https://gcat.davidson.edu/GcatWiki/index.php?action=history&feed=atom&title=IPCR 2026-04-22T22:10:22Z Revision history for this page on the wiki MediaWiki 1.28.2 https://gcat.davidson.edu/GcatWiki/index.php?title=IPCR&diff=16423&oldid=prev 2013-05-20T19:49:27Z

<p></p> <table class="diff diff-contentalign-left" data-mw="interface"> <col class='diff-marker' /> <col class='diff-content' /> <col class='diff-marker' /> <col class='diff-content' /> <tr style='vertical-align: top;' lang='en'> <td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td> <td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 19:49, 20 May 2013</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l2" >Line 2:</td> <td colspan="2" class="diff-lineno">Line 2:</td></tr> <tr><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr> <tr><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>1. Conduct regular PCR of insert/part B (eg. AdhE from J100107) using Prefix_For and Suffix_Rev primers</div></td><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>1. Conduct regular PCR of insert/part B (eg. AdhE from J100107) using Prefix_For and Suffix_Rev primers</div></td></tr> <tr><td colspan="2">&#160;</td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>2. Purify PCR product and digest with XbaI + PstI</div></td><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>2. Purify PCR product and digest with XbaI + PstI</div></td></tr> <tr><td colspan="2">&#160;</td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>3. Heat inactivate restriction enzymes at 80 C for 15 minutes</div></td><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>3. Heat inactivate restriction enzymes at 80 C for 15 minutes</div></td></tr> <tr><td colspan="2">&#160;</td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>4. Conduct Inverted PCR of vector with part A (eg. promoter + C.dog in S05022) using Spe_Rev and Pst_For primers</div></td><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>4. Conduct Inverted PCR of vector with part A (eg. promoter + C.dog in S05022) using Spe_Rev and Pst_For primers</div></td></tr> <tr><td colspan="2">&#160;</td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>5. Purify PCR product and digest with SpeI + PstI</div></td><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>5. Purify PCR product and digest with SpeI + PstI</div></td></tr> <tr><td colspan="2">&#160;</td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>6. Heat inactivate restriction enzymes at 80 C for 15 minutes</div></td><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>6. Heat inactivate restriction enzymes at 80 C for 15 minutes</div></td></tr> <tr><td colspan="2">&#160;</td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>7. Ligate the two PCR products and transform bacteria</div></td><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>7. Ligate the two PCR products and transform bacteria</div></td></tr> <tr><td colspan="2">&#160;</td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr> <tr><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Prefix</div></td><td class='diff-marker'>&#160;</td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Prefix</div></td></tr> </table>

Eckdahl https://gcat.davidson.edu/GcatWiki/index.php?title=IPCR&diff=16413&oldid=prev 2013-05-20T19:32:13Z

<p>Inverted PCR/Biobrick Cloning</p> <p><b>New page</b></p><div>INVERTED PCR/BIOBRICK CLONING<br /> <br /> 1. Conduct regular PCR of insert/part B (eg. AdhE from J100107) using Prefix_For and Suffix_Rev primers<br /> 2. Purify PCR product and digest with XbaI + PstI<br /> 3. Heat inactivate restriction enzymes at 80 C for 15 minutes<br /> 4. Conduct Inverted PCR of vector with part A (eg. promoter + C.dog in S05022) using Spe_Rev and Pst_For primers<br /> 5. Purify PCR product and digest with SpeI + PstI<br /> 6. Heat inactivate restriction enzymes at 80 C for 15 minutes<br /> 7. Ligate the two PCR products and transform bacteria<br /> <br /> Prefix<br /> GAATTCGCGGCCGCTTCTAGAG<br /> CTTAAGCGCCGGCGAAGATCTC<br /> <br /> Suffix<br /> TACTAGTAGCGGCCGCTGCAG<br /> ATGATCATCGCCGGCGACGTC<br /> <br /> <br /> <br /> Prefix_For; TGCATGAATTCGCGG<br /> <br /> Suffix_Rev; TGCATCTGCAGCGGC<br /> <br /> Spe_Rev; GCATCCGCTACTAGTA<br /> <br /> Pst_For; TGCATGCCGCTGCAG</div>

Eckdahl