JP Feb 18 16 - Revision history

Jupreziosi at 19:36, 18 February 2016

2016-02-18T19:36:57Z

2016-02-18T19:35:58Z

2016-02-18T19:32:05Z

2016-02-18T19:24:55Z

2016-02-18T19:24:49Z

2016-02-18T18:48:30Z

2016-02-18T18:48:05Z

2016-02-18T18:39:54Z

Created page with "Julia Preziosi"

New page

[[Julia Preziosi]]

← Older revision		Revision as of 19:36, 18 February 2016
Line 39:		Line 39:


−	There are 3,521 proteins of unknown function. It takes 13 minutes to run 10.	+	There are 3,521 proteins of unknown function. It takes 10 minutes to run 10. It will take 59 hours to run all these.

← Older revision		Revision as of 19:35, 18 February 2016
Line 37:		Line 37:

	Now if we run Todd's sequence for "Protein...2387" through Blast2Go, we can get GO terms for this unknown (now known) protein, and attribute those terms to the proteins in our data.		Now if we run Todd's sequence for "Protein...2387" through Blast2Go, we can get GO terms for this unknown (now known) protein, and attribute those terms to the proteins in our data.
		+
		+
		+	There are 3,521 proteins of unknown function. It takes 13 minutes to run 10.

← Older revision		Revision as of 19:32, 18 February 2016
Line 21:		Line 21:

	We believe this method will yield new results as Todd did his genome a while ago, and new information may have become available since then.		We believe this method will yield new results as Todd did his genome a while ago, and new information may have become available since then.
		+
		+
		+	For example, Todd's data says
		+
		+	">Contig263_Protein_of_unknown_function
		+	ATGATGATAATAACGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATG
		+	ATGATAACAACAATAATACACATTAAAAGTATCTCAAACCGACAGAGACATAAGGGGATG
		+	GGAAATCTCCTTAGACTGCTCTTTGAGATGAACCTTGGTATAGACTTGGTGGACTTTGGA
		+	CTTTTCTCCAGCTCTCTGGATTATCTCAAGTGGCTTACCTCAAGATTGCAGATCTTGTCA
		+	TGA"
		+
		+	We gave this a number and ran our data through Todd's data set.
		+	(Our excel file (not the same protein))
		+	Contig1001_Protein_of_unknown_function_2387 Contig1001_Protein_of_unknown_function_2387 1077 1007.87 0 0 0
		+
		+	Now if we run Todd's sequence for "Protein...2387" through Blast2Go, we can get GO terms for this unknown (now known) protein, and attribute those terms to the proteins in our data.

← Older revision		Revision as of 19:24, 18 February 2016
Line 12:		Line 12:

	* Transcription factors are not usually highly transcribed - small value; we look for things that are transcribed after feeding.		* Transcription factors are not usually highly transcribed - small value; we look for things that are transcribed after feeding.
		+

	GAMEPLAN:		GAMEPLAN:

← Older revision		Revision as of 19:24, 18 February 2016
Line 12:		Line 12:

	* Transcription factors are not usually highly transcribed - small value; we look for things that are transcribed after feeding.		* Transcription factors are not usually highly transcribed - small value; we look for things that are transcribed after feeding.
		+
		+	GAMEPLAN:
		+
		+	Our snake 1-6 data (excel files) were mapped to Todd's python genome (text file) to associate sequences with Gene names.
		+	If we can Blast2GO Todd's "protein of unknown function" sequences, we can get gene names and GO terms for these unknown proteins.
		+	As they're labeled, we can match the label (ex "...unknown_function_20") to our output with the same label, and frequencies, and find the GO terms for these.
		+
		+	We believe this method will yield new results as Todd did his genome a while ago, and new information may have become available since then.

← Older revision		Revision as of 18:48, 18 February 2016
Line 2:		Line 2:

	Drs. C & H findings:		Drs. C & H findings:
		+
		+	http://www.bio.davidson.edu/courses/Bio343/2016/Thursday_18Feb_2016.txt

	Euclidean distance correlations for clustering. Changed from z scale to absolute value.		Euclidean distance correlations for clustering. Changed from z scale to absolute value.

← Older revision		Revision as of 18:48, 18 February 2016
Line 1:		Line 1:
	[[Julia Preziosi]]		[[Julia Preziosi]]
		+
		+	Drs. C & H findings:
		+
		+	Euclidean distance correlations for clustering. Changed from z scale to absolute value.
		+
		+	Then looked at correlation (1 - correlation), clustering was different, dendrogram was different.
		+
		+	They are now working on supervised clustering; make csv to export gene names based on clustering. Given a seed gene, output correlated genes.
		+
		+	* Transcription factors are not usually highly transcribed - small value; we look for things that are transcribed after feeding.