Difference between revisions of "Sequence DNA for Bio113"
From GcatWiki
Macampbell (talk | contribs) |
Macampbell (talk | contribs) (→Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence) |
||
| Line 4: | Line 4: | ||
# Add water to your DNA until the combined volume is 8 µL. | # Add water to your DNA until the combined volume is 8 µL. | ||
# To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL. | # To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL. | ||
| − | # Record your sample and group name for each barcoded tube you used. You should have 3 eXperimental sequencing reactions to send away. Those working with actClone will have | + | # Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away. |
Revision as of 21:23, 6 November 2017
Sequencing Your Plasmid DNA to Confirm Cloned DNA Sequence
- For each eXperimental sample, determine the volume of DNA you need to deliver 320 ng of DNA to a barcoded sequencing tube. Record the bar code for each sample.
- Add water to your DNA until the combined volume is 8 µL.
- To each of your 8 µL of DNA, add 4 μL of the appropriate sequencing primer (at 2 µM concentration) for a total volume of 12 μL.
- Record your sample and group name for each barcoded tube you used. You should have 3 new eXperimental and one old eXperimental sequencing reactions to send away. Those working with actClone will have 8 tubes to send away.
Sequencing Primers to confirm Inserts v2.0
113_pClone_SeqFor
CTAATTCAACAAGAATTGGGAC Tm = 60 C 65bp upstream first base
113_rClone_SeqFor
AACGTGCTGAAGGTCGTC Tm = 65 C 60bp upstream first base
113_actClone_SeqFor
GCATTAGAAACCGTCCATCG Tm = 64 C 73bp upstream first base
113_actClone SeqRev
CCATTAGAAACCATCCCTCG Tm = 63 C 107bp upstream first base
113_repClone_SeqFor
ACAGCTCTTCGCCTTTAC Tm = 62 C 93bp upstream first base
