PCR for Bio113 - Revision history

Macampbell: /* PCR Verification of Successful GGA */

2022-09-15T12:02:12Z

‎PCR Verification of Successful GGA

2018-09-25T19:47:33Z

2018-09-24T22:43:49Z

‎PCR Verification of Successful GGA

2018-09-24T22:43:32Z

2018-09-17T22:27:40Z

2018-09-16T15:15:45Z

‎PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega)

2018-09-16T15:12:27Z

‎PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega)

2018-09-16T15:09:52Z

‎PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega)

2018-09-16T15:08:59Z

‎PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega)

2018-02-06T18:28:34Z

‎PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega)

@@ Line 12: / Line 12: @@
 # 95° C for 30 seconds
 # 54° C for 30 seconds
-#72° C for 1 minute
+#72° C for 30 seconds
 # return to step #2 29 more times
 # store at 22° C indefinitely
 * When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.
 == PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==

@@ Line 20: / Line 20: @@
-== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) == <#results>
+== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==
 '''J119137; pClone Red  (remove 70 bp, insert <61 bp)'''<br>
 _pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C<br>

← Older revision		Revision as of 22:43, 24 September 2018
Line 17:		Line 17:

	* When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.		* When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.
		+
		+

	== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) == <#results>		== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) == <#results>

@@ Line 18: / Line 18: @@
 * When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.
-== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==
+== PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) == <#results>
 '''J119137; pClone Red  (remove 70 bp, insert <61 bp)'''<br>
 _pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C<br>

@@ Line 16: / Line 16: @@
 # store at 22° C indefinitely
-* When the PCR is completed, they will be stored until next week when you will load 10 µL of each into the wells of a 2% agarose gel.
+* When the PCR is completed, they will be stored until next week when you will load 20 µL of each into the wells of a 2% agarose gel.
 == PCR Primers to Confirm Successful GGA (Using Green GoTac DNA polymerase from Promega) ==

@@ Line 52: / Line 52: @@
 <br>
 '''J100204; actClone Red (remove 119 bp, insert <61 bp)'''<br>
 _actClone_confirm_For; ACAGCTCTTCGCCTTTAC Tm = 62 C<br>

@@ Line 33: / Line 33: @@
 <br>
 <br>
-'''J119384; rClone Red  (remove 815 bp, insert <61 bp)'''<br>
+'''J119384; rClone Red  (remove 819 bp, insert <61 bp)'''<br>
 _rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C<br>
 _rClone_confirm_Rev; TCGGAGGAAGCCATCTC Tm = 63 C<br>

@@ Line 40: / Line 40: @@
 <br>
 <br>
-'''J119384; rClone Red  (remove 819 bp, insert <61 bp)'''<br>
+'''J100419; rClone mScarlet  (remove 819 bp, insert <61 bp)'''<br>
 _rClone_confirm_For; CTCGTAATTTATGTGGACGAC Tm = 61 C<br>
 _mScarlet_Rev; CACTTTGAAGCGCATGAATTC Tm = 55 C<br>
-bp amplicon for J119384<br>
+bp amplicon for J100419<br>
 bp amplicon for 15 bp insertion <br>
 <br>

@@ Line 21: / Line 21: @@
 '''J119137; pClone Red  (remove 70 bp, insert <61 bp)'''<br>
-_pClone_confirm_For; CTCCTCTTTAATTACTAGACGAC Tm = 60 C<br>
+_pClone_confirm_For (Same as 113_pClone_SeqFor); CTAATTCAACAAGAATTGGGAC Tm = 60 C<br>
 _pClone_confirm_Rev; AAGTGAACTTGGGCCC Tm = 62 C<br>
 bp amplicon for J119137<br>