GcatWiki - User contributions [en]

Electroporation - Campbell Old School Method

2016-06-23T21:58:26Z

Zashaver: Created page with " == Electroporation of JM109 or Similar Strain == '''Preparing Electrocompetent ''E. coli''''' (note: all glassware and solutions must be sterile) # Inoculate a 50 mL flask o..."

== Electroporation of JM109 or Similar Strain ==

'''Preparing Electrocompetent ''E. coli''''' (note: all glassware and solutions must be sterile)
# Inoculate a 50 mL flask of LB (low salt) with JM109 stock and grow overnight at 37˚C.
# First thing in the morning, put 5 mL of overnight JM109 into a 1 liter flask containing 500 mL of LB (low salt) and incubate at 37˚C and 400 rpm.
# Monitor growth and stop when cell density is between OD600 0.5 and 1.0.
# Centrifuge cells for 15 minutes at 4˚C and 4000g (5.1K rpm in Beckman rotor JA-14) in 250 mL bottles.
# Resuspend cells in 1 liter of distilled H20; make sure there are no clumps of cells. Pellet cells again.
# Resuspend cells in 500 mL fo distilled H20; make sure there are no clumps of cells. Pellet cells again.
# Resuspend cells in 250 mL of distilled H20; make sure there are no clumps of cells. Pellet cells again.
# Resuspend cells in 20 mL of distilled H20 and transfer to two 30 mL corex tubes; make sure there are no clumps of cells. Pellet cells again for 15 minutes at 4˚C and 4000g (5.7K rpm in Beckman rotor JA-20).
# Resuspend cells in 2.5 mL of 10% glycerol - filter sterilized; make sure there are no clumps of cells.
# Aliquot cells in 50 uL volumes into sterile 500 uL microfuge tubes and store at -70˚C.

----

'''Electroporation Procedure'''
# Thaw cells on ice for at least 7 minutes.
# Set the voltage for 1.3 kilovolts.
# Place disposable cuvette with 1 mm gap on ice for at least one minute.
# In the microfuge tube containing the comp. cells, mix the DNA to be transformed with the electrocompetent cells.
# Transfer cells and DNA into disposable cuvette using the sterile dropper provided. Flick the cuvette so that cells touch all four walls of the cuvette.
# Quickly dry the outside of the cuvette and put it into the electrode chamber.

'''WARNING''' If there is too much salt in this solution, it may arc and the cuvette may explode. Protect yourself appropriately.

# Press the red charge/pulse button. When it beeps, the pulse has fired.
# Very quickly, add 960 uL of fresh LB medium to the cells, mix the cells, transfer the cells to sterile 12 X 75 mm plastic tubes, and incubate at 37˚C at 225 rpm for 1 hour.
# Plate the cells on the appropriate agar plates and spread the cells properly.
# Incubate overnight at 37˚C.

Davidson Protocols

2016-06-23T21:57:06Z

Zashaver:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation - Campbell Old School Method]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]

Electroporation Old School Campbell

2016-06-23T21:55:51Z

Davidson Protocols

2016-06-23T21:37:53Z

Zashaver:

'''A. General Lab Information'''
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/reagents.html Common molecular reagents]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]
# [http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly Standard Assembly]
# [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick Ends]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ORIs.html '''Compatibility of Plasmids''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (short protocol)]
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]
# [[Pipet Tip Olympic Records]]

'''B. Gel Electrophoresis and Purification'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MN_gelpure.html Macherey-Nagel Gel Purification (improved 260/230 ratios)l]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Qiagen_gelpure.html Qiagen QIAquick Gel Purification]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/QIAQuick_recycle.html Qiagen QIAquick Column Regeneration Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/gelpure.html ElectroElute Gel Purification]

'''C. Digestion, Ligation, Transformation'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/digestion.html Digest DNA with restriction enzymes]
# [[Davidson Missouri W/Double Digest Guide| Double Digest Guide]]
#[https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes '''NEB Double Digestion Guide''']
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/SAP.html Shrimp Alkaline Phosphatase]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Tranformation_list.html Choices for Transformation: Heat Shock vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Promegacompcells.pdf Heat Shock Transformation] OR [http://www.bio.davidson.edu/courses/Molbio/Protocols/transformation.html Short version of Heat Shock]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[TSS Competent Cells|TSS Competent Cell Transformation]]
# [[Golden Gate Assembly protocol]] '''(GGA with BsaI)'''
# [[Golden_Gate_Assembly_Protocol_for_BsmB1]] '''(GGA with BsmBI)''' written by collaborators at MWSU
# [[GGA for BsmBI]] modified to do everything in one tube
# [https://goldengate.neb.com/editor NEB GGA Assembler]
# [[Electroporation_Transformation]] written by collaborators at MWSU
# [[Electroporation Old School Campbell]]

'''D. Minipreps'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/MiniPrep_list.html Choices for Mini-Preps: Promega vs. Zyppy]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/miniprepPrmega.html Promega miniprep]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_MiniPrep.html Zippy Miniprep]

'''E. Making New Parts and PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [[Annealing_Oligos_for_Cloning]] '''Calculate how to mix boiled oligos with 50 ng of receiving plasmid.'''
# [http://gcat.davidson.edu/SynBio16/ Cooled Oligos for GGA]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
#[[LongAmp PCR NEB]] '''How to set up LongAmp PCR'''
#[[Q5 PCR NEB]] '''How to set up Q5 High-Fidelity PCR'''
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[isolate genomic DNA from a single hair follicle]]
# [[Prepare PCR product for sequencing]] after clean and concentration procedure (for Bio113 lab use)
# [[Davidson Missouri W/Primer_dimer| Making dsDNA Using Primer Dimers]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Clean_Concentrate.html Clean and Concentrate DNA with spin column (after PCR, before digestion)]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to Screen for Successful Ligations]
# PCR Primers '''VF2 = tgccacctgacgtctaagaa''' '''VR primer = attaccgcctttgagtgagc'''
# [[Golden Gate Assembly protocol]]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [[TAS2R38 PCR amplification]]

'''F. Expression of Phenotypes'''
# [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106306/pdf/am002240.pdf Using degradation tags on proteins such as GFP]
# [[Genomic Insertion Protocol|Genomic Insertion Protocol]]
# '''M9CA media''' (J864-100G from Amresco) + '''2mM MgSO4''' (2mL/L of 1 M MgSO4) + '''0.1 mM CaCl2''' (0.1 mL/L 1 M CaCl2) and optional 0.2% glucose (10 mL/L 20% stock solution).
# When inducing with anhydrotetracycline (aTc), the stock solution from Clonetech (#631310) is '''2 mg/mL in 50% EtOH''', which is a 10,000X stock solution. '''Working concentration should 200 ng/mL.'''
# When inducing with IPTG, use '''3 µL of stock''' (0.2 g/mL = 20% w/v) '''to every 1 mL''' of LB or other liquid.
# When inducing with Arabinose, use "2 µL of stock" (10% w/v L-Arabinose) "to every 1 mL" of LB or other liquid.
# When inducing with 3OC6 (HSL), use a '''2000 fold dilution of a 10 mg/mL stock solution'''. We have dissolved in EtOH which is not the best - degrades with time. Keep this cold.
#When growing '''thyA- cells''', add 50 µg/mL thymine to your media. Our thyA- cells have a KanR resistant plasmid that caused the mutation. So it is best to always use kanamycin to maintain the thyA- genotype. Thymine stock solutions (4mg/mL) can be autoclaved.
# [http://partsregistry.org/AHL List of auto-inducers and their catalog numbers]
# [[Synergy Machine Protocol]]

'''G. Golden Gate Shuffling'''
# [[Media:DNAShuffling.docx]] 

'''H. Computer Tools We Use'''
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://genedesign.thruhere.net/gd/ Gene Design (Boeke Lab at JHU)]
# [http://gcat.davidson.edu/iGEM07/genesplitter.html Gene Splitting Web Site]
# [http://gcat.davidson.edu/iGEM08/bbprimer.html PCR Primers w/ BioBricks]
# [http://www.promega.com/a/apps/biomath/index.html?calc=tm Promega Tm Calculator]
# [https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator NEB Phusion Tm Calculator]
# [http://gcat.davidson.edu/iGem10/index.html Oligator making dsDNA from oligos]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://gcat.davidson.edu/SynBio12/successorater.html How many clones should I screen?]
# [http://gcat.davidson.edu/IGEM06/oligo.html Lance-olator Oligos for dsDNA assembly] old version, we recommend Oligator now
# [http://gcat.davidson.edu/GCATalog Access the GCAT-alog of Davidson and MWSU DNA Freezer Stocks]
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [[Sequencing at Agencourt| Sequencing at Agencourt Bioscience]]
# [[Davidson Missouri W/CUGI_Seuqencing| Sequencing at CUGI]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]
# [http://72.22.219.205/sequence VeriPart for DNA sequences of Registry Parts]
# [http://gcat.davidson.edu/igem10/opt/opt_index.html The Optimus for optimizing codons]
# [http://gcat.davidson.edu/iGEM11/Optimizer/WiserOptimizer Wiser Optimizer] Not working right now
# [http://gcat.davidson.edu/SynBio13/GGAJET/ GGAJET Junction Deign Tool]
# [http://gcat.davidson.edu/SynBio13/primer/ GGA Primer Pairs Designed for You]

'''I. Making Selective Media'''
#[[Selecting for Tetracycline Sensitive E. coli]]

==Bio113 Lab Protocols==
'''General Lab Resources''' 
# [http://www.bio.davidson.edu/courses/molbio/labnotebook.html How to Keep a Lab Notebook]
# [http://www.opendoar.org/countrylist.php?cContinent=North%20America#United%20States Open Access Libraries]

'''Discovering New Promoters with Synthetic Biology''' 
# [http://partsregistry.org/Part:BBa_J100091 '''pClone Basic''' receiving plasmid for GGA]
# [http://parts.igem.org/Part:BBa_J119137 '''pClone Green''' receiving plasmid for GGA]
# [http://partsregistry.org/Part:BBa_J100091 understanding GGA and removal of transcriptional terminator (TT)]
# [[Golden Gate Assembly for Bio113]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/anneal_oligos.html Building dsDNA with Oligos]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://gcat.davidson.edu/SynBio12/ The Loligator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ligation.html Ligation Protocol]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/Zippy_Transformation.html Zippy Transformation]
# [[Synergy Machine Protocol]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/ColonyPCR_Screening.html Colony PCR to verify successful GGA]
# [http://gcat.davidson.edu/iGEM08/gelwebsite/gelwebsite.html Optimize your Gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pourgel.html Pouring an agarose gel]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/molwt.html Calculate MWs]
# [http://products.invitrogen.com/ivgn/product/10787018 1kb Plus MW markers]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/clean_short.html Ethanol Precipitate to clean DNA (alternative protocol to spin column)]
# [http://partsregistry.org/Main_Page Registry of Standardized DNA Parts hosted by iGEM]
# [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters hosted at Davidson College]

'''TAS2R38 Allele Testing''' 
# [[isolate genomic DNA from a single hair follicle]]
# [[TAS2R38 PCR amplification]]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html Setting up PCR mixtures]
# [http://www.promega.com/biomath/calc11.htm Promega Tm Calculator]
# [http://www.bio.davidson.edu/courses/Molbio/Protocols/magnesium.html PCR and Mg2+ concentration]
# [[Prepare PCR product for sequencing]] (for Bio113 lab use)
# [[Sequencing at MWG Operon| Sequencing at MWG Operon]]
# [http://gcat.davidson.edu/GcatWiki/images/3/3b/Ape_protocol.pdf Analyzing Sequences with ApE]
# [[Using Apes (A Plasmid Editor)]]

'''Evolution of Antibiotic Resistance''' 
# [[glycerolstocks How to Make Glycerol Stocks of Bacteria]]