Difference between revisions of "Aaron D"

From GcatWiki
Jump to: navigation, search
Line 1: Line 1:
 
'''Blueberry coat color'''
 
'''Blueberry coat color'''
  
−
Evidence presented by Albrigo et al. ([[Media:Albrigo_color.pdf]]) points to "waxy bloom" contributing highly to coat color in highbush blueberries. Other possible variables (such as pH and anthocyanins) were implicated in juice color but showed little to no influence on coat color. Therefore, genes involved in wax production and secretion were the focus of my research.
+
Evidence presented by Albrigo et al. ([[Media:Albrigo_color.pdf]]) points to "waxy bloom" contributing highly to coat color in highbush blueberries. Other possible variables (such as pH and anthocyanins) were implicated in juice color but showed little to no influence on coat color. Also, a direct connection between beta-diketone presence and coat color was made by Sapers et al. ([[Media:Sapers_color.pdf]]). Berries with more beta-diketones displayed a higher degree of blue hue. Therefore, genes involved in wax production and secretion and beta-diketone synthesis were the focus of my research.
  
−
A direct connection between beta-diketone presence and coat color was made by Sapers et al. ([[Media:Sapers_color.pdf]]). Berries with more beta-diketones displayed a higher degree of blue hue. Multiple sources also mentioned a connection between beta-ketones and blue hue on blueberries.
 
  
−
Samuels et al. ([[Media:Samuels_color.pdf]]) provided a thorough analysis of wax production in ''Arabidopsis''. Additionally, pathways presented within the paper indicated genes involved in ketone production. Based on the relatedness of two genera, I searched for orthologs of ''Arabidopsis'' in the ''Vaccinium'' genome. Considerations taken when choosing genes included pathway position, ???
+
Samuels et al. ([[Media:Samuels_color.pdf]]) provided a thorough analysis of wax production in ''Arabidopsis''. Additionally, pathways presented within the paper indicated genes involved specifically in ketone production. Based on the relatedness of two genera, I searched for orthologs of ''Arabidopsis'' within the ''Vaccinium'' scaffold collection. Genes were chosen to represent a variety of roles within wax synthesis and secretion.
 +
 
 +
 
 +
Target genes: ''WBC11'' (transporter: wax secretion); ''CER6'' (fatty acid elongation); ''WSD'' (wax production); ''FATB'' (wax production); ''MAH1'' (ketone production)
  
−
Target genes: ''MAH1'' (ketone production), ''FATB'' (wax production), ''WSD'' (wax production), ''CER6'' (fatty acid elongation), ''WBC11'' (transporter: wax secretion)
 
  
 
[[File:Arabidopsis_wax_pathway.jpg]]
 
[[File:Arabidopsis_wax_pathway.jpg]]
Line 20: Line 21:
 
'''Finding orthologs'''
 
'''Finding orthologs'''
  
−
Samuels et al. provided MIPS accession numbers for each gene. Entering each number into [http://www.arabidopsis.org The Arabidopsis Information Resource] provides links to FASTA sequences for the gene in ''Arabidopsis''. Scaffolds of the ''V. corymbosum'' genome containing possible orthologs were found using the tBLASTx tool on the [http://dev.vaccinium.org ''Vaccinium''] website. Scaffolds were chosen based on E-score. SSRs (and primers for each SSR) were found for each scaffold using the SSR tool on the [http://dev.vaccinium.org ''Vaccinium''] website. SSRs for Marker Assisted Breeding (MAB) were chosen based on proximity to the region of the scaffold aligning with the submitted ''Arabidopsis'' gene. Also, di- and trinucleotide repeats of 5 or greater were favored and PCR products were required to fall between 100 and 700 bp.
+
Samuels et al. provided MIPS accession numbers for each gene. Entering each number into [http://www.arabidopsis.org The Arabidopsis Information Resource] provides links to FASTA sequences for the gene in ''Arabidopsis''. Scaffolds of the ''V. corymbosum'' genome containing possible orthologs were found using the tBLASTx tool on the [http://dev.vaccinium.org ''Vaccinium''] website. Scaffolds were chosen based on E-score. SSRs (and primers for each SSR) were found for each scaffold using the SSR tool on the [http://dev.vaccinium.org ''Vaccinium''] website. SSRs were chosen based on proximity to the region of the scaffold aligning with the submitted ''Arabidopsis'' gene. Also, di- and trinucleotide repeats of 5 or greater were favored and PCR products were required to fall between 100 and 700 bp.
  
  
Line 26: Line 27:
  
  
−
''FATB''
+
''WBC11''
 +
 
 +
 
 +
 
 +
Scaffold 00913 (Aligning region: 72307 - 93373 bp)
 +
 
 +
1. Forward Primer GTGCTAGAATCCCCTGAAACAC & Reverse Primer CCCCCTCTCTCTTTCTTCCTAT (ga) x5 PCR product = 165 (64928 - 64937 bp)
 +
 
 +
2. Forward Primer GTGTGCATCTCTCTCTGATTGC & Reverse Primer TCTCTCCCATCTTAAAACCCAA (ga) x5 PCR product = 132 (96985 - 96994 bp)
 +
 
 +
3. Forward Primer CCGTAAGTAGCGAGGAGACTGT & Reverse Primer ACAAATTCGGACGGAGAGAGTA (ga) x9 PCR product = 227 (100495 - 100512 bp)
 +
 
  
 +
Scaffold 01191 (Aligning region: 8751 - 13731 bp)
  
−
Scaffold 00698
+
1. Forward Primer TCTTATTGGTCCTCGGTGCTAT & Reverse Primer CACAAAATGGCCTAAGTAGGGA (ca) x5 PCR product = 258 (3896 - 3905 bp)
  
−
1. Forward Primer GAAGTCTTCACCACTCCGATTC & Reverse Primer TACCACGCAAAATTATCACCAG (tc) x5 PCR product = 281
+
2. Forward Primer ACTGGAAATGGTAGAAATGGGA & Reverse Primer GAGGAAGAGGAAAAAGGAGGAG (ga) x15 PCR product = 284 (14258 - 14287 bp)
  
−
2. Forward Primer TCCCAATCCAATTGATATCCTC & Reverse Primer TCACTCACCTCTTCCAAGGATT (at) x7 PCR product = 259
 
  
 +
''CER6''
  
−
''WBC11''
 
  
 +
Scaffold 00431 (Aligning region: 45978 - 48317 bp)
  
−
Scaffold 00913
+
1. Forward Primer ATCCGACTTGGTAATTTGATGG & Reverse primer CGGAATGAACACCAACAATAGA (ct) x8 PCR product = 257 (36598 - 36613 bp)
  
−
1. Forward Primer GTGCTAGAATCCCCTGAAACAC & Reverse Primer CCCCCTCTCTCTTTCTTCCTAT (ga) x5 PCR product = 165
+
2. Forward Primer TGCTGAGTGGTGGAGTTCATTA & Reverse primer AAGCCTTACCGCTCTCCTAACT (att) x5 PCR product = 267 (55128 - 55142 bp)
  
−
2. Forward Primer GTGTGCATCTCTCTCTGATTGC & Reverse Primer TCTCTCCCATCTTAAAACCCAA (ga) x5 PCR product = 132
 
  
−
3. Forward Primer CCGTAAGTAGCGAGGAGACTGT & Reverse Primer ACAAATTCGGACGGAGAGAGTA (ga) x9 PCR product = 227
+
Scaffold 00268 (Aligning region: 190730 - 192192 bp)
  
−
Scaffold 01191
+
1. Forward Primer ATTGCAGATCCTTCCAGTCAAT & Reverse primer TTAACATGCCATTGTCGAAGAC (tg) x5 PCR product = 222 (179241 - 179250 bp)
  
−
1. Forward Primer TCAGAGTCACCATCACCGTTAG & Reverse Primer ACTACTACTCGGCAATCGGAAG (cca) x6 PCR product = 256
+
2. Forward Primer TTTGACGTACTTGAGGTTCACG & Reverse primer AAAGAGAGGAGAGAGAGGGAGG (tc) x5 PCR product = 292 (192395 - 192404 bp)
  
−
2. Forward Primer CAATCTATTGAAGGAAGGCTGG & Reverse Primer TCGCAAGCATAGTCACAAACTT (at) x5 PCR product = 269
 
  
 +
Scaffold 00137 (Aligning region: 145956 - 147476 bp)
  
−
''CER6''
+
1. Forward Primer AACACCTTGACGAACTGAACCT & Reverse primer CAATCCAGTATTGAGACAGCCA (tc) x5 PCR product = 107 (143881 - 143890 bp)
  
 +
2. Forward Primer AAATTGCTAGAGTTGCCGTTGT & Reverse primer ATCACATGGACTGGTAGAGCCT (tg) x5 PCR product = 139 (158644 - 158653 bp)
  
−
Scaffold 00431
 
  
−
1. Forward Primer ATCCGACTTGGTAATTTGATGG & Reverse primer CGGAATGAACACCAACAATAGA (ct) x8 PCR product = 257
+
''WSD''
  
−
2. Forward Primer TGCTGAGTGGTGGAGTTCATTA & Reverse primer AAGCCTTACCGCTCTCCTAACT (att) x5 PCR product = 267
 
  
−
Scaffold 00268
+
Scaffold 00550 (Aligning region: 130667 - 130867 bp)
  
−
1. Forward Primer ATTGCAGATCCTTCCAGTCAAT & Reverse primer TTAACATGCCATTGTCGAAGAC (tg) x5 PCR product = 222
+
1. Forward Primer ATGTTATTCCATCCGCCTCTAA & Reverse primer ACCTCAAACAAATAACCCAACG (ga) x5 PCR product = 190 (129038 - 129047 bp)
  
−
2. Forward Primer TTTGACGTACTTGAGGTTCACG & Reverse primer AAAGAGAGGAGAGAGAGGGAGG (tc) x5 PCR product = 292
+
2. Forward Primer AATTGAGAAATGTGAGTCCCGT & Reverse primer GAGACACGCTAAGATTTGCCTT (at) x5 PCR product = 295 (135042 - 135051 bp)
  
−
Scaffold 00137
 
  
−
1. Forward Primer AACACCTTGACGAACTGAACCT & Reverse primer CAATCCAGTATTGAGACAGCCA (tc) x5 PCR product = 107
+
''FATB''
 +
 
  
−
2. Forward Primer AAATTGCTAGAGTTGCCGTTGT & Reverse primer ATCACATGGACTGGTAGAGCCT (tg) x5 PCR product = 139
+
Scaffold 00698 (Aligning region: 13633 - 18095 bp)
  
 +
1. Forward Primer GAAGTCTTCACCACTCCGATTC & Reverse Primer TACCACGCAAAATTATCACCAG (tc) x5 PCR product = 281 (11438 - 11447 bp)
  
−
''WSD''
+
2. Forward Primer TCCCAATCCAATTGATATCCTC & Reverse Primer TCACTCACCTCTTCCAAGGATT (at) x7 PCR product = 259 (19774 - 19787 bp)
  
  
−
Scaffold 00550
+
''MAH1''
  
−
1. Forward Primer ATGTTATTCCATCCGCCTCTAA & Reverse primer ACCTCAAACAAATAACCCAACG (ga) x5 PCR product = 190
 
  
−
2. Forward Primer AATTGAGAAATGTGAGTCCCGT & Reverse primer GAGACACGCTAAGATTTGCCTT (at) x5 PCR product = 295
+
Scaffold 01091 (Aligning region: 124548 - 125522 bp)
  
 +
1. Forward Primer TGTATTAAAGTGTGTGGGGGTG & Reverse Primer TAGAACACGAAAATGGTGTTGG (tc) x11 PCR product = 184 (95581 - 95602 bp)
  
−
''FATB''
+
2. Forward Primer ATAGGCAAAGAATTTTGGGAGG & Reverse Primer TACACACACACACACACACACA (gtat) x8 PCR product = 129 (130046 - 130077 bp)
  
  
−
Scaffold 00698
+
Scaffold 00236 (Aligning region: 226568 - 227989 bp)
  
−
1. Forward Primer GAAGTCTTCACCACTCCGATTC & Reverse Primer TACCACGCAAAATTATCACCAG (tc) x5 PCR product = 281
+
1. Forward Primer ACCACCACCACCTCTCTCTCT & Reverse Primer AAGGTTTTGATGGCTTACCTCA (tca) x7 PCR product = 148 (226187 - 226207 bp)
  
−
2. Forward Primer TCCCAATCCAATTGATATCCTC & Reverse Primer TCACTCACCTCTTCCAAGGATT (at) x7 PCR product = 259
+
2. Forward Primer CTCTTCTCCCCCTTTCATACCT & Reverse Primer CTTCCTGGTGAAGAGAAATTGG (ta) x5 PCR product = 225 (230813 - 230822 bp)

Revision as of 09:03, 15 March 2012

Blueberry coat color

Evidence presented by Albrigo et al. (Media:Albrigo_color.pdf) points to "waxy bloom" contributing highly to coat color in highbush blueberries. Other possible variables (such as pH and anthocyanins) were implicated in juice color but showed little to no influence on coat color. Also, a direct connection between beta-diketone presence and coat color was made by Sapers et al. (Media:Sapers_color.pdf). Berries with more beta-diketones displayed a higher degree of blue hue. Therefore, genes involved in wax production and secretion and beta-diketone synthesis were the focus of my research.


Samuels et al. (Media:Samuels_color.pdf) provided a thorough analysis of wax production in Arabidopsis. Additionally, pathways presented within the paper indicated genes involved specifically in ketone production. Based on the relatedness of two genera, I searched for orthologs of Arabidopsis within the Vaccinium scaffold collection. Genes were chosen to represent a variety of roles within wax synthesis and secretion.


Target genes: WBC11 (transporter: wax secretion); CER6 (fatty acid elongation); WSD (wax production); FATB (wax production); MAH1 (ketone production)


Arabidopsis wax pathway.jpg

Source: Media:Samuels_color.pdf

Arabidopsis wax secretion.jpg

Source: Media:Samuels_color.pdf


Finding orthologs

Samuels et al. provided MIPS accession numbers for each gene. Entering each number into The Arabidopsis Information Resource provides links to FASTA sequences for the gene in Arabidopsis. Scaffolds of the V. corymbosum genome containing possible orthologs were found using the tBLASTx tool on the Vaccinium website. Scaffolds were chosen based on E-score. SSRs (and primers for each SSR) were found for each scaffold using the SSR tool on the Vaccinium website. SSRs were chosen based on proximity to the region of the scaffold aligning with the submitted Arabidopsis gene. Also, di- and trinucleotide repeats of 5 or greater were favored and PCR products were required to fall between 100 and 700 bp.


Results


WBC11


Scaffold 00913 (Aligning region: 72307 - 93373 bp)

1. Forward Primer GTGCTAGAATCCCCTGAAACAC & Reverse Primer CCCCCTCTCTCTTTCTTCCTAT (ga) x5 PCR product = 165 (64928 - 64937 bp)

2. Forward Primer GTGTGCATCTCTCTCTGATTGC & Reverse Primer TCTCTCCCATCTTAAAACCCAA (ga) x5 PCR product = 132 (96985 - 96994 bp)

3. Forward Primer CCGTAAGTAGCGAGGAGACTGT & Reverse Primer ACAAATTCGGACGGAGAGAGTA (ga) x9 PCR product = 227 (100495 - 100512 bp)


Scaffold 01191 (Aligning region: 8751 - 13731 bp)

1. Forward Primer TCTTATTGGTCCTCGGTGCTAT & Reverse Primer CACAAAATGGCCTAAGTAGGGA (ca) x5 PCR product = 258 (3896 - 3905 bp)

2. Forward Primer ACTGGAAATGGTAGAAATGGGA & Reverse Primer GAGGAAGAGGAAAAAGGAGGAG (ga) x15 PCR product = 284 (14258 - 14287 bp)


CER6


Scaffold 00431 (Aligning region: 45978 - 48317 bp)

1. Forward Primer ATCCGACTTGGTAATTTGATGG & Reverse primer CGGAATGAACACCAACAATAGA (ct) x8 PCR product = 257 (36598 - 36613 bp)

2. Forward Primer TGCTGAGTGGTGGAGTTCATTA & Reverse primer AAGCCTTACCGCTCTCCTAACT (att) x5 PCR product = 267 (55128 - 55142 bp)


Scaffold 00268 (Aligning region: 190730 - 192192 bp)

1. Forward Primer ATTGCAGATCCTTCCAGTCAAT & Reverse primer TTAACATGCCATTGTCGAAGAC (tg) x5 PCR product = 222 (179241 - 179250 bp)

2. Forward Primer TTTGACGTACTTGAGGTTCACG & Reverse primer AAAGAGAGGAGAGAGAGGGAGG (tc) x5 PCR product = 292 (192395 - 192404 bp)


Scaffold 00137 (Aligning region: 145956 - 147476 bp)

1. Forward Primer AACACCTTGACGAACTGAACCT & Reverse primer CAATCCAGTATTGAGACAGCCA (tc) x5 PCR product = 107 (143881 - 143890 bp)

2. Forward Primer AAATTGCTAGAGTTGCCGTTGT & Reverse primer ATCACATGGACTGGTAGAGCCT (tg) x5 PCR product = 139 (158644 - 158653 bp)


WSD


Scaffold 00550 (Aligning region: 130667 - 130867 bp)

1. Forward Primer ATGTTATTCCATCCGCCTCTAA & Reverse primer ACCTCAAACAAATAACCCAACG (ga) x5 PCR product = 190 (129038 - 129047 bp)

2. Forward Primer AATTGAGAAATGTGAGTCCCGT & Reverse primer GAGACACGCTAAGATTTGCCTT (at) x5 PCR product = 295 (135042 - 135051 bp)


FATB


Scaffold 00698 (Aligning region: 13633 - 18095 bp)

1. Forward Primer GAAGTCTTCACCACTCCGATTC & Reverse Primer TACCACGCAAAATTATCACCAG (tc) x5 PCR product = 281 (11438 - 11447 bp)

2. Forward Primer TCCCAATCCAATTGATATCCTC & Reverse Primer TCACTCACCTCTTCCAAGGATT (at) x7 PCR product = 259 (19774 - 19787 bp)


MAH1


Scaffold 01091 (Aligning region: 124548 - 125522 bp)

1. Forward Primer TGTATTAAAGTGTGTGGGGGTG & Reverse Primer TAGAACACGAAAATGGTGTTGG (tc) x11 PCR product = 184 (95581 - 95602 bp)

2. Forward Primer ATAGGCAAAGAATTTTGGGAGG & Reverse Primer TACACACACACACACACACACA (gtat) x8 PCR product = 129 (130046 - 130077 bp)


Scaffold 00236 (Aligning region: 226568 - 227989 bp)

1. Forward Primer ACCACCACCACCTCTCTCTCT & Reverse Primer AAGGTTTTGATGGCTTACCTCA (tca) x7 PCR product = 148 (226187 - 226207 bp)

2. Forward Primer CTCTTCTCCCCCTTTCATACCT & Reverse Primer CTTCCTGGTGAAGAGAAATTGG (ta) x5 PCR product = 225 (230813 - 230822 bp)

Retrieved from "https://gcat.davidson.edu/GcatWiki/index.php?title=Aaron_D&oldid=14021"