|
|
(8 intermediate revisions by 2 users not shown) |
Line 1: |
Line 1: |
− | == CRISPRs from JGI: ==
| + | [[Direct Repeats]] |
| | | |
− | ID: Halomicrobium mukohataei DSM 12286, ''unfinished sequence'': NZ_ABTY01000001<br>
| + | [[Blasting Spacers for Our Genome]] |
− | Start Potision: 1000310<br>
| |
− | End Position: 1002443<br>
| |
− | CRISPR length: 2133
| |
| | | |
| + | [[Spacers for Other Species]] |
| | | |
− | ID: Halomicrobium mukohataei DSM 12286, ''unfinished sequenc''e: NZ_ABTY01000002<br>
| + | [[Blasting Spacers for Haloferax mediterranei]] |
− | Start Position: 201627 <br>
| |
− | End Position: 204293<br>
| |
− | CRISPR length: 2666
| |
| | | |
− | | + | [[CRISPR-associated Proteins]] |
− | == Found on CRISPRFInder: ==
| |
− | | |
− | '''Two confirmed CRISPRs:'''
| |
− | | |
− | CRISPR id : tmp_1_Crispr_12<br>
| |
− | START crispr position : 2723382 <br>
| |
− | END crispr position : 2725579 <br>
| |
− | Crispr length : 2197 <br>
| |
− | DR consensus : GTTTCAGACGGACCCTTGTGGGATTGAAGC DR length : 30<br>
| |
− | Number of spacers : 33<br>
| |
− | | |
− | | |
− | CRISPR id : tmp_2_Crispr_1<br> | |
− | START crispr position : 31920<br>
| |
− | END crispr position : 34849<br>
| |
− | Crispr length : 2929<br>
| |
− | DR consensus : GCTTCAATCCCACAAGGGTCCGTCTGAAAC DR length : 30<br>
| |
− | Number of spacers : 44<br>
| |
− | | |
− | These are likely the same CRISPRs that were found by JGI. It's difficult to say with absolute certainty since the start and end coordinates were labeled using the draft sequence but JGI now uses the finished sequence for whole-genome searches.
| |
− | | |
− | '''11 Questionable CRISPRs:'''
| |
− | | |
− | CRISPR id : tmp_1_PossibleCrispr_1<br>
| |
− | START crispr position : 451036<br>
| |
− | END crispr position : 451146<br>
| |
− | Crispr length : 110<br>
| |
− | DR consensus : CCTCGACCGTGTCGGCCGCGCCGCC DR length : 25<br>
| |
− | Number of spacers : 1<br>
| |
− | | |
− | | |
− | CRISPR id : tmp_1_PossibleCrispr_2<br>
| |
− | START crispr position : 451266<br>
| |
− | END crispr position : 451422<br>
| |
− | Crispr length : 156<br>
| |
− | DR consensus : CCTCGACCGTGTCGGCCGCGCCGCC DR length : 25<br>
| |
− | Number of spacers : 2<br>
| |
− | | |
− | | |
− | CRISPR id : tmp_1_PossibleCrispr_3<br>
| |
− | START crispr position : 723910<br>
| |
− | END crispr position : 724040<br>
| |
− | Crispr length : 130<br>
| |
− | DR consensus : CCGCCCGAACACGCCGGTCCCGACCACGAGAACGAGAC DR length : 38<br>
| |
− | Number of spacers : 1<br>
| |
− | | |
− | | |
− | RISPR id : tmp_1_PossibleCrispr_4<br>
| |
− | START crispr position : 775514<br>
| |
− | END crispr position : 775595<br>
| |
− | Crispr length : 81<br>
| |
− | DR consensus : TGATTCGCCCAGCGAGCGCGTTCGTG DR length : 26<br>
| |
− | Number of spacers : 1<br>
| |
− | | |
− | | |
− | CRISPR id : tmp_1_PossibleCrispr_5<br>
| |
− | START crispr position : 1587713<br>
| |
− | END crispr position : 1587871
| |
− | Crispr length : 158<br>
| |
− | DR consensus : TCGAAGGGGCTGTCGCTGTCGGTG DR length : 24<br>
| |
− | Number of spacers : 2<br>
| |
− | | |
− | | |
− | CRISPR id : tmp_1_PossibleCrispr_6<br>
| |
− | START crispr position : 1635784<br>
| |
− | END crispr position : 1635940<br>
| |
− | Crispr length : 156<br>
| |
− | DR consensus : CCTCGACCGTGTCGGCCGCGCCGCC DR length : 25<br>
| |
− | Number of spacers : 2<br>
| |
− | | |
− | | |
− | CRISPR id : tmp_1_PossibleCrispr_7<br>
| |
− | START crispr position : 1733154<br>
| |
− | END crispr position : 1733268<br>
| |
− | Crispr length : 114<br>
| |
− | DR consensus : GTTCGCCGGACCGTGTGGGTGTCG DR length : 24<br>
| |
− | Number of spacers : 2<br>
| |
− | | |
− | | |
− | CRISPR id : tmp_1_PossibleCrispr_8<br>
| |
− | START crispr position : 2087618<br>
| |
− | END crispr position : 2087725<br>
| |
− | Crispr length : 107<br>
| |
− | DR consensus : AGCGCCGGGCGACGACGGGCCAGC DR length : 24<br>
| |
− | Number of spacers : 1<br>
| |
− | | |
− | | |
− | CRISPR id : tmp_1_PossibleCrispr_9<br>
| |
− | START crispr position : 2127953<br>
| |
− | END crispr position : 2128039<br>
| |
− | Crispr length : 86<br>
| |
− | DR consensus : CGCTCGCTTCGAGGGCCGACACTCGCT DR length : 27<br>
| |
− | Number of spacers : 1<br>
| |
− | | |
− | | |
− | CRISPR id : tmp_1_PossibleCrispr_10<br>
| |
− | START crispr position : 2206888<br>
| |
− | END crispr position : 2206968<br>
| |
− | Crispr length : 80<br>
| |
− | DR consensus : CAGTCCAGTGAGGCGTCTCGTCGTCG DR length : 26<br>
| |
− | Number of spacers : 1<br>
| |
− | | |
− | | |
− | CRISPR id : tmp_1_PossibleCrispr_11<br>
| |
− | START crispr position : 2293949<br>
| |
− | END crispr position : 2294199<br>
| |
− | Crispr length : 250<br>
| |
− | DR consensus : CGTTCGCAGCAAAACGGGCCGGAAGGGATTTGAACC DR length : 36<br>
| |
− | Number of spacers : 2<br>
| |
− | | |
− | == BLASTing CRISPRs ==
| |
− | | |
− | I Blasted the two confirmed direct repeat (DR) sequences found by CRISPR Finder in order to see if these repeats are found in any other archaea.
| |
− | | |
− | DR sequences: 1. GTTTCAGACGGACCCTTGTGGGATTGAAGC 2. GCTTCAATCCCACAAGGGTCCGTCTGAAAC
| |
− | | |
− | For both DRs 1 and 2 had top hits with the three archaeal species with which we commonly compare H. mukohataei:
| |
− | # Haloarcula marismortui
| |
− | # Halorhabdus utahensis
| |
− | # Natronomonas pharaonis
| |
− | | |
− | [[Image:CRISPRCompare102909.png|600px|thumb|center]]
| |