Difference between revisions of "Blasting Spacers for Our Genome"
From GcatWiki
Karicheson (talk | contribs) (→Blasting Spacers) |
Karicheson (talk | contribs) (→Blasting Spacers) |
||
| Line 35: | Line 35: | ||
NOTE: lots of hits from each organism- indicates that multiple parts have been incorporated into our species' spacers. . . interesting to study what genes have been inserted | NOTE: lots of hits from each organism- indicates that multiple parts have been incorporated into our species' spacers. . . interesting to study what genes have been inserted | ||
| + | |||
| + | Spacer Six: TGCGAGTGTTGCGGGGAACCGACTCGGGTAGGCCAG | ||
| + | |||
| + | [[Image:spacerSix.jpg]] | ||
Revision as of 17:16, 5 November 2009
Blasting Spacers
CRISPR one results from CRISPR finder are shown below. I blasted all of the spacers using the nr/nt database and the results are shown below.
Error creating thumbnail: Unable to save thumbnail to destination
Spacer One: TGCGTCGTCCGGTGGCCGTCAATAAATGTCGCAAGGG
Error creating thumbnail: Unable to save thumbnail to destination
Matches by chance!
Spacer Two: TCCTACGACCTCGTCGGCGTCAACGGCTGGCCCGA
Error creating thumbnail: Unable to save thumbnail to destination
Spacer Three: CACCCTACAACAGGTGAAATCTACCAGACAAAAGA
Error creating thumbnail: Unable to save thumbnail to destination
Spacer Four: TCACCCAAGCGCAAGCAACAGCTGATCGAGGACCTG
Error creating thumbnail: Unable to save thumbnail to destination
Error creating thumbnail: Unable to save thumbnail to destination
Spacer Five: GCGACGGCGGCCAGTTCCGCGAGGGCGGGAAGGTCC
Error creating thumbnail: Unable to save thumbnail to destination
This image is only part of it. . .
Error creating thumbnail: Unable to save thumbnail to destination
NOTE: lots of hits from each organism- indicates that multiple parts have been incorporated into our species' spacers. . . interesting to study what genes have been inserted
Spacer Six: TGCGAGTGTTGCGGGGAACCGACTCGGGTAGGCCAG
Error creating thumbnail: Unable to save thumbnail to destination