Difference between revisions of "PCR for Bio113"
From GcatWiki
Macampbell (talk | contribs) (Created page with "==Transformations after GGA== You want to do 3 transformations:<br> # a positive control that contains known [http://partsregistry.org/Part:BBa_J04450 PlacI + RBS + RFP] to be...") |
Macampbell (talk | contribs) |
||
| Line 1: | Line 1: | ||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
==PCR Verification of Successful GGA== | ==PCR Verification of Successful GGA== | ||
If you want to PCR verify that GGA has happened, you can use colony PCR and analyze the product by gel electrophoresis (1.7% agarose gel). | If you want to PCR verify that GGA has happened, you can use colony PCR and analyze the product by gel electrophoresis (1.7% agarose gel). | ||
Revision as of 20:12, 18 July 2017
PCR Verification of Successful GGA
If you want to PCR verify that GGA has happened, you can use colony PCR and analyze the product by gel electrophoresis (1.7% agarose gel).
- Use negative control colonies as template to see the MW of the PCR product when TT is still in the plasmid and no GGA has occurred. Run one lane of this negative control PCR product for each row on your gel.
- Use these two primers:
- Forward = 5’ GAATTCGCGGCCGCTTCTAG 3’
- Reverse = 5’ TTTGATAACATCTTCGGAGG 3’
- PCR product with the original TT still in place is 251 bp
- size of TT that should be removed by GGA is 107 bp
