|
|
| (10 intermediate revisions by 2 users not shown) |
| Line 1: |
Line 1: |
| − | == CRISPRs from JGI: ==
| + | [[Direct Repeats]] |
| | | | |
| − | ID: Halomicrobium mukohataei DSM 12286, ''unfinished sequence'': NZ_ABTY01000001<br>
| + | [[Blasting Spacers for Our Genome]] |
| − | Start Potision: 1000310<br>
| |
| − | End Position: 1002443<br>
| |
| − | CRISPR length: 2133
| |
| | | | |
| | + | [[Spacers for Other Species]] |
| | | | |
| − | ID: Halomicrobium mukohataei DSM 12286, ''unfinished sequenc''e: NZ_ABTY01000002<br>
| + | [[Blasting Spacers for Haloferax mediterranei]] |
| − | Start Position: 201627 <br>
| |
| − | End Position: 204293<br>
| |
| − | CRISPR length: 2666
| |
| | | | |
| − | == Found on CRISPRFInder: ==
| + | [[CRISPR-associated Proteins]] |
| − | | |
| − | '''Two confirmed CRISPRs:'''
| |
| − | | |
| − | CRISPR id : tmp_1_Crispr_12<br>
| |
| − | START crispr position : 2723382 <br>
| |
| − | END crispr position : 2725579 <br>
| |
| − | Crispr length : 2197 <br>
| |
| − | DR consensus : GTTTCAGACGGACCCTTGTGGGATTGAAGC DR length : 30<br>
| |
| − | Number of spacers : 33<br>
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_2_Crispr_1<br>
| |
| − | START crispr position : 31920<br>
| |
| − | END crispr position : 34849<br>
| |
| − | Crispr length : 2929<br>
| |
| − | DR consensus : GCTTCAATCCCACAAGGGTCCGTCTGAAAC DR length : 30<br>
| |
| − | Number of spacers : 44<br>
| |
| − | | |
| − | | |
| − | | |
| − | '''11 Questionable CRISPRs:'''
| |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_1<br>
| |
| − | START crispr position : 451036<br>
| |
| − | END crispr position : 451146<br>
| |
| − | Crispr length : 110<br>
| |
| − | DR consensus : CCTCGACCGTGTCGGCCGCGCCGCC DR length : 25<br>
| |
| − | Number of spacers : 1<br>
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_2<br>
| |
| − | START crispr position : 451266<br>
| |
| − | END crispr position : 451422<br>
| |
| − | Crispr length : 156<br>
| |
| − | DR consensus : CCTCGACCGTGTCGGCCGCGCCGCC DR length : 25<br>
| |
| − | Number of spacers : 2<br>
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_3<br>
| |
| − | START crispr position : 723910<br>
| |
| − | END crispr position : 724040<br>
| |
| − | Crispr length : 130<br>
| |
| − | DR consensus : CCGCCCGAACACGCCGGTCCCGACCACGAGAACGAGAC DR length : 38<br>
| |
| − | Number of spacers : 1<br>
| |
| − | | |
| − | | |
| − | RISPR id : tmp_1_PossibleCrispr_4<br>
| |
| − | START crispr position : 775514<br>
| |
| − | END crispr position : 775595<br>
| |
| − | Crispr length : 81<br>
| |
| − | DR consensus : TGATTCGCCCAGCGAGCGCGTTCGTG DR length : 26<br>
| |
| − | Number of spacers : 1<br>
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_5<br>
| |
| − | START crispr position : 1587713<br>
| |
| − | END crispr position : 1587871
| |
| − | Crispr length : 158<br>
| |
| − | DR consensus : TCGAAGGGGCTGTCGCTGTCGGTG DR length : 24<br>
| |
| − | Number of spacers : 2<br>
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_6<br>
| |
| − | START crispr position : 1635784<br>
| |
| − | END crispr position : 1635940<br>
| |
| − | Crispr length : 156<br>
| |
| − | DR consensus : CCTCGACCGTGTCGGCCGCGCCGCC DR length : 25<br>
| |
| − | Number of spacers : 2<br>
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_7<br>
| |
| − | START crispr position : 1733154<br>
| |
| − | END crispr position : 1733268<br>
| |
| − | Crispr length : 114<br>
| |
| − | DR consensus : GTTCGCCGGACCGTGTGGGTGTCG DR length : 24<br>
| |
| − | Number of spacers : 2<br>
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_8<br>
| |
| − | START crispr position : 2087618<br>
| |
| − | END crispr position : 2087725<br>
| |
| − | Crispr length : 107<br>
| |
| − | DR consensus : AGCGCCGGGCGACGACGGGCCAGC DR length : 24<br>
| |
| − | Number of spacers : 1<br>
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_9<br>
| |
| − | START crispr position : 2127953<br>
| |
| − | END crispr position : 2128039<br>
| |
| − | Crispr length : 86<br>
| |
| − | DR consensus : CGCTCGCTTCGAGGGCCGACACTCGCT DR length : 27<br>
| |
| − | Number of spacers : 1<br>
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_10<br>
| |
| − | START crispr position : 2206888<br>
| |
| − | END crispr position : 2206968<br>
| |
| − | Crispr length : 80<br>
| |
| − | DR consensus : CAGTCCAGTGAGGCGTCTCGTCGTCG DR length : 26<br>
| |
| − | Number of spacers : 1<br>
| |
| − | | |
| − | | |
| − | CRISPR id : tmp_1_PossibleCrispr_11<br>
| |
| − | START crispr position : 2293949<br>
| |
| − | END crispr position : 2294199<br>
| |
| − | Crispr length : 250<br>
| |
| − | DR consensus : CGTTCGCAGCAAAACGGGCCGGAAGGGATTTGAACC DR length : 36<br>
| |
| − | Number of spacers : 2<br>
| |
| − | | |
| − | == BLASTing CRISPRs ==
| |
| − | | |
| − | I Blasted the two confirmed direct repeat (DR) sequences found by CRISPR Finder in order to see if these repeats are found in any other archaea.
| |
| − | | |
| − | DR sequences: 1. GTTTCAGACGGACCCTTGTGGGATTGAAGC 2. GCTTCAATCCCACAAGGGTCCGTCTGAAAC
| |
| − | | |
| − | For both DRs 1 and 2 had top hits with the three archaeal species with which we commonly compare H. mukohataei:
| |
| − | # Haloarcula marismortui
| |
| − | # Halorhabdus utahensis
| |
| − | # Natronomonas pharaonis
| |
| − | | |
| − | [[Image:CRISPRCompare102909.png|600px|thumb|center]] | |
