a pre-labeled sterile 1.5 mL tube.
# Remove 212.5 µL of your overnight culture and add it to the appropriately labeled tube with glycerol.
# Close the lid tightly and mix by vortexing.
# When all 4 tubes are well mixed, give them to your instructor to put in the freezer.

Davidson Bio113 Protocols

2022-08-09T20:39:19Z

Macampbell:

== Biology 113 Lab Methods for A. Malcolm Campbell ==

'''A. Links for Registry of DNA Parts'''
# [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=Regulatory List of Known Promoters]
# [http://partsregistry.org/Add_a_Part_to_the_Registry Add A New Part to Registry]
# [http://parts.igem.org/Part:BBa_J119137 pClone Red J119137]
# [http://parts.igem.org/Part:BBa_J119137 rClone Red J119384]
# [http://parts.igem.org/Part:BBa_J119137 actClone Red J100204]
# [http://parts.igem.org/Part:BBa_J119137 repClone Red J100205]

'''B. Links for Wet Lab Protocols'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html boil and cool oligos into dsDNA]
# [[Golden_Gate_Assembly_for_Bio113]]
# [[Bacterial_Transformation_for_Bio113]]
# [[Freeze glycerol stocks of E. coli]]
# [[PCR_for_Bio113]]
# [[Gel_Electrophoresis_for_Bio113]]
# [[Synergy_Machine_Protocol_for Bio113]]
# [[Miniprep_Plasmid_DNA_for_Bio113]]
# [[Nanodrop_DNA_for_Bio113]]
# [[Sequence_DNA_for_Bio113]]

'''C. Links for Dry Lab Protocols'''
# [http://gcat.davidson.edu/iGem10/index.html Oligator]
# [[aPe Sequence_Analysis]]

Davidson Bio113 Protocols

2022-08-09T20:38:48Z

Macampbell:

== Biology 113 Lab Methods for A. Malcolm Campbell ==

'''A. Links for Registry of DNA Parts'''
# [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=Regulatory List of Known Promoters]
# [http://partsregistry.org/Add_a_Part_to_the_Registry Add A New Part to Registry]
# [http://parts.igem.org/Part:BBa_J119137 pClone Red J119137]
# [http://parts.igem.org/Part:BBa_J119137 rClone Red J119384]
# [http://parts.igem.org/Part:BBa_J119137 actClone Red J100204]
# [http://parts.igem.org/Part:BBa_J119137 repClone Red J100205]

'''B. Links for Wet Lab Protocols'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html boil and cool oligos into dsDNA]
# [[Golden_Gate_Assembly_for_Bio113]]
# [[Bacterial_Transformation_for_Bio113]]
# [[Freeze glycerol stocks of E. coli]]
# [[PCR_for_Bio113]]
# [[Gel_Electrophoresis_for_Bio113]]
# [[Synergy_Machine_Protocol_for Bio113]]
# [[Miniprep_Plasmid_DNA_for_Bio113]]
# [[Nanodrop_DNA_for_Bio113]]
# [[Sequence_DNA_for_Bio113]]

'''C. Links for Dry Lab Protocols'''
# [http://gcat.davidson.edu/iGem10/index.html Oligator]
# [[aPe Sequence_Analysis]]

Synergy Machine Protocol for Bio113

2022-08-09T16:05:46Z

Macampbell:

== Synergy Machine Protocol ==

# All wells should contain exactly 200 µL of liquid. Be sure to include wells containing broth with no cells for negative control.
# We use the wavelengths of 460 nm (excitation) and 490 nm(emission) for GFP, and 585 nm(excitation) and 615 nm (emission) for RFP, to minimize noise/interference. However, some of the GFP reading will be from bleeding over of RFP.
# If you are measuring GFP and RFP, measure GFP before RFP.
# You will want to measure cell density using the spectrophotometer with a wavelength of light set for 600 nm.
# Choose the protocol called '''Bio113 Synthetic Biology Research'''
# Place the 96-well plate inside the machine, and be sure to put well A1 near the marker for A1.
# After the machine has run, you can export the data to Excel using the Excel button on the banner of the window that pops up.
 
 
Note- if only a few wells give a value of OVRFLW, try lowering the gain from 100 to 95 or 90 (or lower if necessary). Enter the value on the page with the wavelengths for fluorescence.

Sequence DNA for Bio113

2020-12-01T19:53:59Z

Macampbell:

== Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence ==
# For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
# Add water to your DNA until the combined volume is 8 µL.
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
# Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.

----

'''Sequencing Primers to confirm Inserts v2.0''' 
113_pClone_Red_SeqFor (called pClone_Red_Fwd3 in SnapGene file) 
'''GTGCAAATAAATTTAAGGGTAAG''' Tm = 51°C as per SnapGene; 151bp upstream of first base of the sticky end 
This new primer gave good results for every reaction. Previous sequencing primer was too close to the insert and most of the new promoters were not readable.
 
 
<hr>
<hr>
 
 
113_rClone_Red_SeqRev 
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream of first base of new DNA part 
 
 
113_pClone_mScarlet_SeqFor 
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream of first base of new DNA part 
 
 
113_rClone_mScarlet_SeqRev 
CACTTTGAAGCGCATGAATTC Tm = 55° C 118 bp downstream of first base of new DNA part

Sequence DNA for Bio113

2020-12-01T19:53:17Z

Macampbell:

== Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence ==
# For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
# Add water to your DNA until the combined volume is 8 µL.
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
# Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.

----

'''Sequencing Primers to confirm Inserts v2.0''' 
113_pClone_Red_SeqFor (called pClone_Red_Fwd3 in SnapGene file) 
'''GTGCAAATAAATTTAAGGGTAAG''' Tm = 51°C as per SnapGene; 151bp upstream of first base of the sticky end 
 
 
<hr>
<hr>
 
 
113_rClone_Red_SeqRev 
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream of first base of new DNA part 
 
 
113_pClone_mScarlet_SeqFor 
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream of first base of new DNA part 
 
 
113_rClone_mScarlet_SeqRev 
CACTTTGAAGCGCATGAATTC Tm = 55° C 118 bp downstream of first base of new DNA part

Sequence DNA for Bio113

2020-12-01T19:52:48Z

Macampbell:

== Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence ==
# For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
# Add water to your DNA until the combined volume is 8 µL.
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
# Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.

----

'''Sequencing Primers to confirm Inserts v2.0''' 
113_pClone_Red_SeqFor (called pClone_Red_Fwd3 in SnapGene file) 
GTGCAAATAAATTTAAGGGTAAG Tm = 51°C as per SnapGene; 151bp upstream of first base of the sticky end 
 
 
<hr>
<hr>
 
 
113_rClone_Red_SeqRev 
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream of first base of new DNA part 
 
 
113_pClone_mScarlet_SeqFor 
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream of first base of new DNA part 
 
 
113_rClone_mScarlet_SeqRev 
CACTTTGAAGCGCATGAATTC Tm = 55° C 118 bp downstream of first base of new DNA part

Golden Gate Assembly for Bio113

2020-02-05T14:02:10Z

Macampbell:

==Starting with Boiled then Cooled Oligos==
# You should have already used the [http://gcat.davidson.edu/iGem10/index.html Oligator] to design your oligos for your dsDNA control element. 
# You should have already calculated how to dilute your boiled and cooled oligos from 5 µM to 40 nM. 

==Protocol Details for GGA==

# You will be given two tubes. One tube will be labeled "X" for eXperimental DNA, the other "N" for the negative control that contains plasmid only. Put your initials on the tubes and return the tubes to ice. These tubes will already contain 9 µL of the GGA Mixture.
# Add 1 µL '''diluted''' oligos cooled overnight to the tube labeled '''X''' for the experimental DNA.
# Add 1 µL '''water''' to the tube labeled '''N''' for the negative control"

'''GGA mixture contains:''' 
* 1 µL (40 nM) plasmid containing your receiving plasmid (pClone) 
* 6 µL dH2O 
* 1 µL 10X Promega Ligase Buffer 
* 0.5 µL Bsa I high fidelity (HFv2) restriction enzyme 
* 0.5 µL T4 DNA ligase from Promega 
* 9 µL final volume 

Turn on the thermocycler. Put '''both''' of your tubes into the machine. 
Program it for the following cylces: 
* 20 cycles of 37C for 1.5 minute and 16C for 1.5 minute 
* 37C for 3 minutes 
* 22C holding temperature 
* heated lid on

This DNA ligation is ready for transformation. 

You can increase the number of cycles to 30 if you want to increase yield. However, we have gotten good success with as few as 5 cycles.

This protocols was developed at MWSU by Dr. Todd Eckdahl, and modified at Davidson College by Annie Wacker and Malcolm Campbell.

Sequence DNA for Bio113

2020-01-03T15:35:07Z

Macampbell:

== Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence ==
# For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
# Add water to your DNA until the combined volume is 8 µL.
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
# Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.

----

'''Sequencing Primers to confirm Inserts v2.0''' 
113_pClone_Red_SeqFor 
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream of first base of new DNA part 
 
 
<hr>
<hr>
 
 
113_rClone_Red_SeqRev 
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream of first base of new DNA part 
 
 
113_pClone_mScarlet_SeqFor 
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream of first base of new DNA part 
 
 
113_rClone_mScarlet_SeqRev 
CACTTTGAAGCGCATGAATTC Tm = 55° C 118 bp downstream of first base of new DNA part

Nanodrop DNA for Bio113

2020-01-03T15:33:17Z

Macampbell:

== Nanodrop DNA ==
# The Nanodrop will be blanked using the elution buffer from your mini prep.
# Pipet 2 µL of your mini prep onto the small open stop on the metal circle.
# Carefully lower the arm and click on the measure button.
; Record these values for each of your samples:
: absorbance value of your DNA at 260 nm
: concentration of your DNA in ng/µL
: 260/280 ratio value

Nanodrop DNA for Bio113

2020-01-03T15:32:32Z

Macampbell:

== Nanodrop DNA ==
# The Nanodrop will be blanked using the elution buffer from your mini prep.
# Pipet 2 µL of your mini prep onto the small open stop on the metal circle.
# Carefully lower the arm and click on the measure button.
# Record these values for each of your samples:
* absorbance value of your DNA at 260 nm
* concentration of your DNA in ng/µL
* 260/280 ratio value

Nanodrop DNA for Bio113

2020-01-03T15:29:44Z

Macampbell:

== Nanodrop DNA ==
# The Nanodrop will be blanked using the elution buffer from your mini prep.
# Pipet 2 µL of your mini prep onto the small open stop on the metal circle.
# Carefully lower the arm and click on the measure button.
# Record these values for each of your samples:
** absorbance value of your DNA at 260 nm
* concentration of your DNA in ng/µL
* 260/280 ratio value

Davidson Protocols

2019-09-24T21:24:30Z

Macampbell:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation - Campbell Old School Method]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# When using theophylline with riboswitch C, make a 40-100 mM stock solution of '''theophylline''' in 50 mM NaOH. The final concentration of theophylline should be 2 mM. It works best to make LB media with theophylline in it prior to autoclaving. This way you can avoid the NaOH.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]
# [[M13 Bacteriophage Production Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]
# [http://gcat.davidson.edu/SynBio18/REmbedder/rembedder.html REmbedder (insert restriction site without changing amino acids)]
# [[Common Restriction Sites]]
# [http://gcat.davidson.edu/SynBio18/StickyEndSelector/StickyEndSelector.html Sticky End Selector] to optimize unique sticky ends for correct cloning of fragments
# [http://gcat.davidson.edu/SynBio18/ProteasePicker/ProteasePicker.html Protease Picker] for selecting which protease you want to use to produce desirable fragments

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

'''J Yeast Protocols'''
#[[Yeast Media]]
#[[Yeast Transformation]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Golden Gate Assembly protocol

2019-03-03T06:07:53Z

Macampbell:

<center>'''Protocol to insert new promoter made into pSB1A2 that contains [http://partsregistry.org/Part:BBa_J100091 BBa_J100091]'''</center> 

==Starting with Boiled then Cooled Oligos==
# You should have already used the [http://gcat.davidson.edu/iGem10/index.html Oligator] to design your oligos for self-assembly into dsDNA. You can take advantage of Oligator's capacity to add the sticky ends onto your oligos, or you can do that yourself. Oligator can also add the BsaI restriction sites onto your DNA which will be cut off by BsaI enzyme in the GGA mixture. 
# Use the protocol for [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html boiling oligos to assemble dsDNA].
# Determine how many ng of insert you will need in GGA (below) using this formula X ng of insert = (bp insert) (50 ng linearized plasmid-) ÷ (size of entire plasmid in bp) 

If you don't want to calculate exactly how many ng you need, you can use this approximation for short segments of DNA:
* 1 µL cooled oligos.
* 99 µL water to make a 100X dilution.
* Use 1 µL of the 100X diluted oligos and add to the 9 µL described below.

 

==Protocol Details for GGA==

# Get '''two''' new, small microfuge tubes designed to fit into the PCR machine.
# One tube will be labeled "ligation", the other "plasmid only". Also put your initials on the tubes.
# 1 µL diluted oligos cooled overnight (''use water instead for "plasmid only" tube'').
# 9 µL '''GGA mixture'''
# Use the boiled and cooled promoter DNA for the ligation tube but use only water for the plasmid only tube. 

'''GGA mixture contains:''' 
1 µL (50 ng) plasmid containing receiving plasmid such as [http://partsregistry.org/Part:BBa_J119137 part J119137] 
6 µL dH2O 
1 µL 10X NEB Ligase Buffer 
0.5 µL Bsa I high fidelity (HFv2) restriction enzyme 
0.5 µL T4 DNA ligase from NEB 
9 µL final volume 

Turn on the thermocycler machine. Put '''both''' of your tubes into the machine. 
Program it for the following cylces: 
* 20 cycles of 37C for 1 minute/16C for 1 minute 
* 1 cycle of 37C for 15 minutes 
* 22C holding temperature 
This DNA ligation is ready for transformation. 

You can increase the number of cycles to 30 if you want to increase yield. However, we have gotten good success with as few as 5 cycles.

==Transformations after GGA==
You want to do 3 transformations: 
# a positive control that contains known [http://partsregistry.org/Part:BBa_K315008 promoter + RBS + RFP] to be used for comparison RFP expression. 
# your experimental ligation 
# your negative control ligation 
Use all 10 µL of the ligations for a [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transformation]. 
You will want to perform a transformation positive control using [http://partsregistry.org/Part:BBa_K315008 K315008] which contains pLacI+RBS+RFP in plasmid pSB1A2. 

Use between 20 - 50 µL of Zippy competent cells into each of three 1.5 mL tubes labeled appropriately for each of the three [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html transformations] listed above. Plate all three transformations on LB amp plates. 

==PCR Verification of Successful GGA==
If you want to PCR verify that GGA has happened, you can use colony PCR and analyze the product by gel electrophoresis (1.7% agarose gel).
# Use negative control colonies as template to see the MW of the PCR product when TT is still in the plasmid and no GGA has occurred. Run one lane of this negative control PCR product for each row on your gel.
# Use these two primers:
* Forward = 5’ GAATTCGCGGCCGCTTCTAG 3’
* Reverse = 5’ TTTGATAACATCTTCGGAGG 3’
* PCR product with the original TT still in place is 251 bp
* size of TT that should be removed by GGA is 107 bp

This protocols was developed at MWSU by Dr. Todd Eckdahl, and modified at Davidson College by Annie Wacker and Malcolm Campbell.

Davidson Protocols

2019-01-13T19:15:21Z

Macampbell:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation - Campbell Old School Method]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# When using theophylline with riboswitch C, make a 40-100 mM stock solution of '''theophylline''' in 50 mM NaOH. The final concentration of theophylline should be 2 mM. It works best to make LB media with theophylline in it prior to autoclaving. This way you can avoid the NaOH.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]
# [[M13 Bacteriophage Production Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]
# [http://gcat.davidson.edu/SynBio18/REmbedder/rembedder.html REmbedder (insert restriction site without changing amino acids)]
# [[Common Restriction Sites]]
# [http://gcat.davidson.edu/SynBio18/StickyEndSelector/StickyEndSelector.html Sticky End Selector] to optimize unique sticky ends for correct cloning of fragments
# [http://gcat.davidson.edu/SynBio18/ProteasePicker/ProteasePicker.html Protease Picker] for selecting which protease you want to use to produce desirable fragments

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Miniprep Plasmid DNA for Bio113

2018-11-07T00:59:05Z

Macampbell:

'''Day Before Lab Day (4:30 pm)'''
For each miniprep, grow 2 mL of LB + ampicillin culture, 37° C, overnight (O/N); shake at 250 RPM to make sure the cultures are well aerated.

'''Lab Day'''
# Label two 1.5 mL tubes with your initials and the clone you will miniprep (e.g., X1). Also, label one 2 mL collection tube and the spin column (around the rim) that is inside the collection tube.
#Add 600 µL of O/N culture to one of the appropriately labeled 1.5 mL microfuge tubes. Save the rest of the O/N culture and keep them sterile.
# Add 100 µL 7X Lysis Buffer (blue color). Mix by inverting the tube 4-10 times. Solution should become clear blue instead of opaque. Proceed to the next step within 3 minutes.
# Add 350 µL of Neutralization Buffer (yellow color; RNase A already added) and mix by inverting the tube until the entire solution and precipitate is yellow. This buffer is stored at +4 ° C.
# Microfuge full speed for 2 minutes at room temperature (RT°).
# Transfer ~900 µL yellow supernatant to Zymo-Spin II column. Do not transfer any of the solid precipitate. Better to leave some clear yellow liquid behind than to get greedy and transfer some solid material.
# Microfuge full speed for 2 minutes at RT°.
# Discard liquid flowthrough and reinsert Zymo-Spin II column into same collection tube.
# Add 200 µL Endo-Wash Buffer to the Zymo-Spin II column. Spin full speed for 15 seconds at RT°. Repeat this step a second time. No need to empty flow through until second wash is completed.
# Add 400 µL Zyppy Wash Buffer (with ethonol already added). Spin full speed for 30 seconds at RT°. Discard liquid flowthrough. Repeat this step a second time. Discard liquid flowthrough and and the 2 mL collection tube after the second wash. The DNA is still in the spin column.
# Transfer Zymo-Spin II column to a clean and appropriately labeled 1.5 mL microfuge tube. '''Cut the lid off this tube before microfuging!'''
# Add 30 µL Zyppy Elution Buffer to the center of the to the Zymo-Spin II column. Let it stand for 1 minute to maximize yield.
# Microfuge full speed for 30 seconds at RT°. SAVE THE LIQUID with your plasmid. Discard the spin column.
# You can NanoDrop the DNA to determine the concentration.

Sequence DNA for Bio113

2018-11-07T00:57:00Z

Macampbell:

== Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence ==
# For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
# Add water to your DNA until the combined volume is 8 µL.
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
# Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.

----

'''Sequencing Primers to confirm Inserts v2.0''' 
113_pClone_Red_SeqFor 
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream of first base of new DNA part 
 
 
113_rClone_Red_SeqRev 
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream of first base of new DNA part 
 
 
113_pClone_mScarlet_SeqFor 
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream of first base of new DNA part 
 
 
113_rClone_mScarlet_SeqRev 
CACTTTGAAGCGCATGAATTC Tm = 55° C 118 bp downstream of first base of new DNA part

Miniprep Plasmid DNA for Bio113

2018-11-06T18:37:23Z

Macampbell:

'''Day Before Lab Day (4:30 pm)'''
For each miniprep, grow 2 mL of LB + ampicillin culture, 37° C, overnight (O/N); shake at 250 RPM to make sure the cultures are well aerated.

'''Lab Day'''
# Label two 1.5 mL tubes with your initials and the clone you will miniprep (e.g., X1). Also, label one 2 mL collection tube and the spin column with it.
#Add 600 µL of O/N culture to an appropriately labeled 1.5 mL microfuge tube. Save the rest of the O/N culture and keep them sterile.
# Add 100 µL 7X Lysis Buffer (blue color). Mix by inverting the tube 4-10 times. Solution should become clear blue instead of opaque. Proceed to the next step within 3 minutes.
# Add 350 µL of Neutralization Buffer (yellow color; RNase A already added) and mix by inverting the tube until the entire solution and precipitate is yellow. This buffer is stored at +4 ° C.
# Microfuge full speed for 2 minutes at room temperature (RT°).
# While your samples are spinning, prepare Zymo-Spin II column (with white binding resin) by inserting into 2 mL collection tube. Be sure to label the spin column and the collection tube. Also label a second 1.5 mL microfuge tube for the final elution.
# Transfer ~900 µL yellow supernatant to Zymo-Spin II column. Do not transfer any of the solid precipitate. Better to leave some clear yellow liquid behind than to get greedy and transfer some solid material.
# Microfuge full speed for 2 minutes at RT°.
# Discard liquid flowthrough and reinsert Zymo-Spin II column into same collection tube.
# Add 200 µL Endo-Wash Buffer to the Zymo-Spin II column. Spin full speed for 15 seconds at RT°. Repeat this step a second time. No need to empty flow through until second wash is completed.
# Add 400 µL Zyppy Wash Buffer (with ethonol already added). Spin full speed for 30 seconds at RT°. Discard liquid flowthrough. Repeat this step a second time. Discard liquid flowthrough and and the 2 mL collection tube after the second wash. The DNA is still in the spin column.
# Transfer Zymo-Spin II column to a clean and appropriately labeled 1.5 mL microfuge tube (from step 5 above). '''Cut the lid off this tube before microfuging!'''
# Add 30 µL Zyppy Elution Buffer to the center of the to the Zymo-Spin II column. Let it stand for 1 minute to maximize yield.
# Microfuge full speed for 30 seconds at RT°. SAVE THE LIQUID with your plasmid. Discard the spin column.
# You can NanoDrop the DNA to determine the concentration.

Miniprep Plasmid DNA for Bio113

2018-11-06T18:27:53Z

Macampbell:

'''Day Before Lab Day (4:30 pm)'''
For each miniprep, grow 2 mL of LB + ampicillin culture, 37° C, overnight (O/N); shake at 250 RPM to make sure the cultures are well aerated.

'''Lab Day'''
# Label two 1.5 mL tubes with your initials and the clone you will miniprep (e.g., X1).
#Add 600 µL of O/N culture to an appropriately labeled 1.5 mL microfuge tube. Save the rest of the O/N culture and keep them sterile.
# Add 100 µL 7X Lysis Buffer (blue color). Mix by inverting the tube 4-10 times. Solution should become clear blue instead of opaque. Proceed to the next step within 3 minutes.
# Add 350 µL of Neutralization Buffer (yellow color; RNase A already added) and mix by inverting the tube until the entire solution and precipitate is yellow. This buffer is stored at +4 ° C.
# Microfuge full speed for 2 minutes at room temperature (RT°).
# While your samples are spinning, prepare Zymo-Spin II column (with white binding resin) by inserting into 2 mL collection tube. Be sure to label the spin column and the collection tube. Also label a second 1.5 mL microfuge tube for the final elution.
# Transfer ~900 µL yellow supernatant to Zymo-Spin II column. Do not transfer any of the solid precipitate. Better to leave some clear yellow liquid behind than to get greedy and transfer some solid material.
# Microfuge full speed for 2 minutes at RT°.
# Discard liquid flowthrough and reinsert Zymo-Spin II column into same collection tube.
# Add 200 µL Endo-Wash Buffer to the Zymo-Spin II column. Spin full speed for 15 seconds at RT°. Repeat this step a second time. No need to empty flow through until second wash is completed.
# Add 400 µL Zyppy Wash Buffer (with ethonol already added). Spin full speed for 30 seconds at RT°. Discard liquid flowthrough. Repeat this step a second time. Discard liquid flowthrough and and the 2 mL collection tube after the second wash. The DNA is still in the spin column.
# Transfer Zymo-Spin II column to a clean and appropriately labeled 1.5 mL microfuge tube (from step 5 above). '''Cut the lid off this tube before microfuging!'''
# Add 30 µL Zyppy Elution Buffer to the center of the to the Zymo-Spin II column. Let it stand for 1 minute to maximize yield.
# Microfuge full speed for 30 seconds at RT°. SAVE THE LIQUID with your plasmid. Discard the spin column.
# You can NanoDrop the DNA to determine the concentration.

Bacterial Transformation for Bio113

2018-10-23T19:32:18Z

Macampbell:

== Transforming DNA after GGA Ligation ==

# Thaw the competent cells on ice for 6 minutes. Each tube contains 50 µL of ''E. coli'', JM109 cells.
# Add all 50 µL of your ''E. coli'' cells to the GGA ligation mixture. Very gently mix the DNA and cells and return the cells to ice ASAP.
# Incubate on ice for 5 minutes.
# Add 30 µL SOC media with no antibiotic to your transformed cells. Spread cells onto LB plates containing ampicillin.
You're done already!!

Bacterial Transformation for Bio113

2018-10-23T19:21:37Z

Macampbell:

== Transforming DNA after GGA Ligation ==

# Thaw the competent cells on ice for 6 minutes. Each tube contains 50 µL of ''E. coli'', JM109 cells.
# Add all 50 µL of your ''E. coli'' cells to the GGA ligation mixture. Very gently mix the DNA and cells and return the cells to ice ASAP.
# Incubate on ice for 5 minutes.
# Add 60 µL SOC media with no antibiotic to your transformed cells. Spread cells onto LB plates containing ampicillin.
You're done already!!

Davidson Protocols

2018-10-16T13:29:44Z

Macampbell:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation - Campbell Old School Method]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# When using theophylline with riboswitch C, make a 40-100 mM stock solution of '''theophylline''' in 50 mM NaOH. The final concentration of theophylline should be 2 mM. It works best to make LB media with theophylline in it prior to autoclaving. This way you can avoid the NaOH.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]
# [[M13 Bacteriophage Production Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]
# [http://gcat.davidson.edu/SynBio18/REmbedder/rembedder.html REmbedder (insert restriction site without changing amino acids)]
# [[Common Restriction Sites]]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Davidson Protocols

2018-10-16T13:28:20Z

Macampbell:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation - Campbell Old School Method]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# When using theophylline with riboswitch C, make a 40-100 mM stock solution of '''theophylline''' in 50 mM NaOH. The final concentration of theophylline should be 2 mM.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]
# [[M13 Bacteriophage Production Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]
# [http://gcat.davidson.edu/SynBio18/REmbedder/rembedder.html REmbedder (insert restriction site without changing amino acids)]
# [[Common Restriction Sites]]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Davidson Protocols

2018-09-27T20:49:27Z

Macampbell:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation - Campbell Old School Method]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# When using theophylline with riboswitch C, make a 40-100 mM stock solution of '''theophylline''' in 50 mM NaOH. The final concentration of theophylline should be 2 µM.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]
# [[M13 Bacteriophage Production Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]
# [http://gcat.davidson.edu/SynBio18/REmbedder/rembedder.html REmbedder (insert restriction site without changing amino acids)]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Davidson Protocols

2018-09-27T20:49:04Z

Macampbell:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation - Campbell Old School Method]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# When using theophylline with riboswitch C, make a 40-100 mM stock solution of '''theophylline''' in 50 mM NaOH. The final concentration of theophylline should be 2 µM.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]
# [[M13 Bacteriophage Production Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]
# [http://gcat.davidson.edu/SynBio18/REmbedder/rembedder.html REmbedder (insert restriction site without changing amino acids)

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

PCR for Bio113

2018-09-25T19:47:33Z

Macampbell:

==PCR Verification of Successful GGA==
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel).
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template.
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred.
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid.
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells.
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:

----

# 95° C for 5 minutes, 1 time
# 95° C for 30 seconds
# 54° C for 30 seconds
#72° C for 1 minute
# return to step #2 29 more times
# store at 22° C indefinitely

* When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.

== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==
'''J119137; pClone Red (remove 70 bp, insert <61 bp)''' 
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C 
177 bp amplicon for J119137 
167 bp amplicon for 60 bp insertion 
 
 
'''J100384; pClone mScarlet (remove 70 bp, insert <61 bp)''' 
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C 
228 bp amplicon for J100384 
220 bp amplicon for 60 bp insertion 
 
 
'''J119384; rClone Red (remove 819 bp, insert <61 bp)''' 
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C 
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C 
856 bp amplicon for J119384 
58 bp amplicon for 15 bp insertion 
 
 
'''J100419; rClone mScarlet (remove 819 bp, insert <61 bp)''' 
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C 
113_mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C 
914 bp amplicon for J100419 
95 bp amplicon for 15 bp insertion 
 
 
 
 
 
 

'''Previous plasmids used in 113''' 
'''J100204; actClone Red (remove 119 bp, insert <61 bp)''' 
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C 
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG Tm = 61 C 
250 bp amplicon for J100204 
 
 
'''J100205; repClone Red (remove 129 bp, insert <61 bp)''' 
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C 
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C 
424 bp amplicon for J100205

PCR for Bio113

2018-09-24T22:43:49Z

Macampbell: /* PCR Verification of Successful GGA */

==PCR Verification of Successful GGA==
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel).
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template.
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred.
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid.
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells.
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:

----

# 95° C for 5 minutes, 1 time
# 95° C for 30 seconds
# 54° C for 30 seconds
#72° C for 1 minute
# return to step #2 29 more times
# store at 22° C indefinitely

* When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.

== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) == <#results>
'''J119137; pClone Red (remove 70 bp, insert <61 bp)''' 
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C 
177 bp amplicon for J119137 
167 bp amplicon for 60 bp insertion 
 
 
'''J100384; pClone mScarlet (remove 70 bp, insert <61 bp)''' 
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C 
228 bp amplicon for J100384 
220 bp amplicon for 60 bp insertion 
 
 
'''J119384; rClone Red (remove 819 bp, insert <61 bp)''' 
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C 
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C 
856 bp amplicon for J119384 
58 bp amplicon for 15 bp insertion 
 
 
'''J100419; rClone mScarlet (remove 819 bp, insert <61 bp)''' 
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C 
113_mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C 
914 bp amplicon for J100419 
95 bp amplicon for 15 bp insertion 
 
 
 
 
 
 

'''Previous plasmids used in 113''' 
'''J100204; actClone Red (remove 119 bp, insert <61 bp)''' 
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C 
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG Tm = 61 C 
250 bp amplicon for J100204 
 
 
'''J100205; repClone Red (remove 129 bp, insert <61 bp)''' 
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C 
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C 
424 bp amplicon for J100205

PCR for Bio113

2018-09-24T22:43:32Z

Macampbell:

==PCR Verification of Successful GGA==
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel).
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template.
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred.
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid.
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells.
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:

----

# 95° C for 5 minutes, 1 time
# 95° C for 30 seconds
# 54° C for 30 seconds
#72° C for 1 minute
# return to step #2 29 more times
# store at 22° C indefinitely

* When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.

== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) == <#results>
'''J119137; pClone Red (remove 70 bp, insert <61 bp)''' 
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C 
177 bp amplicon for J119137 
167 bp amplicon for 60 bp insertion 
 
 
'''J100384; pClone mScarlet (remove 70 bp, insert <61 bp)''' 
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C 
228 bp amplicon for J100384 
220 bp amplicon for 60 bp insertion 
 
 
'''J119384; rClone Red (remove 819 bp, insert <61 bp)''' 
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C 
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C 
856 bp amplicon for J119384 
58 bp amplicon for 15 bp insertion 
 
 
'''J100419; rClone mScarlet (remove 819 bp, insert <61 bp)''' 
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C 
113_mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C 
914 bp amplicon for J100419 
95 bp amplicon for 15 bp insertion 
 
 
 
 
 
 

'''Previous plasmids used in 113''' 
'''J100204; actClone Red (remove 119 bp, insert <61 bp)''' 
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C 
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG Tm = 61 C 
250 bp amplicon for J100204 
 
 
'''J100205; repClone Red (remove 129 bp, insert <61 bp)''' 
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C 
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C 
424 bp amplicon for J100205

PCR for Bio113

2018-09-17T22:27:40Z

Macampbell:

==PCR Verification of Successful GGA==
If you want to use PCR to verify that GGA has happened, you can amplify the plasmid DNA inside the cells you grew overnight. After PCR, you will need to analyze the PCR product (often called an amplicon) by gel electrophoresis (2.0% agarose gel).
# For each PCR you want to perform on your eXperimental cells (e.g. X1, X2, X3), remove 2 µL of cells from the overnight culture. This will serve as your template.
# Use 2 µL of negative control (N) cells as template to see the MW of the PCR product when no GGA has occurred.
# Add the 2 µL of cell cultures to the labeled tubes for your particular receiving plasmid.
# The tubes already contain the paired PCR primers (see list below) and the green GoTaq master mix that includes buffer, dNTPs and Taq DNA polymerase. The volume of this tube is currently 23 µL and will be 25 µL after you add the template cells.
# Put your labeled tubes (treatment and group name) into the thermocycler. Your tubes will be incubated as follows:

----

# 95° C for 5 minutes, 1 time
# 95° C for 30 seconds
# 54° C for 30 seconds
#72° C for 1 minute
# return to step #2 29 more times
# store at 22° C indefinitely

* When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.

== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==
'''J119137; pClone Red (remove 70 bp, insert <61 bp)''' 
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C 
177 bp amplicon for J119137 
167 bp amplicon for 60 bp insertion 
 
 
'''J100384; pClone mScarlet (remove 70 bp, insert <61 bp)''' 
113_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C 
113_pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C 
228 bp amplicon for J100384 
220 bp amplicon for 60 bp insertion 
 
 
'''J119384; rClone Red (remove 819 bp, insert <61 bp)''' 
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C 
113_rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C 
856 bp amplicon for J119384 
58 bp amplicon for 15 bp insertion 
 
 
'''J100419; rClone mScarlet (remove 819 bp, insert <61 bp)''' 
113_rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C 
113_mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C 
914 bp amplicon for J100419 
95 bp amplicon for 15 bp insertion 
 
 
 
 
 
 

'''Previous plasmids used in 113''' 
'''J100204; actClone Red (remove 119 bp, insert <61 bp)''' 
113_actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C 
113_actClone_confirm_Rev; ATGCAGAATAATCCAACACG Tm = 61 C 
250 bp amplicon for J100204 
 
 
'''J100205; repClone Red (remove 129 bp, insert <61 bp)''' 
113_repClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C 
113_repClone_confirm_Rev; CCTTCGTACGGACGACCTTC Tm = 58 C 
424 bp amplicon for J100205

Davidson Protocols

2018-08-28T21:06:58Z

Macampbell:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation - Campbell Old School Method]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# When using theophylline with riboswitch C, make a 40-100 mM stock solution of '''theophylline''' in 50 mM NaOH. The final concentration of theophylline should be 2 µM.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]
# [[M13 Bacteriophage Production Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Davidson Protocols

2018-08-28T21:06:34Z

Macampbell:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation - Campbell Old School Method]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# When using theophylline with riboswitch C, make a 40 mM stock solution of '''theophylline''' in 50 mM NaOH. The final concentration of theophylline should be 2 µM.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]
# [[M13 Bacteriophage Production Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Davidson Protocols

2018-08-27T20:34:39Z

Macampbell:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation - Campbell Old School Method]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# When using theophylline with riboswitch C, make a 40 mM stock solution of '''theophylline'''. The final concentration of theophylline should be 2 µM.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]
# [[M13 Bacteriophage Production Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Sequence DNA for Bio113

2018-08-06T13:08:11Z

Macampbell:

== Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence ==
# For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
# Add water to your DNA until the combined volume is 8 µL.
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
# Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.

----

'''Sequencing Primers to confirm Inserts v2.0''' 
113_pClone_Red_SeqFor 
CTAATTCAACAAGAATTGGGAC Tm = 60° C 71bp upstream first base of new DNA part 
 
 
113_rClone_Red_SeqFor 
CCTTCGTACGGACGACCTTC Tm = 58° C 112bp downstream first base of new DNA part 
 
 
113_pClone_mScarlet_SeqFor 

 
 
113_rClone_mScarlet_SeqRev

Bacterial Transformation for Bio113

2018-08-06T13:06:08Z

Macampbell:

== Transforming DNA after GGA Ligation ==

# Thaw the competent cells on ice for 6 minutes. Each tube contains 50 µL of ''E. coli'', JM109 cells.
# Add all 10 µL of your GGA ligation mixture to the thawed cells. Very gently mix the DNA and cells and return the cells to ice ASAP.
# Incubate on ice for 5 minutes.
# Add 60 µL SOC media with no antibiotic to your transformed cells. Spread cells onto LB plates containing ampicillin.
You're done already!!

Golden Gate Assembly for Bio113

2018-05-17T20:30:33Z

Macampbell:

==Starting with Boiled then Cooled Oligos==
# You should have already used the [http://gcat.davidson.edu/iGem10/index.html Oligator] to design your oligos for your dsDNA control element. 
# You should have already calculated how to dilute your boiled and cooled oligos from 5 µM to 40 nM. 

==Protocol Details for GGA==

# You will be given two tubes. One tube will be labeled "X" for eXperimental DNA, the other "N" for the negative control that contains plasmid only. Put your initials on the tubes and return the tubes to ice. These tubes will already contain 9 µL of the GGA Mixture.
# Add 1 µL '''diluted''' oligos cooled overnight to the tube labeled '''X''' for the experimental DNA.
# Add 1 µL '''water''' to the tube labeled '''N''' for the negative control"

'''GGA mixture contains:''' 
* 1 µL (40 nM) plasmid containing your receiving plasmid (pClone) 
* 6 µL dH2O 
* 1 µL 10X Promega Ligase Buffer 
* 0.5 µL Bsa I high fidelity (HFv2) restriction enzyme 
* 0.5 µL T4 DNA ligase from Promega 
* 9 µL final volume 

Turn on the thermocycler. Put '''both''' of your tubes into the machine. 
Program it for the following cylces: 
* 20 cycles of 37C for 1.5 minute and 16C for 1.5 minute 
* 22C holding temperature 
* heated lid on

This DNA ligation is ready for transformation. 

You can increase the number of cycles to 30 if you want to increase yield. However, we have gotten good success with as few as 5 cycles.

This protocols was developed at MWSU by Dr. Todd Eckdahl, and modified at Davidson College by Annie Wacker and Malcolm Campbell.

Mouse Charcot-Marie-Tooth type 2D RNAseq Project

2018-03-16T18:34:33Z

Macampbell: /* C. elegans nhr-25 experiments */

This is the page for Bio343 at Davidson College, spring 2018.

This group of 10 colleagues will investigate molecular causes for Charcot-Marie-Tooth type 2D disease as part of Davidson's [http://www.bio.davidson.edu/Courses/Bio343/LabMethods_2018.html Laboratory Methods in Genomics] class. They are collaborating with [https://www.jax.org/research-and-faculty/research-labs/the-burgess-lab Emily Spaulding and Rob Burgess] at Jackson Laboratory (JAX) in Bar Harbor Maine.

* [[Aiko Chamby]]
* [[Itzy Cuellar]]
* [[Vivienne Fang]]
* [[Stephanie Hautamaa]]
* [[Owen Koucky]]
* [[Jonah Mische]]
* [[Jenna Reed]]
* [[Ky Roland]]
* [[Malcolm Campbell]]
* [[Debbie Thurtle-Schmidt]]

Teams
* [[Aiko and Jenna]]
* [[Owen and Vivienne]]
* [[Stephanie and Ky]]
* [[Jonah and Itzy]]
* [[Debbie and Malcolm]]

== ''C. elegans'' ''nhr-25'' experiments ==
'''Ready to upload to your Galaxy site:''' 
our 1 = her 60 = gene set for mapping 
our 2 & 3 = her 51 = N2 #2 
our 4 & 5 = her 52 = ku217 #2 
our 6 & 7 = her 53 = nhr-25(RNAi) #3 
our 8 & 9 = her 54 = nhr-25(RNAi) #1 
our 10 & 11 = her 55 = nhr-25(RNAi) #2 
our 12 & 13 = her 56 = ku217 #3 
our 14 & 15 = her 57 = N2 #3 
our 16 & 17 = her 58 = N2 #1 
our 18 & 19 = her 59 = ku217 #1 

These values are ready for DESeq2 analysis.

Mouse Charcot-Marie-Tooth type 2D RNAseq Project

2018-03-15T14:52:50Z

Macampbell: /* C. elegans nhr-25 experiments */

This is the page for Bio343 at Davidson College, spring 2018.

This group of 10 colleagues will investigate molecular causes for Charcot-Marie-Tooth type 2D disease as part of Davidson's [http://www.bio.davidson.edu/Courses/Bio343/LabMethods_2018.html Laboratory Methods in Genomics] class. They are collaborating with [https://www.jax.org/research-and-faculty/research-labs/the-burgess-lab Emily Spaulding and Rob Burgess] at Jackson Laboratory (JAX) in Bar Harbor Maine.

* [[Aiko Chamby]]
* [[Itzy Cuellar]]
* [[Vivienne Fang]]
* [[Stephanie Hautamaa]]
* [[Owen Koucky]]
* [[Jonah Mische]]
* [[Jenna Reed]]
* [[Ky Roland]]
* [[Malcolm Campbell]]
* [[Debbie Thurtle-Schmidt]]

Teams
* [[Aiko and Jenna]]
* [[Owen and Vivienne]]
* [[Stephanie and Ky]]
* [[Jonah and Itzy]]
* [[Debbie and Malcolm]]

== ''C. elegans'' ''nhr-25'' experiments ==
'''Ready to upload to your Galaxy site:''' 
our 1 = her 60 = gene set for mapping
our 2 & 3 = her 51 = N2 #2 
our 4 & 5 = her 52 = ku217 #2 
our 6 & 7 = her 53 = nhr-25(RNAi) #3 
our 8 & 9 = her 54 = nhr-25(RNAi) #1 
our 10 & 11 = her 55 = nhr-25(RNAi) #2 
our 12 & 13 = her 56 = ku217 #3 
our 14 & 15 = her 57 = N2 #3 
our 16 & 17 = her 58 = N2 #1 
our 19 & 19 = her 59 = ku217 #1 

These values are ready for DESeq2 analysis.

Mouse Charcot-Marie-Tooth type 2D RNAseq Project

2018-03-15T11:57:36Z

Macampbell:

This is the page for Bio343 at Davidson College, spring 2018.

This group of 10 colleagues will investigate molecular causes for Charcot-Marie-Tooth type 2D disease as part of Davidson's [http://www.bio.davidson.edu/Courses/Bio343/LabMethods_2018.html Laboratory Methods in Genomics] class. They are collaborating with [https://www.jax.org/research-and-faculty/research-labs/the-burgess-lab Emily Spaulding and Rob Burgess] at Jackson Laboratory (JAX) in Bar Harbor Maine.

* [[Aiko Chamby]]
* [[Itzy Cuellar]]
* [[Vivienne Fang]]
* [[Stephanie Hautamaa]]
* [[Owen Koucky]]
* [[Jonah Mische]]
* [[Jenna Reed]]
* [[Ky Roland]]
* [[Malcolm Campbell]]
* [[Debbie Thurtle-Schmidt]]

Teams
* [[Aiko and Jenna]]
* [[Owen and Vivienne]]
* [[Stephanie and Ky]]
* [[Jonah and Itzy]]
* [[Debbie and Malcolm]]

== ''C. elegans'' ''nhr-25'' experiments ==
'''Ready to upload to your Galaxy site:''' 
78 and 77: ku217 1 
76 and 75: N2 1 
74 and 73: N2 3 
72 and 71: ku217 3 
70 and 69: nhr-25(rnai) 2 
68 and 67: nhr-25(rnai) 1 
66 and 65: nhr-25(rnai) 3 
64 and 63: ku217 2 
62 and 61: N2 - 2 

These values are ready for DESeq2 analysis.

Malcolm Campbell

2018-02-06T15:47:53Z

Macampbell:

'''Bio343 HTSeq Results''' 
25 and 24 = paired reads, Male mouse 2078, C201R 
23 and 22 = paired reads, Female mouse 2077, WT 
21 and 20 = paired reads, Male mouse 2076, WT 
19 and 18 = paired reads, Male mouse 2075, WT 
17 and 16 = paired reads, Male mouse 2074, WT 
15 and 14 = paired reads, Male mouse 2073, C201R 
13 and 12 = paired reads, Female mouse 2072, C201R 
11 and 10 = paired reads, Female mouse 2071, C201R 
9 and 8 = paired reads, Female mouse 2070, C201R 
7 and 6 = paired reads, Female mouse 2081, WT 
5 and 4 = paired reads, Female mouse 2080, WT 
3 and 2 = paired reads, Male mouse 2079, C201R

What does TopHat do?

2018-02-06T15:30:14Z

Macampbell:

'''TopHat''' aligns RNA-seq reads to mammalian-sized genomes (in our case, to the mm10 mouse genome build). Because we are using paired-end datasets, forward and reverse, we need to set a mean inner distance or the average distance in basepairs between reads.
Because we are mapping mRNA with no introns to full genomes, TopHat then uses its parent program '''Bowtie''' to analyze the alignment results to identify splice junctions between exons and correctly align the reads.
The mapped reads from TopHat saves as a '''BAM/SAM''' dataset.

What does TopHat do?

2018-02-06T15:22:23Z

Macampbell:

'''TopHat''' aligns RNA-seq reads to mammalian-sized genomes (in our case, to the mm10 mouse genome build). Because we are using paired-end datasets, forward and reverse, we need to set a mean inner distance or the average distance in basepairs between reads.
Because we are mapping mRNA with no introns to full genomes, TopHat then uses its parent program '''Bowtie''' to analyze the alignment results to identify splice junctions between exons and correctly aligns the reads.
The mapped reads from TopHat saves as a '''BAM/SAM''' dataset.

What does TopHat do?

2018-02-06T15:22:11Z

Macampbell:

'''TopHat''' aligns RNA-seq reads to mammalian-sized genomes (in our case, to the mm10 mouse genome build). Because we are using paired-end datasets, forward and reverse, we need to set a mean inner distance or the average distance in basepairs between reads.
Because we are mapping mRNA with no introns to full genomes, TopHat then uses its parent program '''Bowtie''' to analyze the alignment results to identify splice junctions between exons and correctly aligns the reads.
The mapped reads from TopHat saves as a BAM/SAM dataset.

How does it differ from HISAT2?

2018-02-06T15:19:41Z

Macampbell: Created page with "New and improved version of TopHat. It aligns RNAseq reads to the genome and deals with intron gaps."

New and improved version of TopHat. It aligns RNAseq reads to the genome and deals with intron gaps.

What does TopHat do?

2018-02-06T15:18:54Z

Macampbell:

What does TopHat do?

2018-02-06T15:15:48Z

Macampbell: Created page with "'''TopHat''' aligns RNA-seq reads to mammalian-sized genomes (in our case, to the mm10 mouse genome build). Because we are using paired-end datasets, forward and reverse, we n..."

'''TopHat''' aligns RNA-seq reads to mammalian-sized genomes (in our case, to the mm10 mouse genome build). Because we are using paired-end datasets, forward and reverse, we need to set a mean inner distance or the average distance in basepairs between reads.
TopHat then uses its parent program '''Bowtie''' to analyze the alignment results to identify splice junctions between exons.

What does Timmomatic do?

2018-02-06T15:10:41Z

Macampbell:

Trimmomatic is a program that remove adapters from FastQ data so that this tagging information is not included in future data analysis. 
Running FastQ data through trimmomatic increases the quality control scores.

[http://www.usadellab.org/cms/uploads/supplementary/Trimmomatic/TrimmomaticManual_V0.32.pdf Source of Trimmomatic Data]